 ATP4B Polyclonal Antibody |
|
ES10039-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATP4B from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA |
 ATP4B Rabbit pAb |
|
A10106-100ul |
Abclonal |
100 ul |
EUR 308 |
ATP4B Rabbit pAb |
|
A10106-200ul |
Abclonal |
200 ul |
EUR 459 |
ATP4B Rabbit pAb |
|
A10106-20ul |
Abclonal |
20 ul |
EUR 183 |
ATP4B Rabbit pAb |
|
A10106-50ul |
Abclonal |
50 ul |
EUR 223 |
 ATP4B antibody |
|
70R-15905 |
Fitzgerald |
50 ul |
EUR 435 |
|
Description: Rabbit polyclonal ATP4B antibody |
 ATP4B Antibody |
|
35648-100ul |
SAB |
100ul |
EUR 252 |
ATP4B Antibody |
|
1-CSB-PA002343EA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
|
|
Description: A polyclonal antibody against ATP4B. Recognizes ATP4B from Human. This antibody is Unconjugated. Tested in the following application: ELISA |
ATP4B Antibody |
|
1-CSB-PA002343GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
|
|
Description: A polyclonal antibody against ATP4B. Recognizes ATP4B from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB |
ATP4B Antibody |
|
1-CSB-PA017108 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
|
Description: A polyclonal antibody against ATP4B. Recognizes ATP4B from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:2000, WB:1:200-1:1000, IHC:1:25-1:100 |
ATP4B antibody |
|
70R-6951 |
Fitzgerald |
50 ug |
EUR 467 |
|
Description: Rabbit polyclonal ATP4B antibody raised against the middle region of ATP4B |
 Atp4b antibody |
|
70R-8600 |
Fitzgerald |
50 ug |
EUR 467 |
|
Description: Affinity purified rabbit polyclonal Atp4b antibody |
) Polyclonal ATP4B Antibody (N-term) |
|
APR10860G |
Leading Biology |
0.1ml |
EUR 528 |
|
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human ATP4B (N-term). This antibody is tested and proven to work in the following applications: |
 ATP4B Polyclonal Antibody, Biotin Conjugated |
|
A53513 |
EpiGentek |
100 µg |
EUR 570.55 |
|
Description: Ask the seller for details |
 ATP4B Polyclonal Antibody, FITC Conjugated |
|
A53514 |
EpiGentek |
100 µg |
EUR 570.55 |
|
Description: The best epigenetics products |
 ATP4B Polyclonal Antibody, HRP Conjugated |
|
A53515 |
EpiGentek |
100 µg |
EUR 570.55 |
|
Description: kits suitable for this type of research |
 ELISA Kit) Human ATPase, H+/K+ Exchanging Beta Polypeptide (ATP4b) ELISA Kit |
|
DLR-ATP4b-Hu-48T |
DL Develop |
48T |
EUR 517 |
- Should the Human ATPase, H+/K+ Exchanging Beta Polypeptide (ATP4b) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
|
Description: A sandwich quantitative ELISA assay kit for detection of Human ATPase, H+/K+ Exchanging Beta Polypeptide (ATP4b) in samples from tissue homogenates or other biological fluids. |
Human ATPase, H+/K+ Exchanging Beta Polypeptide (ATP4b) ELISA Kit |
|
DLR-ATP4b-Hu-96T |
DL Develop |
96T |
EUR 673 |
- Should the Human ATPase, H+/K+ Exchanging Beta Polypeptide (ATP4b) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
|
Description: A sandwich quantitative ELISA assay kit for detection of Human ATPase, H+/K+ Exchanging Beta Polypeptide (ATP4b) in samples from tissue homogenates or other biological fluids. |
 ELISA Kit) Mouse ATPase, H+/K+ Exchanging Beta Polypeptide (ATP4b) ELISA Kit |
|
DLR-ATP4b-Mu-48T |
DL Develop |
48T |
EUR 527 |
- Should the Mouse ATPase, H+/K+ Exchanging Beta Polypeptide (ATP4b) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
|
