ATP4B Rabbit Polyclonal Antibody

ATP4B Polyclonal Antibody

ES10039-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATP4B from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

ATP4B Rabbit pAb

A10106-100ul 100 ul
EUR 308

ATP4B Rabbit pAb

A10106-200ul 200 ul
EUR 459

ATP4B Rabbit pAb

A10106-20ul 20 ul
EUR 183

ATP4B Rabbit pAb

A10106-50ul 50 ul
EUR 223

ATP4B antibody

70R-15905 50 ul
EUR 435
Description: Rabbit polyclonal ATP4B antibody

ATP4B Antibody

35648-100ul 100ul
EUR 252

ATP4B Antibody

1-CSB-PA002343EA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ATP4B. Recognizes ATP4B from Human. This antibody is Unconjugated. Tested in the following application: ELISA

ATP4B Antibody

1-CSB-PA002343GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against ATP4B. Recognizes ATP4B from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

ATP4B Antibody

1-CSB-PA017108
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against ATP4B. Recognizes ATP4B from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:2000, WB:1:200-1:1000, IHC:1:25-1:100

ATP4B antibody

70R-6951 50 ug
EUR 467
Description: Rabbit polyclonal ATP4B antibody raised against the middle region of ATP4B

Atp4b antibody

70R-8600 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal Atp4b antibody

Polyclonal ATP4B Antibody (N-term)

APR10860G 0.1ml
EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human ATP4B (N-term). This antibody is tested and proven to work in the following applications:

ATP4B Polyclonal Antibody, Biotin Conjugated

A53513 100 µg
EUR 570.55
Description: Ask the seller for details

ATP4B Polyclonal Antibody, FITC Conjugated

A53514 100 µg
EUR 570.55
Description: The best epigenetics products

ATP4B Polyclonal Antibody, HRP Conjugated

A53515 100 µg
EUR 570.55
Description: kits suitable for this type of research

Human ATPase, H+/K+ Exchanging Beta Polypeptide (ATP4b) ELISA Kit

DLR-ATP4b-Hu-48T 48T
EUR 517
  • Should the Human ATPase, H+/K+ Exchanging Beta Polypeptide (ATP4b) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human ATPase, H+/K+ Exchanging Beta Polypeptide (ATP4b) in samples from tissue homogenates or other biological fluids.

Human ATPase, H+/K+ Exchanging Beta Polypeptide (ATP4b) ELISA Kit

DLR-ATP4b-Hu-96T 96T
EUR 673
  • Should the Human ATPase, H+/K+ Exchanging Beta Polypeptide (ATP4b) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human ATPase, H+/K+ Exchanging Beta Polypeptide (ATP4b) in samples from tissue homogenates or other biological fluids.

Mouse ATPase, H+/K+ Exchanging Beta Polypeptide (ATP4b) ELISA Kit

DLR-ATP4b-Mu-48T 48T
EUR 527
  • Should the Mouse ATPase, H+/K+ Exchanging Beta Polypeptide (ATP4b) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse ATPase, H+/K+ Exchanging Beta Polypeptide (ATP4b) in samples from tissue homogenates or other biological fluids.

Mouse ATPase, H+/K+ Exchanging Beta Polypeptide (ATP4b) ELISA Kit

DLR-ATP4b-Mu-96T 96T
EUR 688
  • Should the Mouse ATPase, H+/K+ Exchanging Beta Polypeptide (ATP4b) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse ATPase, H+/K+ Exchanging Beta Polypeptide (ATP4b) in samples from tissue homogenates or other biological fluids.

Rat ATPase, H+/K+ Exchanging Beta Polypeptide (ATP4b) ELISA Kit

DLR-ATP4b-Ra-48T 48T
EUR 549
  • Should the Rat ATPase, H+/K+ Exchanging Beta Polypeptide (ATP4b) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat ATPase, H+/K+ Exchanging Beta Polypeptide (ATP4b) in samples from tissue homogenates or other biological fluids.

Rat ATPase, H+/K+ Exchanging Beta Polypeptide (ATP4b) ELISA Kit

DLR-ATP4b-Ra-96T 96T
EUR 718
  • Should the Rat ATPase, H+/K+ Exchanging Beta Polypeptide (ATP4b) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat ATPase, H+/K+ Exchanging Beta Polypeptide (ATP4b) in samples from tissue homogenates or other biological fluids.

