ATP4B Polyclonal Antibody |
A53516 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: The best epigenetics products |
ATP4B Rabbit pAb |
A10106-100ul |
Abclonal |
100 ul |
EUR 308 |
ATP4B Rabbit pAb |
A10106-200ul |
Abclonal |
200 ul |
EUR 459 |
ATP4B Rabbit pAb |
A10106-20ul |
Abclonal |
20 ul |
EUR 183 |
ATP4B Rabbit pAb |
A10106-50ul |
Abclonal |
50 ul |
EUR 223 |
ATP4B antibody |
70R-6951 |
Fitzgerald |
50 ug |
EUR 467 |
Description: Rabbit polyclonal ATP4B antibody raised against the middle region of ATP4B |
Atp4b antibody |
70R-8600 |
Fitzgerald |
50 ug |
EUR 467 |
Description: Affinity purified rabbit polyclonal Atp4b antibody |
ATP4B Antibody |
35648-100ul |
SAB |
100ul |
EUR 252 |
ATP4B antibody |
70R-15905 |
Fitzgerald |
50 ul |
EUR 435 |
Description: Rabbit polyclonal ATP4B antibody |
ATP4B Antibody |
1-CSB-PA002343EA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against ATP4B. Recognizes ATP4B from Human. This antibody is Unconjugated. Tested in the following application: ELISA |
ATP4B Antibody |
1-CSB-PA002343GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
|
Description: A polyclonal antibody against ATP4B. Recognizes ATP4B from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB |
ATP4B Antibody |
1-CSB-PA017108 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
Description: A polyclonal antibody against ATP4B. Recognizes ATP4B from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:2000, WB:1:200-1:1000, IHC:1:25-1:100 |
Polyclonal ATP4B Antibody (N-term) |
APR10860G |
Leading Biology |
0.1ml |
EUR 528 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human ATP4B (N-term). This antibody is tested and proven to work in the following applications: |
ATP4B Polyclonal Antibody, Biotin Conjugated |
A53513 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: Ask the seller for details |
ATP4B Polyclonal Antibody, FITC Conjugated |
A53514 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: The best epigenetics products |
ATP4B Polyclonal Antibody, HRP Conjugated |
A53515 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: kits suitable for this type of research |
Human ATPase, H+/K+ Exchanging Beta Polypeptide (ATP4b) ELISA Kit |
DLR-ATP4b-Hu-48T |
DL Develop |
48T |
EUR 517 |
- Should the Human ATPase, H+/K+ Exchanging Beta Polypeptide (ATP4b) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human ATPase, H+/K+ Exchanging Beta Polypeptide (ATP4b) in samples from tissue homogenates or other biological fluids. |
Human ATPase, H+/K+ Exchanging Beta Polypeptide (ATP4b) ELISA Kit |
DLR-ATP4b-Hu-96T |
DL Develop |
96T |
EUR 673 |
- Should the Human ATPase, H+/K+ Exchanging Beta Polypeptide (ATP4b) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human ATPase, H+/K+ Exchanging Beta Polypeptide (ATP4b) in samples from tissue homogenates or other biological fluids. |
Mouse ATPase, H+/K+ Exchanging Beta Polypeptide (ATP4b) ELISA Kit |
DLR-ATP4b-Mu-48T |
DL Develop |
48T |
EUR 527 |
- Should the Mouse ATPase, H+/K+ Exchanging Beta Polypeptide (ATP4b) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Mouse ATPase, H+/K+ Exchanging Beta Polypeptide (ATP4b) in samples from tissue homogenates or other biological fluids. |
Mouse ATPase, H+/K+ Exchanging Beta Polypeptide (ATP4b) ELISA Kit |
DLR-ATP4b-Mu-96T |
DL Develop |
96T |
EUR 688 |
- Should the Mouse ATPase, H+/K+ Exchanging Beta Polypeptide (ATP4b) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Mouse ATPase, H+/K+ Exchanging Beta Polypeptide (ATP4b) in samples from tissue homogenates or other biological fluids. |