Description: A sandwich quantitative ELISA assay kit for detection of Mouse ATPase, H+/K+ Exchanging Beta Polypeptide (ATP4b) in samples from tissue homogenates or other biological fluids. |
Mouse ATPase, H+/K+ Exchanging Beta Polypeptide (ATP4b) ELISA Kit |
|
DLR-ATP4b-Mu-96T |
DL Develop |
96T |
EUR 688 |
- Should the Mouse ATPase, H+/K+ Exchanging Beta Polypeptide (ATP4b) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
|
Description: A sandwich quantitative ELISA assay kit for detection of Mouse ATPase, H+/K+ Exchanging Beta Polypeptide (ATP4b) in samples from tissue homogenates or other biological fluids. |
 ELISA Kit) Rat ATPase, H+/K+ Exchanging Beta Polypeptide (ATP4b) ELISA Kit |
|
DLR-ATP4b-Ra-48T |
DL Develop |
48T |
EUR 549 |
- Should the Rat ATPase, H+/K+ Exchanging Beta Polypeptide (ATP4b) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
|
Description: A sandwich quantitative ELISA assay kit for detection of Rat ATPase, H+/K+ Exchanging Beta Polypeptide (ATP4b) in samples from tissue homogenates or other biological fluids. |
Rat ATPase, H+/K+ Exchanging Beta Polypeptide (ATP4b) ELISA Kit |
|
DLR-ATP4b-Ra-96T |
DL Develop |
96T |
EUR 718 |
- Should the Rat ATPase, H+/K+ Exchanging Beta Polypeptide (ATP4b) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
|
Description: A sandwich quantitative ELISA assay kit for detection of Rat ATPase, H+/K+ Exchanging Beta Polypeptide (ATP4b) in samples from tissue homogenates or other biological fluids. |
Human ATPase, H+/K+ Exchanging Beta Polypeptide (ATP4b) ELISA Kit |
|
RDR-ATP4b-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 544 |
Human ATPase, H+/K+ Exchanging Beta Polypeptide (ATP4b) ELISA Kit |
|
RDR-ATP4b-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 756 |
Mouse ATPase, H+/K+ Exchanging Beta Polypeptide (ATP4b) ELISA Kit |
|
RDR-ATP4b-Mu-48Tests |
Reddot Biotech |
48 Tests |
EUR 557 |
Mouse ATPase, H+/K+ Exchanging Beta Polypeptide (ATP4b) ELISA Kit |
|
RDR-ATP4b-Mu-96Tests |
Reddot Biotech |
96 Tests |
EUR 774 |
Rat ATPase, H+/K+ Exchanging Beta Polypeptide (ATP4b) ELISA Kit |
|
RDR-ATP4b-Ra-48Tests |
Reddot Biotech |
48 Tests |
EUR 583 |
Rat ATPase, H+/K+ Exchanging Beta Polypeptide (ATP4b) ELISA Kit |
|
RDR-ATP4b-Ra-96Tests |
Reddot Biotech |
96 Tests |
EUR 811 |
Human ATPase, H+/K+ Exchanging Beta Polypeptide (ATP4b) ELISA Kit |
|
RD-ATP4b-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 521 |
Human ATPase, H+/K+ Exchanging Beta Polypeptide (ATP4b) ELISA Kit |
|
RD-ATP4b-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 723 |
Mouse ATPase, H+/K+ Exchanging Beta Polypeptide (ATP4b) ELISA Kit |
|
RD-ATP4b-Mu-48Tests |
Reddot Biotech |
48 Tests |
EUR 533 |
Mouse ATPase, H+/K+ Exchanging Beta Polypeptide (ATP4b) ELISA Kit |
|
RD-ATP4b-Mu-96Tests |
Reddot Biotech |
96 Tests |
EUR 740 |
Rat ATPase, H+/K+ Exchanging Beta Polypeptide (ATP4b) ELISA Kit |
|
RD-ATP4b-Ra-48Tests |
Reddot Biotech |
48 Tests |
EUR 557 |
Rat ATPase, H+/K+ Exchanging Beta Polypeptide (ATP4b) ELISA Kit |
|
RD-ATP4b-Ra-96Tests |
Reddot Biotech |
96 Tests |
EUR 775 |
 ATP4B Conjugated Antibody |
|
C35648 |
SAB |
100ul |
EUR 397 |
 anti- ATP4B antibody |
|
FNab00701 |
FN Test |
100µg |
EUR 505.25 |
- Recommended dilution: WB: 1:500 - 1:2000
- IHC: 1:50 - 1:200
- Immunogen: ATPase, H+/K+ exchanging, beta polypeptide
- Uniprot ID: P51164
- Gene ID: 496
- Research Area: Metabolism
|
|
Description: Antibody raised against ATP4B |
 Anti-ATP4B antibody |
|
STJ112145 |
St John's Laboratory |
100 µl |
EUR 277 |
|