Human ATPase, H+/K+ Exchanging Beta Polypeptide (ATP4b) ELISA Kit

RDR-ATP4b-Hu-48Tests 48 Tests
EUR 544

Human ATPase, H+/K+ Exchanging Beta Polypeptide (ATP4b) ELISA Kit

RDR-ATP4b-Hu-96Tests 96 Tests
EUR 756

Mouse ATPase, H+/K+ Exchanging Beta Polypeptide (ATP4b) ELISA Kit

RDR-ATP4b-Mu-48Tests 48 Tests
EUR 557

Mouse ATPase, H+/K+ Exchanging Beta Polypeptide (ATP4b) ELISA Kit

RDR-ATP4b-Mu-96Tests 96 Tests
EUR 774

Rat ATPase, H+/K+ Exchanging Beta Polypeptide (ATP4b) ELISA Kit

RDR-ATP4b-Ra-48Tests 48 Tests
EUR 583

Rat ATPase, H+/K+ Exchanging Beta Polypeptide (ATP4b) ELISA Kit

RDR-ATP4b-Ra-96Tests 96 Tests
EUR 811

Human ATPase, H+/K+ Exchanging Beta Polypeptide (ATP4b) ELISA Kit

RD-ATP4b-Hu-48Tests 48 Tests
EUR 521

Human ATPase, H+/K+ Exchanging Beta Polypeptide (ATP4b) ELISA Kit

RD-ATP4b-Hu-96Tests 96 Tests
EUR 723

Mouse ATPase, H+/K+ Exchanging Beta Polypeptide (ATP4b) ELISA Kit

RD-ATP4b-Mu-48Tests 48 Tests
EUR 533

Mouse ATPase, H+/K+ Exchanging Beta Polypeptide (ATP4b) ELISA Kit

RD-ATP4b-Mu-96Tests 96 Tests
EUR 740

Rat ATPase, H+/K+ Exchanging Beta Polypeptide (ATP4b) ELISA Kit

RD-ATP4b-Ra-48Tests 48 Tests
EUR 557

Rat ATPase, H+/K+ Exchanging Beta Polypeptide (ATP4b) ELISA Kit

RD-ATP4b-Ra-96Tests 96 Tests
EUR 775

ATP4B Conjugated Antibody

C35648 100ul
EUR 397

anti- ATP4B antibody

FNab00701 100µg
EUR 505.25
  • Recommended dilution: WB: 1:500 - 1:2000
  • IHC: 1:50 - 1:200
  • Immunogen: ATPase, H+/K+ exchanging, beta polypeptide
  • Uniprot ID: P51164
  • Gene ID: 496
  • Research Area: Metabolism
Description: Antibody raised against ATP4B

Anti-ATP4B antibody

PAab00701 100 ug
EUR 355

Anti-ATP4B antibody

STJ112145 100 µl
EUR 277
Description: The protein encoded by this gene belongs to a family of P-type cation-transporting ATPases. The gastric H+, K+-ATPase is a heterodimer consisting of a high molecular weight catalytic alpha subunit and a smaller but heavily glycosylated beta subunit. This enzyme is a proton pump that catalyzes the hydrolysis of ATP coupled with the exchange of H(+) and K(+) ions across the plasma membrane. It is also responsible for gastric acid secretion. This gene encodes the beta subunit of the gastric H+, K+-ATPase.

Anti-ATP4B antibody

STJ191197 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to ATP4B

Atp4b/ Rat Atp4b ELISA Kit

ELI-24015r 96 Tests
EUR 886

ATP4B siRNA

20-abx900522
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

ATP4B siRNA

20-abx908558
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

ATP4B siRNA

20-abx908559
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

ATP4B Antibody, HRP conjugated

1-CSB-PA002343EB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ATP4B. Recognizes ATP4B from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

ATP4B Antibody, FITC conjugated

1-CSB-PA002343EC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ATP4B. Recognizes ATP4B from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

ATP4B Antibody, Biotin conjugated

1-CSB-PA002343ED01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ATP4B. Recognizes ATP4B from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Atp4b Blocking Peptide

33R-7677 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of Atp4b antibody, catalog no. 70R-8600

ATP4B Blocking Peptide

33R-7776 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of ATP4B antibody, catalog no. 70R-6951

ATP4B cloning plasmid

CSB-CL002343HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 876
  • Sequence: atggcggctctgcaggagaagaagacgtgtggccagcgcatggaggagttccagcgttactgctggaacccggacacggggcagatgctgggccgcaccctgtcccggtgggtgtggatcagcctgtactacgtggccttctacgtggtgatgactgggctcttcgccctgtgcct
  • Show more
Description: A cloning plasmid for the ATP4B gene.