Rat ATPase, H+/K+ Exchanging Beta Polypeptide (ATP4b) ELISA Kit |
DLR-ATP4b-Ra-48T |
DL Develop |
48T |
EUR 549 |
- Should the Rat ATPase, H+/K+ Exchanging Beta Polypeptide (ATP4b) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Rat ATPase, H+/K+ Exchanging Beta Polypeptide (ATP4b) in samples from tissue homogenates or other biological fluids. |
Rat ATPase, H+/K+ Exchanging Beta Polypeptide (ATP4b) ELISA Kit |
DLR-ATP4b-Ra-96T |
DL Develop |
96T |
EUR 718 |
- Should the Rat ATPase, H+/K+ Exchanging Beta Polypeptide (ATP4b) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Rat ATPase, H+/K+ Exchanging Beta Polypeptide (ATP4b) in samples from tissue homogenates or other biological fluids. |
Human ATPase, H+/K+ Exchanging Beta Polypeptide (ATP4b) ELISA Kit |
RD-ATP4b-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 521 |
Human ATPase, H+/K+ Exchanging Beta Polypeptide (ATP4b) ELISA Kit |
RD-ATP4b-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 723 |
Mouse ATPase, H+/K+ Exchanging Beta Polypeptide (ATP4b) ELISA Kit |
RD-ATP4b-Mu-48Tests |
Reddot Biotech |
48 Tests |
EUR 533 |
Mouse ATPase, H+/K+ Exchanging Beta Polypeptide (ATP4b) ELISA Kit |
RD-ATP4b-Mu-96Tests |
Reddot Biotech |
96 Tests |
EUR 740 |
Rat ATPase, H+/K+ Exchanging Beta Polypeptide (ATP4b) ELISA Kit |
RD-ATP4b-Ra-48Tests |
Reddot Biotech |
48 Tests |
EUR 557 |
Rat ATPase, H+/K+ Exchanging Beta Polypeptide (ATP4b) ELISA Kit |
RD-ATP4b-Ra-96Tests |
Reddot Biotech |
96 Tests |
EUR 775 |
Human ATPase, H+/K+ Exchanging Beta Polypeptide (ATP4b) ELISA Kit |
RDR-ATP4b-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 544 |
Human ATPase, H+/K+ Exchanging Beta Polypeptide (ATP4b) ELISA Kit |
RDR-ATP4b-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 756 |
Mouse ATPase, H+/K+ Exchanging Beta Polypeptide (ATP4b) ELISA Kit |
RDR-ATP4b-Mu-48Tests |
Reddot Biotech |
48 Tests |
EUR 557 |
Mouse ATPase, H+/K+ Exchanging Beta Polypeptide (ATP4b) ELISA Kit |
RDR-ATP4b-Mu-96Tests |
Reddot Biotech |
96 Tests |
EUR 774 |
Rat ATPase, H+/K+ Exchanging Beta Polypeptide (ATP4b) ELISA Kit |
RDR-ATP4b-Ra-48Tests |
Reddot Biotech |
48 Tests |
EUR 583 |
Rat ATPase, H+/K+ Exchanging Beta Polypeptide (ATP4b) ELISA Kit |
RDR-ATP4b-Ra-96Tests |
Reddot Biotech |
96 Tests |
EUR 811 |
ATP4B Conjugated Antibody |
C35648 |
SAB |
100ul |
EUR 397 |
anti- ATP4B antibody |
FNab00701 |
FN Test |
100µg |
EUR 505.25 |
- Recommended dilution: WB: 1:500 - 1:2000
- IHC: 1:50 - 1:200
- Immunogen: ATPase, H+/K+ exchanging, beta polypeptide
- Uniprot ID: P51164
- Gene ID: 496
- Research Area: Metabolism
|
Description: Antibody raised against ATP4B |
Anti-ATP4B antibody |
STJ112145 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: The protein encoded by this gene belongs to a family of P-type cation-transporting ATPases. The gastric H+, K+-ATPase is a heterodimer consisting of a high molecular weight catalytic alpha subunit and a smaller but heavily glycosylated beta subunit. This enzyme is a proton pump that catalyzes the hydrolysis of ATP coupled with the exchange of H(+) and K(+) ions across the plasma membrane. It is also responsible for gastric acid secretion. This gene encodes the beta subunit of the gastric H+, K+-ATPase. |
Anti-ATP4B antibody |
STJ191197 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to ATP4B |
ATP4B siRNA |
20-abx900522 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
ATP4B siRNA |
20-abx908558 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
ATP4B siRNA |