Description: The protein encoded by this gene belongs to a family of P-type cation-transporting ATPases. The gastric H+, K+-ATPase is a heterodimer consisting of a high molecular weight catalytic alpha subunit and a smaller but heavily glycosylated beta subunit. This enzyme is a proton pump that catalyzes the hydrolysis of ATP coupled with the exchange of H(+) and K(+) ions across the plasma membrane. It is also responsible for gastric acid secretion. This gene encodes the beta subunit of the gastric H+, K+-ATPase. |
Anti-ATP4B antibody |
|
STJ191197 |
St John's Laboratory |
200 µl |
EUR 197 |
|
Description: Unconjugated Rabbit polyclonal to ATP4B |
 ATP4B siRNA |
|
20-abx900522 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
ATP4B siRNA |
|
20-abx908558 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
ATP4B siRNA |
|
20-abx908559 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
 ATP4B Antibody, HRP conjugated |
|
1-CSB-PA002343EB01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
|
|
Description: A polyclonal antibody against ATP4B. Recognizes ATP4B from Human. This antibody is HRP conjugated. Tested in the following application: ELISA |
 ATP4B Antibody, FITC conjugated |
|
1-CSB-PA002343EC01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
|
|
Description: A polyclonal antibody against ATP4B. Recognizes ATP4B from Human. This antibody is FITC conjugated. Tested in the following application: ELISA |
 ATP4B Antibody, Biotin conjugated |
|
1-CSB-PA002343ED01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
|
|
Description: A polyclonal antibody against ATP4B. Recognizes ATP4B from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA |
 Atp4b Blocking Peptide |
|
33R-7677 |
Fitzgerald |
100 ug |
EUR 180 |
|
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of Atp4b antibody, catalog no. 70R-8600 |
 ATP4B Blocking Peptide |
|
33R-7776 |
Fitzgerald |
100 ug |
EUR 180 |
|
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of ATP4B antibody, catalog no. 70R-6951 |
 ATP4B cloning plasmid |
|
CSB-CL002343HU-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 876
- Sequence: atggcggctctgcaggagaagaagacgtgtggccagcgcatggaggagttccagcgttactgctggaacccggacacggggcagatgctgggccgcaccctgtcccggtgggtgtggatcagcctgtactacgtggccttctacgtggtgatgactgggctcttcgccctgtgcct
- Show more
|
|
Description: A cloning plasmid for the ATP4B gene. |
 Rabbit Potassium- transporting ATPase subunit beta, ATP4B ELISA |
|
ELI-34316Ra |
Lifescience Market |
96 Tests |
EUR 928 |
 Rat ATP4B shRNA Plasmid |
|
20-abx984385 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
 Mouse ATP4B shRNA Plasmid |
|
20-abx969274 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
 Human ATP4B shRNA Plasmid |
|
20-abx950349 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
) ATP4B Recombinant Protein (Human) |
|
RP002296 |
ABM |
100 ug |
Ask for price |
) ATP4B Recombinant Protein (Mouse) |
|
RP117971 |
ABM |
100 ug |
Ask for price |
) ATP4B Recombinant Protein (Rat) |
|
RP191456 |
ABM |
100 ug |
Ask for price |
 ELISA kit) Rabbit Potassium transporting ATPase subunit β(ATP4B) ELISA kit |
|
E04P0799-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A sandwich ELISA for quantitative measurement of Rabbit Potassium transporting ATPase subunit β(ATP4B) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit Potassium transporting ATPase subunit β(ATP4B) ELISA kit |
|
