BOP1 Rabbit Polyclonal Antibody

BOP1 Polyclonal Antibody
ES10183-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against BOP1 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

BOP1 Polyclonal Antibody
ES10183-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against BOP1 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

BOP1 antibody
70R-2410	Fitzgerald	50 ug	EUR 467
Description: Rabbit polyclonal BOP1 antibody raised against the N terminal of BOP1

BOP1 antibody
70R-2945	Fitzgerald	50 ug	EUR 467
Description: Rabbit polyclonal BOP1 antibody raised against the N terminal of BOP1

BOP1 Antibody
46933-100ul	SAB	100ul	EUR 252

Bop1/ Rat Bop1 ELISA Kit
ELI-11933r	Lifescience Market	96 Tests	EUR 886

BOP1 Conjugated Antibody
C46933	SAB	100ul	EUR 397

Anti-BOP1 antibody
STJ191341	St John's Laboratory	200 µl	EUR 197
Description: Unconjugated Rabbit polyclonal to BOP1

BOP1 siRNA
20-abx900656	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

BOP1 siRNA
20-abx909226	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

BOP1 siRNA
20-abx909227	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

Human Ribosome biogenesis protein BOP1, BOP1 ELISA KIT
ELI-11932h	Lifescience Market	96 Tests	EUR 824

Rat Ribosome Biogenesis Protein BOP1 (BOP1) ELISA Kit
abx391027-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Human Ribosome Biogenesis Protein BOP1 (BOP1) ELISA Kit
abx384634-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Mouse Ribosome Biogenesis Protein BOP1 (BOP1) ELISA Kit
abx388693-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Mouse Ribosome biogenesis protein BOP1, Bop1 ELISA KIT
ELI-33369m	Lifescience Market	96 Tests	EUR 865

BOP1 Blocking Peptide
33R-5670	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of BOP1 antibody, catalog no. 70R-2410

BOP1 Blocking Peptide
33R-7197	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of BOP1 antibody, catalog no. 70R-2945

BOP1 cloning plasmid
CSB-CL621760HU-10ug	Cusabio	10ug	EUR 737
Formulation: 10 μg plasmid + 200μl Glycerol Length: 2241 Sequence: atggcgggttcgcggggtgcggggcgcacggcggcgccgagcgtgcggccggagaagcggcggtctgagcccgaactggagcctgagcccgagccggagccccccctcctctgcacctctcctctcagccacagcaccggcagcgattctggcgtctccgacagcgaggagagtg Show more
Description: A cloning plasmid for the BOP1 gene.

pCMV-SPORT6-BOP1
PVT14148	Lifescience Market	2 ug	EUR 599

Bop1 ELISA Kit| Rat Ribosome biogenesis protein BOP1 ELISA Kit
EF018380	Lifescience Market	96 Tests	EUR 689

Bop1 ELISA Kit| Mouse Ribosome biogenesis protein BOP1 ELISA Ki
EF014318	Lifescience Market	96 Tests	EUR 689

BOP1 ELISA KIT|Human
EF004671	Lifescience Market	96 Tests	EUR 689

Rat BOP1 shRNA Plasmid
20-abx989023	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Human BOP1 shRNA Plasmid
20-abx958120	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Mouse BOP1 shRNA Plasmid
20-abx969383	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

BOP1 Recombinant Protein (Human)
RP003163	ABM	100 ug	Ask for price

BOP1 Recombinant Protein (Rat)
RP192341	ABM	100 ug	Ask for price

BOP1 Recombinant Protein (Mouse)
RP119774	ABM	100 ug	Ask for price

Bop1 ORF Vector (Rat) (pORF)
ORF064115	ABM	1.0 ug DNA	EUR 506

BOP1 ORF Vector (Human) (pORF)
ORF001055	ABM	1.0 ug DNA	EUR 95

Bop1 ORF Vector (Mouse) (pORF)
ORF039926	ABM	1.0 ug DNA	EUR 506

Bop1 sgRNA CRISPR Lentivector set (Rat)
K7224901	ABM	3 x 1.0 ug	EUR 339

BOP1 sgRNA CRISPR Lentivector set (Human)
K0191801	ABM	3 x 1.0 ug	EUR 339

Bop1 sgRNA CRISPR Lentivector set (Mouse)
K3965401	ABM	3 x 1.0 ug	EUR 339

Bop1 sgRNA CRISPR Lentivector (Rat) (Target 1)
K7224902	ABM	1.0 ug DNA	EUR 154

Bop1 sgRNA CRISPR Lentivector (Rat) (Target 2)
K7224903	ABM	1.0 ug DNA	EUR 154

Bop1 sgRNA CRISPR Lentivector (Rat) (Target 3)
K7224904	ABM	1.0 ug DNA	EUR 154

BOP1 sgRNA CRISPR Lentivector (Human) (Target 1)
K0191802	ABM	1.0 ug DNA	EUR 154

BOP1 sgRNA CRISPR Lentivector (Human) (Target 2)
K0191803	ABM	1.0 ug DNA	EUR 154

BOP1 sgRNA CRISPR Lentivector (Human) (Target 3)
K0191804	ABM	1.0 ug DNA	EUR 154

Bop1 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K3965402	ABM	1.0 ug DNA	EUR 154