Rabbit Potassium- transporting ATPase subunit beta, ATP4B ELISA

ELI-34316Ra 96 Tests
EUR 928

Canine ATP4B ELISA KIT

ELI-24036d 96 Tests
EUR 928

ATP4B ELISA KIT|Human

EF007984 96 Tests
EUR 689

Rat ATP4B shRNA Plasmid

20-abx984385
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse ATP4B shRNA Plasmid

20-abx969274
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human ATP4B shRNA Plasmid

20-abx950349
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse Atp4b ELISA KIT

ELI-34411m 96 Tests
EUR 865

Human ATP4B ELISA KIT

ELI-48881h 96 Tests
EUR 824

pCMV-SPORT6-ATP4B Plasmid

PVT16366 2 ug
EUR 325

ATP4B Recombinant Protein (Human)

RP002296 100 ug Ask for price

ATP4B Recombinant Protein (Mouse)

RP117971 100 ug Ask for price

ATP4B Recombinant Protein (Rat)

RP191456 100 ug Ask for price

Rabbit Potassium transporting ATPase subunit β(ATP4B) ELISA kit

E04P0799-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Potassium transporting ATPase subunit β(ATP4B) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Potassium transporting ATPase subunit β(ATP4B) ELISA kit

E04P0799-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Potassium transporting ATPase subunit β(ATP4B) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Potassium transporting ATPase subunit β(ATP4B) ELISA kit

E04P0799-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Potassium transporting ATPase subunit β(ATP4B) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Anti-Hydrogen Potassium ATPase Beta/ATP4B Antibody

A08719-1 100ug/vial
EUR 294

Atp4b ORF Vector (Rat) (pORF)

ORF063820 1.0 ug DNA
EUR 506

ATP4B ORF Vector (Human) (pORF)

ORF000766 1.0 ug DNA
EUR 95

Atp4b ORF Vector (Mouse) (pORF)

ORF039325 1.0 ug DNA
EUR 506

ATP4b ELISA Kit (Mouse) (OKDD00766)

OKDD00766 96 Wells
EUR 988
Description: Description of target: Required for stabilization and maturation of the catalytic proton pump alpha subunit and may also involved in cell adhesion and establishing epithelial cell polarity.;Species reactivity: Mouse;Application: ;Assay info: Quantitative Sandwich ELISA;Sensitivity: <0.066ng/mL

ATPase, H+/K+ Exchanging Beta Polypeptide (ATP4B) Antibody

20-abx214013
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

ATPase, H+/K+ Exchanging Beta Polypeptide (ATP4b) Antibody

20-abx175505
  • EUR 1233.00
  • EUR 592.00
  • 1 mg
  • 200 ug
  • Please enquire.

ATPase, H+/K+ Exchanging Beta Polypeptide (ATP4b) Antibody

20-abx175506
  • EUR 1233.00
  • EUR 592.00
  • 1 mg
  • 200 ug
  • Please enquire.

ATPase, H+/K+ Exchanging Beta Polypeptide (ATP4B) Antibody

20-abx110108
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

ATPase, H+/K+ Exchanging Beta Polypeptide (ATP4B) Antibody

20-abx111155
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

ATPase, H+/K+ Exchanging Beta Polypeptide (ATP4B) Antibody

abx037938-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

ATPase, H+/K+ Exchanging Beta Polypeptide (ATP4B) Antibody

20-abx136016
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

ATPase, H+/K+ Exchanging Beta Polypeptide (ATP4B) Antibody

abx032433-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

ATPase, H+/K+ Exchanging Beta Polypeptide (ATP4B) Antibody

abx032433-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

ATPase, H+/K+ Exchanging Beta Polypeptide (ATP4B) Antibody

abx230701-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

Atp4b sgRNA CRISPR Lentivector set (Rat)

K6902401 3 x 1.0 ug
EUR 339

ATP4B sgRNA CRISPR Lentivector set (Human)

K0146701 3 x 1.0 ug
EUR 339

Atp4b sgRNA CRISPR Lentivector set (Mouse)

K3780701 3 x 1.0 ug
EUR 339

ATPase, H+/K+ Exchanging Beta Polypeptide (ATP4B) Antibody (Biotin)

20-abx105786
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

ATPase, H+/K+ Exchanging Beta Polypeptide (ATP4B) Antibody (FITC)

