ATP4B Rabbit Polyclonal Antibody

ATP4B Polyclonal Antibody

A53516 100 µg
EUR 570.55
Description: The best epigenetics products

ATP4B Rabbit pAb

A10106-100ul 100 ul
EUR 308

ATP4B Rabbit pAb

A10106-200ul 200 ul
EUR 459

ATP4B Rabbit pAb

A10106-20ul 20 ul
EUR 183

ATP4B Rabbit pAb

A10106-50ul 50 ul
EUR 223

ATP4B antibody

70R-6951 50 ug
EUR 467
Description: Rabbit polyclonal ATP4B antibody raised against the middle region of ATP4B

Atp4b antibody

70R-8600 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal Atp4b antibody

ATP4B Antibody

35648-100ul 100ul
EUR 252

ATP4B antibody

70R-15905 50 ul
EUR 435
Description: Rabbit polyclonal ATP4B antibody

ATP4B Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ATP4B. Recognizes ATP4B from Human. This antibody is Unconjugated. Tested in the following application: ELISA

ATP4B Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against ATP4B. Recognizes ATP4B from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

ATP4B Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against ATP4B. Recognizes ATP4B from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:2000, WB:1:200-1:1000, IHC:1:25-1:100

Polyclonal ATP4B Antibody (N-term)

APR10860G 0.1ml
EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human ATP4B (N-term). This antibody is tested and proven to work in the following applications:

ATP4B Polyclonal Antibody, Biotin Conjugated

A53513 100 µg
EUR 570.55
Description: Ask the seller for details

ATP4B Polyclonal Antibody, FITC Conjugated

A53514 100 µg
EUR 570.55
Description: The best epigenetics products

ATP4B Polyclonal Antibody, HRP Conjugated

A53515 100 µg
EUR 570.55
Description: kits suitable for this type of research

Human ATPase, H+/K+ Exchanging Beta Polypeptide (ATP4b) ELISA Kit

DLR-ATP4b-Hu-48T 48T
EUR 517
  • Should the Human ATPase, H+/K+ Exchanging Beta Polypeptide (ATP4b) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human ATPase, H+/K+ Exchanging Beta Polypeptide (ATP4b) in samples from tissue homogenates or other biological fluids.

Human ATPase, H+/K+ Exchanging Beta Polypeptide (ATP4b) ELISA Kit

DLR-ATP4b-Hu-96T 96T
EUR 673
  • Should the Human ATPase, H+/K+ Exchanging Beta Polypeptide (ATP4b) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human ATPase, H+/K+ Exchanging Beta Polypeptide (ATP4b) in samples from tissue homogenates or other biological fluids.

Mouse ATPase, H+/K+ Exchanging Beta Polypeptide (ATP4b) ELISA Kit

DLR-ATP4b-Mu-48T 48T
EUR 527
  • Should the Mouse ATPase, H+/K+ Exchanging Beta Polypeptide (ATP4b) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse ATPase, H+/K+ Exchanging Beta Polypeptide (ATP4b) in samples from tissue homogenates or other biological fluids.

Mouse ATPase, H+/K+ Exchanging Beta Polypeptide (ATP4b) ELISA Kit

DLR-ATP4b-Mu-96T 96T
EUR 688
  • Should the Mouse ATPase, H+/K+ Exchanging Beta Polypeptide (ATP4b) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse ATPase, H+/K+ Exchanging Beta Polypeptide (ATP4b) in samples from tissue homogenates or other biological fluids.

Rat ATPase, H+/K+ Exchanging Beta Polypeptide (ATP4b) ELISA Kit

DLR-ATP4b-Ra-48T 48T
EUR 549
  • Should the Rat ATPase, H+/K+ Exchanging Beta Polypeptide (ATP4b) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat ATPase, H+/K+ Exchanging Beta Polypeptide (ATP4b) in samples from tissue homogenates or other biological fluids.

Rat ATPase, H+/K+ Exchanging Beta Polypeptide (ATP4b) ELISA Kit

DLR-ATP4b-Ra-96T 96T
EUR 718
  • Should the Rat ATPase, H+/K+ Exchanging Beta Polypeptide (ATP4b) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat ATPase, H+/K+ Exchanging Beta Polypeptide (ATP4b) in samples from tissue homogenates or other biological fluids.