20-abx908559 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
ATP4B Antibody, HRP conjugated |
1-CSB-PA002343EB01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against ATP4B. Recognizes ATP4B from Human. This antibody is HRP conjugated. Tested in the following application: ELISA |
ATP4B Antibody, FITC conjugated |
1-CSB-PA002343EC01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against ATP4B. Recognizes ATP4B from Human. This antibody is FITC conjugated. Tested in the following application: ELISA |
ATP4B Antibody, Biotin conjugated |
1-CSB-PA002343ED01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against ATP4B. Recognizes ATP4B from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA |
Atp4b Blocking Peptide |
33R-7677 |
Fitzgerald |
100 ug |
EUR 180 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of Atp4b antibody, catalog no. 70R-8600 |
ATP4B Blocking Peptide |
33R-7776 |
Fitzgerald |
100 ug |
EUR 180 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of ATP4B antibody, catalog no. 70R-6951 |
ATP4B cloning plasmid |
CSB-CL002343HU-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 876
- Sequence: atggcggctctgcaggagaagaagacgtgtggccagcgcatggaggagttccagcgttactgctggaacccggacacggggcagatgctgggccgcaccctgtcccggtgggtgtggatcagcctgtactacgtggccttctacgtggtgatgactgggctcttcgccctgtgcct
- Show more
|
Description: A cloning plasmid for the ATP4B gene. |
Rabbit Potassium- transporting ATPase subunit beta, ATP4B ELISA |
ELI-34316Ra |
Lifescience Market |
96 Tests |
EUR 928 |
Rat ATP4B shRNA Plasmid |
20-abx984385 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Human ATP4B shRNA Plasmid |
20-abx950349 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Mouse ATP4B shRNA Plasmid |
20-abx969274 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
ATP4B Recombinant Protein (Human) |
RP002296 |
ABM |
100 ug |
Ask for price |
ATP4B Recombinant Protein (Rat) |
RP191456 |
ABM |
100 ug |
Ask for price |
ATP4B Recombinant Protein (Mouse) |
RP117971 |
ABM |
100 ug |
Ask for price |
Rabbit Potassium transporting ATPase subunit β(ATP4B) ELISA kit |
E04P0799-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Rabbit Potassium transporting ATPase subunit β(ATP4B) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit Potassium transporting ATPase subunit β(ATP4B) ELISA kit |
E04P0799-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Rabbit Potassium transporting ATPase subunit β(ATP4B) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit Potassium transporting ATPase subunit β(ATP4B) ELISA kit |
E04P0799-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Rabbit Potassium transporting ATPase subunit β(ATP4B) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Anti-Hydrogen Potassium ATPase Beta/ATP4B Antibody |
A08719-1 |
BosterBio |
100ug/vial |
EUR 294 |
ATP4B ORF Vector (Human) (pORF) |
ORF000766 |
ABM |
1.0 ug DNA |
EUR 95 |
Atp4b ORF Vector (Mouse) (pORF) |
ORF039325 |
ABM |
1.0 ug DNA |
EUR 506 |
Atp4b ORF Vector (Rat) (pORF) |
ORF063820 |
ABM |
1.0 ug DNA |
EUR 506 |
ATPase, H+/K+ Exchanging Beta Polypeptide (ATP4B) Antibody |
20-abx111155 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
ATPase, H+/K+ Exchanging Beta Polypeptide (ATP4B) Antibody |
20-abx110108 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
ATPase, H+/K+ Exchanging Beta Polypeptide (ATP4B) Antibody |
20-abx136016 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
ATPase, H+/K+ Exchanging Beta Polypeptide (ATP4B) Antibody |
abx037938-100ug |
Abbexa |
100 ug |
EUR 391 |
- Shipped within 5-10 working days.