Bop1 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K3965403	ABM	1.0 ug DNA	EUR 154

Bop1 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K3965404	ABM	1.0 ug DNA	EUR 154

BOP1 Protein Vector (Mouse) (pPB-C-His)
PV159702	ABM	500 ng	EUR 1065

BOP1 Protein Vector (Mouse) (pPB-N-His)
PV159703	ABM	500 ng	EUR 1065

BOP1 Protein Vector (Mouse) (pPM-C-HA)
PV159704	ABM	500 ng	EUR 1065

BOP1 Protein Vector (Mouse) (pPM-C-His)
PV159705	ABM	500 ng	EUR 1065

BOP1 Protein Vector (Rat) (pPB-C-His)
PV256458	ABM	500 ng	EUR 1166

BOP1 Protein Vector (Rat) (pPB-N-His)
PV256459	ABM	500 ng	EUR 1166

BOP1 Protein Vector (Rat) (pPM-C-HA)
PV256460	ABM	500 ng	EUR 1166

BOP1 Protein Vector (Rat) (pPM-C-His)
PV256461	ABM	500 ng	EUR 1166

BOP1 Protein Vector (Human) (pPB-His-MBP)
PV327318	ABM	500 ng	EUR 329

BOP1 Protein Vector (Human) (pPB-His-GST)
PV327319	ABM	500 ng	EUR 329

BOP1 Protein Vector (Human) (pPB-C-His)
PV004217	ABM	500 ng	EUR 329

BOP1 Protein Vector (Human) (pPB-N-His)
PV004218	ABM	500 ng	EUR 329

BOP1 Protein Vector (Human) (pPM-C-HA)
PV004219	ABM	500 ng	EUR 329

BOP1 Protein Vector (Human) (pPM-C-His)
PV004220	ABM	500 ng	EUR 329

Bop1 3'UTR GFP Stable Cell Line
TU152808	ABM	1.0 ml	Ask for price

Bop1 3'UTR Luciferase Stable Cell Line
TU102808	ABM	1.0 ml	Ask for price

Bop1 3'UTR Luciferase Stable Cell Line
TU201385	ABM	1.0 ml	Ask for price

Bop1 3'UTR GFP Stable Cell Line
TU251385	ABM	1.0 ml	Ask for price

BOP1 3'UTR GFP Stable Cell Line
TU051861	ABM	1.0 ml	EUR 1394

BOP1 3'UTR Luciferase Stable Cell Line
TU001861	ABM	1.0 ml	EUR 1394

BOP1 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)
LV661063	ABM	1.0 ug DNA	EUR 1355

BOP1 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)
LV661067	ABM	1.0 ug DNA	EUR 1355

BOP1 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)
LV661068	ABM	1.0 ug DNA	EUR 1355

GAPDH Rabbit Polyclonal Antibody
37985-100ul	SAB	100ul	EUR 252

GAPDH Rabbit Polyclonal Antibody
37985-50ul	SAB	50ul	EUR 187

EFHD1 Rabbit Polyclonal Antibody
38001-100ul	SAB	100ul	EUR 252

EFHD1 Rabbit Polyclonal Antibody
38001-50ul	SAB	50ul	EUR 187

Alliinase Rabbit Polyclonal Antibody
38042-100ul	SAB	100ul	EUR 252

Alliinase Rabbit Polyclonal Antibody
38042-50ul	SAB	50ul	EUR 187

ECFP Rabbit Polyclonal Antibody
38077-100ul	SAB	100ul	EUR 252

ECFP Rabbit Polyclonal Antibody
38077-50ul	SAB	50ul	EUR 187

EYFP Rabbit Polyclonal Antibody
38078-100ul	SAB	100ul	EUR 252

EYFP Rabbit Polyclonal Antibody
38078-50ul	SAB	50ul	EUR 187

mOrange Rabbit Polyclonal Antibody
38079-100ul	SAB	100ul	EUR 252

mOrange Rabbit Polyclonal Antibody
38079-50ul	SAB	50ul	EUR 187

mStrawberry Rabbit Polyclonal Antibody
38083-100ul	SAB	100ul	EUR 252

mStrawberry Rabbit Polyclonal Antibody
38083-50ul	SAB	50ul	EUR 187

AmCyan Rabbit Polyclonal Antibody
38086-100ul	SAB	100ul	EUR 252

AmCyan Rabbit Polyclonal Antibody
38086-50ul	SAB	50ul	EUR 187

EBFP Rabbit Polyclonal Antibody
38087-100ul	SAB	100ul	EUR 252

EBFP Rabbit Polyclonal Antibody
38087-50ul	SAB	50ul	EUR 187

Vimentin Rabbit Polyclonal Antibody
38104-100ul	SAB	100ul	EUR 252

BOP1 Rabbit Polyclonal Antibody