Human ATPase, H+/K+ Exchanging Beta Polypeptide (ATP4b) ELISA Kit

RD-ATP4b-Hu-48Tests 48 Tests
EUR 521

Human ATPase, H+/K+ Exchanging Beta Polypeptide (ATP4b) ELISA Kit

RD-ATP4b-Hu-96Tests 96 Tests
EUR 723

Mouse ATPase, H+/K+ Exchanging Beta Polypeptide (ATP4b) ELISA Kit

RD-ATP4b-Mu-48Tests 48 Tests
EUR 533

Mouse ATPase, H+/K+ Exchanging Beta Polypeptide (ATP4b) ELISA Kit

RD-ATP4b-Mu-96Tests 96 Tests
EUR 740

Rat ATPase, H+/K+ Exchanging Beta Polypeptide (ATP4b) ELISA Kit

RD-ATP4b-Ra-48Tests 48 Tests
EUR 557

Rat ATPase, H+/K+ Exchanging Beta Polypeptide (ATP4b) ELISA Kit

RD-ATP4b-Ra-96Tests 96 Tests
EUR 775

Human ATPase, H+/K+ Exchanging Beta Polypeptide (ATP4b) ELISA Kit

RDR-ATP4b-Hu-48Tests 48 Tests
EUR 544

Human ATPase, H+/K+ Exchanging Beta Polypeptide (ATP4b) ELISA Kit

RDR-ATP4b-Hu-96Tests 96 Tests
EUR 756

Mouse ATPase, H+/K+ Exchanging Beta Polypeptide (ATP4b) ELISA Kit

RDR-ATP4b-Mu-48Tests 48 Tests
EUR 557

Mouse ATPase, H+/K+ Exchanging Beta Polypeptide (ATP4b) ELISA Kit

RDR-ATP4b-Mu-96Tests 96 Tests
EUR 774

Rat ATPase, H+/K+ Exchanging Beta Polypeptide (ATP4b) ELISA Kit

RDR-ATP4b-Ra-48Tests 48 Tests
EUR 583

Rat ATPase, H+/K+ Exchanging Beta Polypeptide (ATP4b) ELISA Kit

RDR-ATP4b-Ra-96Tests 96 Tests
EUR 811

ATP4B Conjugated Antibody

C35648 100ul
EUR 397

anti- ATP4B antibody

FNab00701 100µg
EUR 505.25
  • Recommended dilution: WB: 1:500 - 1:2000
  • IHC: 1:50 - 1:200
  • Immunogen: ATPase, H+/K+ exchanging, beta polypeptide
  • Uniprot ID: P51164
  • Gene ID: 496
  • Research Area: Metabolism
Description: Antibody raised against ATP4B

Anti-ATP4B antibody

PAab00701 100 ug
EUR 355

Anti-ATP4B antibody

STJ112145 100 µl
EUR 277
Description: The protein encoded by this gene belongs to a family of P-type cation-transporting ATPases. The gastric H+, K+-ATPase is a heterodimer consisting of a high molecular weight catalytic alpha subunit and a smaller but heavily glycosylated beta subunit. This enzyme is a proton pump that catalyzes the hydrolysis of ATP coupled with the exchange of H(+) and K(+) ions across the plasma membrane. It is also responsible for gastric acid secretion. This gene encodes the beta subunit of the gastric H+, K+-ATPase.

Anti-ATP4B antibody

STJ191197 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to ATP4B

Atp4b/ Rat Atp4b ELISA Kit

ELI-24015r 96 Tests
EUR 886


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

ATP4B Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ATP4B. Recognizes ATP4B from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

ATP4B Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ATP4B. Recognizes ATP4B from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

ATP4B Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ATP4B. Recognizes ATP4B from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Atp4b Blocking Peptide

33R-7677 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of Atp4b antibody, catalog no. 70R-8600

ATP4B Blocking Peptide

33R-7776 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of ATP4B antibody, catalog no. 70R-6951

ATP4B cloning plasmid

CSB-CL002343HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 876
  • Sequence: atggcggctctgcaggagaagaagacgtgtggccagcgcatggaggagttccagcgttactgctggaacccggacacggggcagatgctgggccgcaccctgtcccggtgggtgtggatcagcctgtactacgtggccttctacgtggtgatgactgggctcttcgccctgtgcct
  • Show more
Description: A cloning plasmid for the ATP4B gene.

Rabbit Potassium- transporting ATPase subunit beta, ATP4B ELISA

ELI-34316Ra 96 Tests
EUR 928

Rat ATP4B shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.


ELI-24036d 96 Tests
EUR 928


EF007984 96 Tests
EUR 689

Mouse Atp4b ELISA KIT

ELI-34411m 96 Tests
EUR 865


ELI-48881h 96 Tests
EUR 824

Human ATP4B shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse ATP4B shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

ATP4B Recombinant Protein (Human)

RP002296 100 ug Ask for price


PVT16366 2 ug
EUR 325

ATP4B Recombinant Protein (Rat)

RP191456 100 ug Ask for price

ATP4B Recombinant Protein (Mouse)

RP117971 100 ug Ask for price

Rabbit Potassium transporting ATPase subunit β(ATP4B) ELISA kit

E04P0799-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Potassium transporting ATPase subunit β(ATP4B) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Potassium transporting ATPase subunit β(ATP4B) ELISA kit