|
ATPase, H+/K+ Exchanging Beta Polypeptide (ATP4B) Antibody |
abx032433-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
ATPase, H+/K+ Exchanging Beta Polypeptide (ATP4B) Antibody |
abx032433-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
ATPase, H+/K+ Exchanging Beta Polypeptide (ATP4b) Antibody |
20-abx175505 |
Abbexa |
|
|
|
ATPase, H+/K+ Exchanging Beta Polypeptide (ATP4b) Antibody |
20-abx175506 |
Abbexa |
|
|
|
ATPase, H+/K+ Exchanging Beta Polypeptide (ATP4B) Antibody |
20-abx214013 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
ATPase, H+/K+ Exchanging Beta Polypeptide (ATP4B) Antibody |
abx230701-100ug |
Abbexa |
100 ug |
EUR 481 |
- Shipped within 5-12 working days.
|
ATP4B sgRNA CRISPR Lentivector set (Human) |
K0146701 |
ABM |
3 x 1.0 ug |
EUR 339 |
Atp4b sgRNA CRISPR Lentivector set (Mouse) |
K3780701 |
ABM |
3 x 1.0 ug |
EUR 339 |
Atp4b sgRNA CRISPR Lentivector set (Rat) |
K6902401 |
ABM |
3 x 1.0 ug |
EUR 339 |
ATPase, H+/K+ Exchanging Beta Polypeptide (ATP4B) Antibody (HRP) |
20-abx108624 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
ATPase, H+/K+ Exchanging Beta Polypeptide (ATP4B) Antibody (Biotin) |
20-abx105786 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
ATPase, H+/K+ Exchanging Beta Polypeptide (ATP4B) Antibody (FITC) |
20-abx107204 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
ATP4B sgRNA CRISPR Lentivector (Human) (Target 1) |
K0146702 |
ABM |
1.0 ug DNA |
EUR 154 |
ATP4B sgRNA CRISPR Lentivector (Human) (Target 2) |
K0146703 |
ABM |
1.0 ug DNA |
EUR 154 |
ATP4B sgRNA CRISPR Lentivector (Human) (Target 3) |
K0146704 |
ABM |
1.0 ug DNA |
EUR 154 |
Human Potassium-transporting ATPase subunit beta (ATP4B) |
1-CSB-YP002343HU |
Cusabio |
-
EUR 430.00
-
EUR 234.00
-
EUR 1508.00
-
EUR 642.00
-
EUR 1009.00
-
EUR 291.00
|
-
100ug
-
10ug
-
1MG
-
200ug
-
500ug
-
50ug
|
- MW: 28.6 kDa
- Buffer composition: Tris-based buffer with 50% glycerol.
|
Description: Recombinant Human Potassium-transporting ATPase subunit beta(ATP4B),partial expressed in Yeast |
Human Potassium-transporting ATPase subunit beta (ATP4B) |
1-CSB-EP002343HU |
Cusabio |
-
EUR 380.00
-
EUR 214.00
-
EUR 1309.00
-
EUR 560.00
-
EUR 873.00
-
EUR 262.00
|
-
100ug
-
10ug
-
1MG
-
200ug
-
500ug
-
50ug
|
- MW: 53.6 kDa
- Buffer composition: Tris-based buffer with 50% glycerol.