E04P0799-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A sandwich ELISA for quantitative measurement of Rabbit Potassium transporting ATPase subunit β(ATP4B) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit Potassium transporting ATPase subunit β(ATP4B) ELISA kit |
|
E04P0799-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A sandwich ELISA for quantitative measurement of Rabbit Potassium transporting ATPase subunit β(ATP4B) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
 Anti-Hydrogen Potassium ATPase Beta/ATP4B Antibody |
|
A08719-1 |
BosterBio |
100ug/vial |
EUR 294 |
 (pORF)) Atp4b ORF Vector (Rat) (pORF) |
|
ORF063820 |
ABM |
1.0 ug DNA |
EUR 506 |
 (pORF)) ATP4B ORF Vector (Human) (pORF) |
|
ORF000766 |
ABM |
1.0 ug DNA |
EUR 95 |
 (pORF)) Atp4b ORF Vector (Mouse) (pORF) |
|
ORF039325 |
ABM |
1.0 ug DNA |
EUR 506 |
 (OKDD00766)) ATP4b ELISA Kit (Mouse) (OKDD00766) |
|
OKDD00766 |
Aviva Systems Biology |
96 Wells |
EUR 988 |
|
Description: Description of target: Required for stabilization and maturation of the catalytic proton pump alpha subunit and may also involved in cell adhesion and establishing epithelial cell polarity.;Species reactivity: Mouse;Application: ;Assay info: Quantitative Sandwich ELISA;Sensitivity: <0.066ng/mL |
 Antibody) ATPase, H+/K+ Exchanging Beta Polypeptide (ATP4B) Antibody |
|
20-abx214013 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
 Antibody) ATPase, H+/K+ Exchanging Beta Polypeptide (ATP4b) Antibody |
|
20-abx175505 |
Abbexa |
|
|
|
|
ATPase, H+/K+ Exchanging Beta Polypeptide (ATP4b) Antibody |
|
20-abx175506 |
Abbexa |
|
|
|
|
ATPase, H+/K+ Exchanging Beta Polypeptide (ATP4B) Antibody |
|
20-abx110108 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
ATPase, H+/K+ Exchanging Beta Polypeptide (ATP4B) Antibody |
|
20-abx111155 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
ATPase, H+/K+ Exchanging Beta Polypeptide (ATP4B) Antibody |
|
abx037938-100ug |
Abbexa |
100 ug |
EUR 391 |
- Shipped within 5-10 working days.
|
ATPase, H+/K+ Exchanging Beta Polypeptide (ATP4B) Antibody |
|
20-abx136016 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
ATPase, H+/K+ Exchanging Beta Polypeptide (ATP4B) Antibody |
|
abx032433-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
ATPase, H+/K+ Exchanging Beta Polypeptide (ATP4B) Antibody |
|
abx032433-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
ATPase, H+/K+ Exchanging Beta Polypeptide (ATP4B) Antibody |
|
abx230701-100ug |
Abbexa |
100 ug |
EUR 481 |
- Shipped within 5-12 working days.
|
) Atp4b sgRNA CRISPR Lentivector set (Rat) |
|
K6902401 |
ABM |
3 x 1.0 ug |
EUR 339 |
) ATP4B sgRNA CRISPR Lentivector set (Human) |
|
K0146701 |
ABM |
3 x 1.0 ug |
EUR 339 |
) Atp4b sgRNA CRISPR Lentivector set (Mouse) |
|
K3780701 |
ABM |
3 x 1.0 ug |
EUR 339 |
 Antibody (Biotin)) ATPase, H+/K+ Exchanging Beta Polypeptide (ATP4B) Antibody (Biotin) |
|
20-abx105786 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
 Antibody (FITC)) ATPase, H+/K+ Exchanging Beta Polypeptide (ATP4B) Antibody (FITC) |
|
20-abx107204 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
 Antibody (HRP)) ATPase, H+/K+ Exchanging Beta Polypeptide (ATP4B) Antibody (HRP) |
|
20-abx108624 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
) Human Potassium-transporting ATPase subunit beta (ATP4B) |
|
1-CSB-EP002343HU |
Cusabio |
-
EUR 380.00
-
EUR 214.00
-
EUR 1309.00
-
EUR 560.00
-
EUR 873.00
-
EUR 262.00
|
-
100ug
-
10ug
-
1MG
-
200ug
-
500ug
-
50ug
|
- MW: 53.6 kDa
- Buffer composition: Tris-based buffer with 50% glycerol.