E04P0799-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Potassium transporting ATPase subunit β(ATP4B) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Potassium transporting ATPase subunit β(ATP4B) ELISA kit

E04P0799-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Potassium transporting ATPase subunit β(ATP4B) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Anti-Hydrogen Potassium ATPase Beta/ATP4B Antibody

A08719-1 100ug/vial
EUR 294

ATP4B ORF Vector (Human) (pORF)

ORF000766 1.0 ug DNA
EUR 95

Atp4b ORF Vector (Mouse) (pORF)

ORF039325 1.0 ug DNA
EUR 506

Atp4b ORF Vector (Rat) (pORF)

ORF063820 1.0 ug DNA
EUR 506

ATPase, H+/K+ Exchanging Beta Polypeptide (ATP4B) Antibody

  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

ATPase, H+/K+ Exchanging Beta Polypeptide (ATP4B) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

ATPase, H+/K+ Exchanging Beta Polypeptide (ATP4B) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

ATPase, H+/K+ Exchanging Beta Polypeptide (ATP4B) Antibody

abx037938-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

ATPase, H+/K+ Exchanging Beta Polypeptide (ATP4B) Antibody

abx032433-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

ATPase, H+/K+ Exchanging Beta Polypeptide (ATP4B) Antibody

abx032433-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

ATPase, H+/K+ Exchanging Beta Polypeptide (ATP4b) Antibody

  • EUR 1233.00
  • EUR 592.00
  • 1 mg
  • 200 ug
  • Please enquire.

ATPase, H+/K+ Exchanging Beta Polypeptide (ATP4b) Antibody

  • EUR 1233.00
  • EUR 592.00
  • 1 mg
  • 200 ug
  • Please enquire.

ATPase, H+/K+ Exchanging Beta Polypeptide (ATP4B) Antibody

  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

ATPase, H+/K+ Exchanging Beta Polypeptide (ATP4B) Antibody

abx230701-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

ATP4B sgRNA CRISPR Lentivector set (Human)

K0146701 3 x 1.0 ug
EUR 339

Atp4b sgRNA CRISPR Lentivector set (Mouse)

K3780701 3 x 1.0 ug
EUR 339

Atp4b sgRNA CRISPR Lentivector set (Rat)

K6902401 3 x 1.0 ug
EUR 339

ATPase, H+/K+ Exchanging Beta Polypeptide (ATP4B) Antibody (HRP)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

ATPase, H+/K+ Exchanging Beta Polypeptide (ATP4B) Antibody (Biotin)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

ATPase, H+/K+ Exchanging Beta Polypeptide (ATP4B) Antibody (FITC)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

ATP4B sgRNA CRISPR Lentivector (Human) (Target 1)

K0146702 1.0 ug DNA
EUR 154

ATP4B sgRNA CRISPR Lentivector (Human) (Target 2)

K0146703 1.0 ug DNA
EUR 154

ATP4B sgRNA CRISPR Lentivector (Human) (Target 3)

K0146704 1.0 ug DNA
EUR 154

Human Potassium-transporting ATPase subunit beta (ATP4B)

  • EUR 430.00
  • EUR 234.00
  • EUR 1508.00
  • EUR 642.00
  • EUR 1009.00
  • EUR 291.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 28.6 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Potassium-transporting ATPase subunit beta(ATP4B),partial expressed in Yeast

Human Potassium-transporting ATPase subunit beta (ATP4B)

  • EUR 380.00
  • EUR 214.00
  • EUR 1309.00
  • EUR 560.00
  • EUR 873.00
  • EUR 262.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 53.6 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Potassium-transporting ATPase subunit beta(ATP4B),partial expressed in E.coli

Human Potassium-transporting ATPase subunit beta (ATP4B)

  • EUR 496.00
  • EUR 330.00
  • EUR 1425.00
  • EUR 677.00
  • EUR 989.00
  • EUR 378.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 26.6 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Potassium-transporting ATPase subunit beta(ATP4B),Partial expressed in E.coli

Atp4b sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3780702 1.0 ug DNA
EUR 154

Atp4b sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3780703 1.0 ug DNA
EUR 154

Atp4b sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3780704 1.0 ug DNA
EUR 154

ATP4B Protein Vector (Human) (pPB-C-His)

PV003061 500 ng
EUR 329

ATP4B Protein Vector (Human) (pPB-N-His)

PV003062 500 ng
EUR 329

ATP4B Protein Vector (Human) (pPM-C-HA)

PV003063 500 ng
EUR 329

ATP4B Protein Vector (Human) (pPM-C-His)

PV003064 500 ng
EUR 329

Atp4b sgRNA CRISPR Lentivector (Rat) (Target 1)

K6902402 1.0 ug DNA
EUR 154

Atp4b sgRNA CRISPR Lentivector (Rat) (Target 2)