|
Description: Recombinant Human Potassium-transporting ATPase subunit beta(ATP4B),partial expressed in E.coli |
Human Potassium-transporting ATPase subunit beta (ATP4B) |
1-CSB-EP002343HUe1 |
Cusabio |
-
EUR 496.00
-
EUR 330.00
-
EUR 1425.00
-
EUR 677.00
-
EUR 989.00
-
EUR 378.00
|
-
100ug
-
10ug
-
1MG
-
200ug
-
500ug
-
50ug
|
- MW: 26.6 kDa
- Buffer composition: Tris-based buffer with 50% glycerol.
|
Description: Recombinant Human Potassium-transporting ATPase subunit beta(ATP4B),Partial expressed in E.coli |
Atp4b sgRNA CRISPR Lentivector (Mouse) (Target 1) |
K3780702 |
ABM |
1.0 ug DNA |
EUR 154 |
Atp4b sgRNA CRISPR Lentivector (Mouse) (Target 2) |
K3780703 |
ABM |
1.0 ug DNA |
EUR 154 |
Atp4b sgRNA CRISPR Lentivector (Mouse) (Target 3) |
K3780704 |
ABM |
1.0 ug DNA |
EUR 154 |
ATP4B Protein Vector (Human) (pPB-C-His) |
PV003061 |
ABM |
500 ng |
EUR 329 |
ATP4B Protein Vector (Human) (pPB-N-His) |
PV003062 |
ABM |
500 ng |
EUR 329 |
ATP4B Protein Vector (Human) (pPM-C-HA) |
PV003063 |
ABM |
500 ng |
EUR 329 |
ATP4B Protein Vector (Human) (pPM-C-His) |
PV003064 |
ABM |
500 ng |
EUR 329 |
Atp4b sgRNA CRISPR Lentivector (Rat) (Target 1) |
K6902402 |
ABM |
1.0 ug DNA |
EUR 154 |
Atp4b sgRNA CRISPR Lentivector (Rat) (Target 2) |
K6902403 |
ABM |
1.0 ug DNA |
EUR 154 |
Atp4b sgRNA CRISPR Lentivector (Rat) (Target 3) |
K6902404 |
ABM |
1.0 ug DNA |
EUR 154 |
ATP4B Protein Vector (Human) (pPB-His-MBP) |
PV325046 |
ABM |
500 ng |
EUR 329 |
ATP4B Protein Vector (Human) (pPB-His-GST) |
PV325047 |
ABM |
500 ng |
EUR 329 |
ATP4B Protein Vector (Rat) (pPB-C-His) |
PV255278 |
ABM |
500 ng |
EUR 603 |
ATP4B Protein Vector (Rat) (pPB-N-His) |
PV255279 |
ABM |
500 ng |
EUR 603 |
ATP4B Protein Vector (Rat) (pPM-C-HA) |
PV255280 |
ABM |
500 ng |
EUR 603 |
ATP4B Protein Vector (Rat) (pPM-C-His) |
PV255281 |
ABM |
500 ng |
EUR 603 |
ATP4B Protein Vector (Mouse) (pPB-C-His) |
PV157298 |
ABM |
500 ng |
EUR 603 |
ATP4B Protein Vector (Mouse) (pPB-N-His) |
PV157299 |
ABM |
500 ng |
EUR 603 |
ATP4B Protein Vector (Mouse) (pPM-C-HA) |
PV157300 |
ABM |
500 ng |
EUR 603 |
ATP4B Protein Vector (Mouse) (pPM-C-His) |
PV157301 |
ABM |
500 ng |
EUR 603 |
Atp4b 3'UTR Luciferase Stable Cell Line |
TU201076 |
ABM |
1.0 ml |
Ask for price |
Atp4b 3'UTR GFP Stable Cell Line |
TU152320 |
ABM |
1.0 ml |
Ask for price |
ATP4B 3'UTR Luciferase Stable Cell Line |
TU001389 |
ABM |
1.0 ml |
EUR 1394 |
Atp4b 3'UTR Luciferase Stable Cell Line |
TU102320 |
ABM |
1.0 ml |
Ask for price |
ATP4B 3'UTR GFP Stable Cell Line |
TU051389 |
ABM |
1.0 ml |
EUR 1394 |
Atp4b 3'UTR GFP Stable Cell Line |
TU251076 |
ABM |
1.0 ml |
Ask for price |
VEGF Rabbit Polyclonal Antibody |
ES8453-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
VEGF Rabbit Polyclonal Antibody |
ES8453-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
CD10 Rabbit Polyclonal Antibody |
ES8454-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
CD10 Rabbit Polyclonal Antibody |
ES8454-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NM23A Rabbit Polyclonal Antibody |
ES8455-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NM23A Rabbit Polyclonal Antibody |
ES8455-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8456-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8456-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8457-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8457-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
HSC70 Rabbit Polyclonal Antibody |
ES8558-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSC70 Rabbit Polyclonal Antibody |
ES8558-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSP40 Rabbit Polyclonal Antibody |
ES8559-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSP40 Rabbit Polyclonal Antibody |