|
|
Description: Recombinant Human Potassium-transporting ATPase subunit beta(ATP4B),partial expressed in E.coli |
Human Potassium-transporting ATPase subunit beta (ATP4B) |
|
1-CSB-EP002343HUe1 |
Cusabio |
-
EUR 496.00
-
EUR 330.00
-
EUR 1425.00
-
EUR 677.00
-
EUR 989.00
-
EUR 378.00
|
-
100ug
-
10ug
-
1MG
-
200ug
-
500ug
-
50ug
|
- MW: 26.6 kDa
- Buffer composition: Tris-based buffer with 50% glycerol.
|
|
Description: Recombinant Human Potassium-transporting ATPase subunit beta(ATP4B),Partial expressed in E.coli |
Human Potassium-transporting ATPase subunit beta (ATP4B) |
|
1-CSB-YP002343HU |
Cusabio |
-
EUR 430.00
-
EUR 234.00
-
EUR 1508.00
-
EUR 642.00
-
EUR 1009.00
-
EUR 291.00
|
-
100ug
-
10ug
-
1MG
-
200ug
-
500ug
-
50ug
|
- MW: 28.6 kDa
- Buffer composition: Tris-based buffer with 50% glycerol.
|
|
Description: Recombinant Human Potassium-transporting ATPase subunit beta(ATP4B),partial expressed in Yeast |
 (Target 1)) Atp4b sgRNA CRISPR Lentivector (Rat) (Target 1) |
|
K6902402 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 2)) Atp4b sgRNA CRISPR Lentivector (Rat) (Target 2) |
|
K6902403 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 3)) Atp4b sgRNA CRISPR Lentivector (Rat) (Target 3) |
|
K6902404 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 1)) ATP4B sgRNA CRISPR Lentivector (Human) (Target 1) |
|
K0146702 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 2)) ATP4B sgRNA CRISPR Lentivector (Human) (Target 2) |
|
K0146703 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 3)) ATP4B sgRNA CRISPR Lentivector (Human) (Target 3) |
|
K0146704 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 1)) Atp4b sgRNA CRISPR Lentivector (Mouse) (Target 1) |
|
K3780702 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 2)) Atp4b sgRNA CRISPR Lentivector (Mouse) (Target 2) |
|
K3780703 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 3)) Atp4b sgRNA CRISPR Lentivector (Mouse) (Target 3) |
|
K3780704 |
ABM |
1.0 ug DNA |
EUR 154 |
 (pPB-C-His)) ATP4B Protein Vector (Mouse) (pPB-C-His) |
|
PV157298 |
ABM |
500 ng |
EUR 603 |
 (pPB-N-His)) ATP4B Protein Vector (Mouse) (pPB-N-His) |
|
PV157299 |
ABM |
500 ng |
EUR 603 |
 (pPM-C-HA)) ATP4B Protein Vector (Mouse) (pPM-C-HA) |
|
PV157300 |
ABM |
500 ng |
EUR 603 |
 (pPM-C-His)) ATP4B Protein Vector (Mouse) (pPM-C-His) |
|
PV157301 |
ABM |
500 ng |
EUR 603 |
 (pPB-C-His)) ATP4B Protein Vector (Rat) (pPB-C-His) |
|
PV255278 |
ABM |
500 ng |
EUR 603 |
 (pPB-N-His)) ATP4B Protein Vector (Rat) (pPB-N-His) |
|
PV255279 |
ABM |
500 ng |
EUR 603 |
 (pPM-C-HA)) ATP4B Protein Vector (Rat) (pPM-C-HA) |
|
PV255280 |
ABM |
500 ng |
EUR 603 |
 (pPM-C-His)) ATP4B Protein Vector (Rat) (pPM-C-His) |
|
PV255281 |
ABM |
500 ng |
EUR 603 |
 (pPB-His-MBP)) ATP4B Protein Vector (Human) (pPB-His-MBP) |
|
PV325046 |
ABM |
500 ng |
EUR 329 |
 (pPB-His-GST)) ATP4B Protein Vector (Human) (pPB-His-GST) |
|
PV325047 |
ABM |
500 ng |
EUR 329 |
 (pPB-C-His)) ATP4B Protein Vector (Human) (pPB-C-His) |
|
PV003061 |
ABM |
500 ng |
EUR 329 |
 (pPB-N-His)) ATP4B Protein Vector (Human) (pPB-N-His) |
|
PV003062 |
ABM |
500 ng |
EUR 329 |
 (pPM-C-HA)) ATP4B Protein Vector (Human) (pPM-C-HA) |
|
PV003063 |
ABM |
500 ng |
EUR 329 |
 (pPM-C-His)) ATP4B Protein Vector (Human) (pPM-C-His) |
|
PV003064 |
ABM |
500 ng |
EUR 329 |
 Atp4b 3'UTR GFP Stable Cell Line |
|
TU152320 |
ABM |
1.0 ml |
Ask for price |