K6902403 1.0 ug DNA
EUR 154

Atp4b sgRNA CRISPR Lentivector (Rat) (Target 3)

K6902404 1.0 ug DNA
EUR 154

ATP4B Protein Vector (Human) (pPB-His-MBP)

PV325046 500 ng
EUR 329

ATP4B Protein Vector (Human) (pPB-His-GST)

PV325047 500 ng
EUR 329

ATP4B Protein Vector (Rat) (pPB-C-His)

PV255278 500 ng
EUR 603

ATP4B Protein Vector (Rat) (pPB-N-His)

PV255279 500 ng
EUR 603

ATP4B Protein Vector (Rat) (pPM-C-HA)

PV255280 500 ng
EUR 603

ATP4B Protein Vector (Rat) (pPM-C-His)

PV255281 500 ng
EUR 603

ATP4B Protein Vector (Mouse) (pPB-C-His)

PV157298 500 ng
EUR 603

ATP4B Protein Vector (Mouse) (pPB-N-His)

PV157299 500 ng
EUR 603

ATP4B Protein Vector (Mouse) (pPM-C-HA)

PV157300 500 ng
EUR 603

ATP4B Protein Vector (Mouse) (pPM-C-His)

PV157301 500 ng
EUR 603

Atp4b 3'UTR Luciferase Stable Cell Line

TU201076 1.0 ml Ask for price

Atp4b 3'UTR GFP Stable Cell Line

TU152320 1.0 ml Ask for price

ATP4B 3'UTR Luciferase Stable Cell Line

TU001389 1.0 ml
EUR 1394

Atp4b 3'UTR Luciferase Stable Cell Line

TU102320 1.0 ml Ask for price

ATP4B 3'UTR GFP Stable Cell Line

TU051389 1.0 ml
EUR 1394

Atp4b 3'UTR GFP Stable Cell Line

TU251076 1.0 ml Ask for price

VEGF Rabbit Polyclonal Antibody

ES8453-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

VEGF Rabbit Polyclonal Antibody

ES8453-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody

ES8454-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody

ES8454-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody

ES8455-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody

ES8455-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8456-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8456-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8457-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8457-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSC70 Rabbit Polyclonal Antibody

ES8558-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSC70 Rabbit Polyclonal Antibody

ES8558-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody

ES8559-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody

ES8559-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP90? Rabbit Polyclonal Antibody

ES8560-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSP90? Rabbit Polyclonal Antibody

ES8560-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

IkB ? Rabbit Polyclonal Antibody

ES8561-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

IkB ? Rabbit Polyclonal Antibody

ES8561-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JAK1 Rabbit Polyclonal Antibody

ES8562-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK1 Rabbit Polyclonal Antibody

ES8562-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK2 Rabbit Polyclonal Antibody

ES8563-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK2 Rabbit Polyclonal Antibody

ES8563-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JNK2 Rabbit Polyclonal Antibody

ES8564-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JNK2 Rabbit Polyclonal Antibody

ES8564-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JNK3 Rabbit Polyclonal Antibody

ES8565-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JNK3 Rabbit Polyclonal Antibody

ES8565-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

MEK2 Rabbit Polyclonal Antibody

ES8566-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC

MEK2 Rabbit Polyclonal Antibody

ES8566-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC

MEK3 Rabbit Polyclonal Antibody

ES8567-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

MEK3 Rabbit Polyclonal Antibody

ES8567-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Nrf2 Rabbit Polyclonal Antibody

ES8568-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Nrf2 Rabbit Polyclonal Antibody

ES8568-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4a Rabbit Polyclonal Antibody

ES8569-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4a Rabbit Polyclonal Antibody

ES8569-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4b Rabbit Polyclonal Antibody

ES8570-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4b Rabbit Polyclonal Antibody

ES8570-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4c Rabbit Polyclonal Antibody

ES8571-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4c Rabbit Polyclonal Antibody

ES8571-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG5 Rabbit Polyclonal Antibody

ES8572-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG5 Rabbit Polyclonal Antibody

ES8572-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG7 Rabbit Polyclonal Antibody

ES8573-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG7 Rabbit Polyclonal Antibody

ES8573-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG13 Rabbit Polyclonal Antibody

ES8574-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG13 Rabbit Polyclonal Antibody

ES8574-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG13 Rabbit Polyclonal Antibody

ES8575-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG13 Rabbit Polyclonal Antibody

ES8575-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG14L Rabbit Polyclonal Antibody

ES8576-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG14L Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG14L Rabbit Polyclonal Antibody

ES8576-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG14L Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NBR1 Rabbit Polyclonal Antibody

ES8578-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NBR1 Rabbit Polyclonal Antibody

ES8578-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NBR1 Rabbit Polyclonal Antibody

ES8579-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NBR1 Rabbit Polyclonal Antibody

ES8579-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATP4B Rabbit Polyclonal Antibody