20-abx107204
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

ATPase, H+/K+ Exchanging Beta Polypeptide (ATP4B) Antibody (HRP)

20-abx108624
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Human Potassium-transporting ATPase subunit beta (ATP4B)

1-CSB-EP002343HU
  • EUR 380.00
  • EUR 214.00
  • EUR 1309.00
  • EUR 560.00
  • EUR 873.00
  • EUR 262.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 53.6 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Potassium-transporting ATPase subunit beta(ATP4B),partial expressed in E.coli

Human Potassium-transporting ATPase subunit beta (ATP4B)

1-CSB-EP002343HUe1
  • EUR 496.00
  • EUR 330.00
  • EUR 1425.00
  • EUR 677.00
  • EUR 989.00
  • EUR 378.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 26.6 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Potassium-transporting ATPase subunit beta(ATP4B),Partial expressed in E.coli

Human Potassium-transporting ATPase subunit beta (ATP4B)

1-CSB-YP002343HU
  • EUR 430.00
  • EUR 234.00
  • EUR 1508.00
  • EUR 642.00
  • EUR 1009.00
  • EUR 291.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 28.6 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Potassium-transporting ATPase subunit beta(ATP4B),partial expressed in Yeast

Atp4b sgRNA CRISPR Lentivector (Rat) (Target 1)

K6902402 1.0 ug DNA
EUR 154

Atp4b sgRNA CRISPR Lentivector (Rat) (Target 2)

K6902403 1.0 ug DNA
EUR 154

Atp4b sgRNA CRISPR Lentivector (Rat) (Target 3)

K6902404 1.0 ug DNA
EUR 154

ATP4B sgRNA CRISPR Lentivector (Human) (Target 1)

K0146702 1.0 ug DNA
EUR 154

ATP4B sgRNA CRISPR Lentivector (Human) (Target 2)

K0146703 1.0 ug DNA
EUR 154

ATP4B sgRNA CRISPR Lentivector (Human) (Target 3)

K0146704 1.0 ug DNA
EUR 154

Atp4b sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3780702 1.0 ug DNA
EUR 154

Atp4b sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3780703 1.0 ug DNA
EUR 154

Atp4b sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3780704 1.0 ug DNA
EUR 154

ATP4B Protein Vector (Mouse) (pPB-C-His)

PV157298 500 ng
EUR 603

ATP4B Protein Vector (Mouse) (pPB-N-His)

PV157299 500 ng
EUR 603

ATP4B Protein Vector (Mouse) (pPM-C-HA)

PV157300 500 ng
EUR 603

ATP4B Protein Vector (Mouse) (pPM-C-His)

PV157301 500 ng
EUR 603

ATP4B Protein Vector (Rat) (pPB-C-His)

PV255278 500 ng
EUR 603

ATP4B Protein Vector (Rat) (pPB-N-His)

PV255279 500 ng
EUR 603

ATP4B Protein Vector (Rat) (pPM-C-HA)

PV255280 500 ng
EUR 603

ATP4B Protein Vector (Rat) (pPM-C-His)

PV255281 500 ng
EUR 603

ATP4B Protein Vector (Human) (pPB-His-MBP)

PV325046 500 ng
EUR 329

ATP4B Protein Vector (Human) (pPB-His-GST)

PV325047 500 ng
EUR 329

ATP4B Protein Vector (Human) (pPB-C-His)

PV003061 500 ng
EUR 329

ATP4B Protein Vector (Human) (pPB-N-His)

PV003062 500 ng
EUR 329

ATP4B Protein Vector (Human) (pPM-C-HA)

PV003063 500 ng
EUR 329

ATP4B Protein Vector (Human) (pPM-C-His)