 Atp4b 3'UTR Luciferase Stable Cell Line |
|
TU102320 |
ABM |
1.0 ml |
Ask for price |
Atp4b 3'UTR Luciferase Stable Cell Line |
|
TU201076 |
ABM |
1.0 ml |
Ask for price |
Atp4b 3'UTR GFP Stable Cell Line |
|
TU251076 |
ABM |
1.0 ml |
Ask for price |
 ATP4B 3'UTR GFP Stable Cell Line |
|
TU051389 |
ABM |
1.0 ml |
EUR 1394 |
 ATP4B 3'UTR Luciferase Stable Cell Line |
|
TU001389 |
ABM |
1.0 ml |
EUR 1394 |
 GAPDH Rabbit Polyclonal Antibody |
|
37985-100ul |
SAB |
100ul |
EUR 252 |
GAPDH Rabbit Polyclonal Antibody |
|
37985-50ul |
SAB |
50ul |
EUR 187 |
 EFHD1 Rabbit Polyclonal Antibody |
|
38001-100ul |
SAB |
100ul |
EUR 252 |
EFHD1 Rabbit Polyclonal Antibody |
|
38001-50ul |
SAB |
50ul |
EUR 187 |
 Alliinase Rabbit Polyclonal Antibody |
|
38042-100ul |
SAB |
100ul |
EUR 252 |
Alliinase Rabbit Polyclonal Antibody |
|
38042-50ul |
SAB |
50ul |
EUR 187 |
 ECFP Rabbit Polyclonal Antibody |
|
38077-100ul |
SAB |
100ul |
EUR 252 |
ECFP Rabbit Polyclonal Antibody |
|
38077-50ul |
SAB |
50ul |
EUR 187 |
 EYFP Rabbit Polyclonal Antibody |
|
38078-100ul |
SAB |
100ul |
EUR 252 |
EYFP Rabbit Polyclonal Antibody |
|
38078-50ul |
SAB |
50ul |
EUR 187 |
 mOrange Rabbit Polyclonal Antibody |
|
38079-100ul |
SAB |
100ul |
EUR 252 |
mOrange Rabbit Polyclonal Antibody |
|
38079-50ul |
SAB |
50ul |
EUR 187 |
 mStrawberry Rabbit Polyclonal Antibody |
|
38083-100ul |
SAB |
100ul |
EUR 252 |
mStrawberry Rabbit Polyclonal Antibody |
|
38083-50ul |
SAB |
50ul |
EUR 187 |
 AmCyan Rabbit Polyclonal Antibody |
|
38086-100ul |
SAB |
100ul |
EUR 252 |
AmCyan Rabbit Polyclonal Antibody |
|
38086-50ul |
SAB |
50ul |
EUR 187 |
 EBFP Rabbit Polyclonal Antibody |
|
38087-100ul |
SAB |
100ul |
EUR 252 |
EBFP Rabbit Polyclonal Antibody |
|
38087-50ul |
SAB |
50ul |
EUR 187 |
 Vimentin Rabbit Polyclonal Antibody |
|
38104-100ul |
SAB |
100ul |
EUR 252 |
Vimentin Rabbit Polyclonal Antibody |
|
38104-50ul |
SAB |
50ul |
EUR 187 |
 LDHD Rabbit Polyclonal Antibody |
|
38105-100ul |
SAB |
100ul |
EUR 252 |
LDHD Rabbit Polyclonal Antibody |
|
38105-50ul |
SAB |
50ul |
EUR 187 |
GAPDH Rabbit Polyclonal Antibody |
|
A01021-005ml |
Abbkine |
0.05ml |
EUR 147 |
- Immunogen information: Recombinant Protein
- Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
- Show more
|
|
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein |
GAPDH Rabbit Polyclonal Antibody |
|
A01021-02ml |
Abbkine |
0.2ml |
EUR 332 |
- Immunogen information: Recombinant Protein
- Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
- Show more
|
|
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein |
GAPDH Rabbit Polyclonal Antibody |
|
A01021-02ml5 |
Abbkine |
0.2ml×5 |
EUR 920 |
- Immunogen information: Recombinant Protein
- Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
- Show more
|
|
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein |
 Rabbit Hemoglobin Polyclonal Antibody |
|
A53073 |
EpiGentek |
100 µg |
EUR 570.55 |
|
Description: The best epigenetics products |
 Met Rabbit Polyclonal Antibody |
|
ABP57458-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
Met Rabbit Polyclonal Antibody |
|
ABP57458-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
Met Rabbit Polyclonal Antibody |
|
ABP57458-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
 VEGF Rabbit Polyclonal Antibody |
|
ABP57460-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
VEGF Rabbit Polyclonal Antibody |