ES8559-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSP90? Rabbit Polyclonal Antibody |
ES8560-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
HSP90? Rabbit Polyclonal Antibody |
ES8560-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
IkB ? Rabbit Polyclonal Antibody |
ES8561-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
IkB ? Rabbit Polyclonal Antibody |
ES8561-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
JAK1 Rabbit Polyclonal Antibody |
ES8562-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JAK1 Rabbit Polyclonal Antibody |
ES8562-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JAK2 Rabbit Polyclonal Antibody |
ES8563-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JAK2 Rabbit Polyclonal Antibody |
ES8563-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JNK2 Rabbit Polyclonal Antibody |
ES8564-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
JNK2 Rabbit Polyclonal Antibody |
ES8564-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
JNK3 Rabbit Polyclonal Antibody |
ES8565-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JNK3 Rabbit Polyclonal Antibody |
ES8565-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
MEK2 Rabbit Polyclonal Antibody |
ES8566-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC |
MEK2 Rabbit Polyclonal Antibody |
ES8566-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC |
MEK3 Rabbit Polyclonal Antibody |
ES8567-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
MEK3 Rabbit Polyclonal Antibody |
ES8567-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
Nrf2 Rabbit Polyclonal Antibody |
ES8568-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
Nrf2 Rabbit Polyclonal Antibody |
ES8568-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4a Rabbit Polyclonal Antibody |
ES8569-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4a Rabbit Polyclonal Antibody |
ES8569-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4b Rabbit Polyclonal Antibody |
ES8570-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4b Rabbit Polyclonal Antibody |
ES8570-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4c Rabbit Polyclonal Antibody |
ES8571-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4c Rabbit Polyclonal Antibody |
ES8571-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG5 Rabbit Polyclonal Antibody |
ES8572-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG5 Rabbit Polyclonal Antibody |
ES8572-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG7 Rabbit Polyclonal Antibody |
ES8573-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG7 Rabbit Polyclonal Antibody |
ES8573-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG13 Rabbit Polyclonal Antibody |
ES8574-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG13 Rabbit Polyclonal Antibody |
ES8574-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG13 Rabbit Polyclonal Antibody |
ES8575-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG13 Rabbit Polyclonal Antibody |
ES8575-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG14L Rabbit Polyclonal Antibody |
ES8576-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG14L Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG14L Rabbit Polyclonal Antibody |
ES8576-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG14L Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NBR1 Rabbit Polyclonal Antibody |
ES8578-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NBR1 Rabbit Polyclonal Antibody |
ES8578-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NBR1 Rabbit Polyclonal Antibody |
ES8579-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NBR1 Rabbit Polyclonal Antibody |
ES8579-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATP4B Rabbit Polyclonal Antibody