PV003064 500 ng
EUR 329

Atp4b 3'UTR GFP Stable Cell Line

TU152320 1.0 ml Ask for price

Atp4b 3'UTR Luciferase Stable Cell Line

TU102320 1.0 ml Ask for price

Atp4b 3'UTR Luciferase Stable Cell Line

TU201076 1.0 ml Ask for price

Atp4b 3'UTR GFP Stable Cell Line

TU251076 1.0 ml Ask for price

ATP4B 3'UTR GFP Stable Cell Line

TU051389 1.0 ml
EUR 1394

ATP4B 3'UTR Luciferase Stable Cell Line

TU001389 1.0 ml
EUR 1394

GAPDH Rabbit Polyclonal Antibody

37985-100ul 100ul
EUR 252

GAPDH Rabbit Polyclonal Antibody

37985-50ul 50ul
EUR 187

EFHD1 Rabbit Polyclonal Antibody

38001-100ul 100ul
EUR 252

EFHD1 Rabbit Polyclonal Antibody

38001-50ul 50ul
EUR 187

Alliinase Rabbit Polyclonal Antibody

38042-100ul 100ul
EUR 252

Alliinase Rabbit Polyclonal Antibody

38042-50ul 50ul
EUR 187

ECFP Rabbit Polyclonal Antibody

38077-100ul 100ul
EUR 252

ECFP Rabbit Polyclonal Antibody

38077-50ul 50ul
EUR 187

EYFP Rabbit Polyclonal Antibody

38078-100ul 100ul
EUR 252

EYFP Rabbit Polyclonal Antibody

38078-50ul 50ul
EUR 187

mOrange Rabbit Polyclonal Antibody

38079-100ul 100ul
EUR 252

mOrange Rabbit Polyclonal Antibody

38079-50ul 50ul
EUR 187

mStrawberry Rabbit Polyclonal Antibody

38083-100ul 100ul
EUR 252

mStrawberry Rabbit Polyclonal Antibody

38083-50ul 50ul
EUR 187

AmCyan Rabbit Polyclonal Antibody

38086-100ul 100ul
EUR 252

AmCyan Rabbit Polyclonal Antibody

38086-50ul 50ul
EUR 187

EBFP Rabbit Polyclonal Antibody

38087-100ul 100ul
EUR 252

EBFP Rabbit Polyclonal Antibody

38087-50ul 50ul
EUR 187

Vimentin Rabbit Polyclonal Antibody

38104-100ul 100ul
EUR 252

Vimentin Rabbit Polyclonal Antibody

38104-50ul 50ul
EUR 187

LDHD Rabbit Polyclonal Antibody

38105-100ul 100ul
EUR 252

LDHD Rabbit Polyclonal Antibody

38105-50ul 50ul
EUR 187

GAPDH Rabbit Polyclonal Antibody

A01021-005ml 0.05ml
EUR 147
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

GAPDH Rabbit Polyclonal Antibody

A01021-02ml 0.2ml
EUR 332
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

GAPDH Rabbit Polyclonal Antibody

A01021-02ml5 0.2ml×5
EUR 920
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

Rabbit Hemoglobin Polyclonal Antibody

A53073 100 µg
EUR 570.55
Description: The best epigenetics products

Met Rabbit Polyclonal Antibody

ABP57458-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

Met Rabbit Polyclonal Antibody

ABP57458-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

Met Rabbit Polyclonal Antibody

ABP57458-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

VEGF Rabbit Polyclonal Antibody

ABP57460-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

VEGF Rabbit Polyclonal Antibody

ABP57460-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

VEGF Rabbit Polyclonal Antibody

ABP57460-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

CD10 Rabbit Polyclonal Antibody

ABP57461-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

CD10 Rabbit Polyclonal Antibody

ABP57461-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

CD10 Rabbit Polyclonal Antibody

ABP57461-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

NM23A Rabbit Polyclonal Antibody

ABP57462-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of NM23A of NME1
  • Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1

NM23A Rabbit Polyclonal Antibody

ABP57462-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of NM23A of NME1
  • Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1

NM23A Rabbit Polyclonal Antibody

ABP57462-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of NM23A of NME1
  • Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1

ATM Rabbit Polyclonal Antibody

ABP57463-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody

ABP57463-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody

ABP57463-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody

ABP57464-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody

ABP57464-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody

ABP57464-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

HSC70 Rabbit Polyclonal Antibody

ABP57565-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
  • Applications tips:
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)

HSC70 Rabbit Polyclonal Antibody

ABP57565-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
  • Applications tips:
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)

HSC70 Rabbit Polyclonal Antibody

ABP57565-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
  • Applications tips:
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)

HSP40 Rabbit Polyclonal Antibody

ABP57566-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of HSP40
  • Applications tips:
Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40

HSP40 Rabbit Polyclonal Antibody

ABP57566-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of HSP40
  • Applications tips:
Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40

HSP40 Rabbit Polyclonal Antibody

ABP57566-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of HSP40
  • Applications tips:
Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40

HSP90Alpha Rabbit Polyclonal Antibody

ABP57567-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of HSP90?
  • Applications tips:
Description: A polyclonal antibody for detection of HSP90Alpha from Human, Mouse, Rat. This HSP90Alpha antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP90?

ATP4B Rabbit Polyclonal Antibody