|
ABP57460-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
VEGF Rabbit Polyclonal Antibody |
|
ABP57460-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
 CD10 Rabbit Polyclonal Antibody |
|
ABP57461-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of CD10 of MME
- Applications tips:
|
|
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME |
CD10 Rabbit Polyclonal Antibody |
|
ABP57461-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of CD10 of MME
- Applications tips:
|
|
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME |
CD10 Rabbit Polyclonal Antibody |
|
ABP57461-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of CD10 of MME
- Applications tips:
|
|
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME |
 NM23A Rabbit Polyclonal Antibody |
|
ABP57462-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of NM23A of NME1
- Applications tips:
|
|
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1 |
NM23A Rabbit Polyclonal Antibody |
|
ABP57462-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of NM23A of NME1
- Applications tips:
|
|
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1 |
NM23A Rabbit Polyclonal Antibody |
|
ABP57462-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of NM23A of NME1
- Applications tips:
|
|
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1 |
 ATM Rabbit Polyclonal Antibody |
|
ABP57463-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
ATM Rabbit Polyclonal Antibody |
|
ABP57463-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
ATM Rabbit Polyclonal Antibody |
|
ABP57463-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
ATM Rabbit Polyclonal Antibody |
|
ABP57464-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
ATM Rabbit Polyclonal Antibody |
|
ABP57464-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
ATM Rabbit Polyclonal Antibody |
|
ABP57464-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
 HSC70 Rabbit Polyclonal Antibody |
|
ABP57565-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
- Applications tips:
|
|
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8) |
HSC70 Rabbit Polyclonal Antibody |
|
ABP57565-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
- Applications tips:
|
|
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8) |
HSC70 Rabbit Polyclonal Antibody |
|
ABP57565-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
- Applications tips:
|
|
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8) |
 HSP40 Rabbit Polyclonal Antibody |
|
ABP57566-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of HSP40
- Applications tips:
|
|
Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40 |
HSP40 Rabbit Polyclonal Antibody |
|
ABP57566-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of HSP40
- Applications tips:
|
|
Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40 |
HSP40 Rabbit Polyclonal Antibody |
|
ABP57566-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of HSP40
- Applications tips:
|
|
Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40 |
 HSP90Alpha Rabbit Polyclonal Antibody |
|
ABP57567-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of HSP90?
- Applications tips:
|
|
Description: A polyclonal antibody for detection of HSP90Alpha from Human, Mouse, Rat. This HSP90Alpha antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP90? |
ATP4B Rabbit Polyclonal Antibody
