BOP1 Polyclonal Antibody |
ABP57918-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from part region of human BOP1 protein at amino acid sequence of 110-190
- Applications tips:
|
Description: A polyclonal antibody for detection of BOP1 from Human, Mouse, Rat. This BOP1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human BOP1 protein at amino acid sequence of 110-190 |
BOP1 Polyclonal Antibody |
ABP57918-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human BOP1 protein at amino acid sequence of 110-190
- Applications tips:
|
Description: A polyclonal antibody for detection of BOP1 from Human, Mouse, Rat. This BOP1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human BOP1 protein at amino acid sequence of 110-190 |
BOP1 antibody |
70R-2410 |
Fitzgerald |
50 ug |
EUR 467 |
Description: Rabbit polyclonal BOP1 antibody raised against the N terminal of BOP1 |
BOP1 antibody |
70R-2945 |
Fitzgerald |
50 ug |
EUR 467 |
Description: Rabbit polyclonal BOP1 antibody raised against the N terminal of BOP1 |
BOP1 Antibody |
46933-100ul |
SAB |
100ul |
EUR 252 |
BOP1 Conjugated Antibody |
C46933 |
SAB |
100ul |
EUR 397 |
Anti-BOP1 antibody |
STJ191341 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to BOP1 |
BOP1 siRNA |
20-abx900656 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
BOP1 siRNA |
20-abx909226 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
BOP1 siRNA |
20-abx909227 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Human Ribosome biogenesis protein BOP1, BOP1 ELISA KIT |
ELI-11932h |
Lifescience Market |
96 Tests |
EUR 824 |
Mouse Ribosome biogenesis protein BOP1, Bop1 ELISA KIT |
ELI-33369m |
Lifescience Market |
96 Tests |
EUR 865 |
Human Ribosome Biogenesis Protein BOP1 (BOP1) ELISA Kit |
abx384634-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
Mouse Ribosome Biogenesis Protein BOP1 (BOP1) ELISA Kit |
abx388693-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
Rat Ribosome Biogenesis Protein BOP1 (BOP1) ELISA Kit |
abx391027-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
BOP1 Blocking Peptide |
33R-5670 |
Fitzgerald |
100 ug |
EUR 180 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of BOP1 antibody, catalog no. 70R-2410 |
BOP1 Blocking Peptide |
33R-7197 |
Fitzgerald |
100 ug |
EUR 180 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of BOP1 antibody, catalog no. 70R-2945 |
BOP1 cloning plasmid |
CSB-CL621760HU-10ug |
Cusabio |
10ug |
EUR 737 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 2241
- Sequence: atggcgggttcgcggggtgcggggcgcacggcggcgccgagcgtgcggccggagaagcggcggtctgagcccgaactggagcctgagcccgagccggagccccccctcctctgcacctctcctctcagccacagcaccggcagcgattctggcgtctccgacagcgaggagagtg
- Show more
|
Description: A cloning plasmid for the BOP1 gene. |
Bop1 ELISA Kit| Rat Ribosome biogenesis protein BOP1 ELISA Kit |
EF018380 |
Lifescience Market |
96 Tests |
EUR 689 |
Bop1 ELISA Kit| Mouse Ribosome biogenesis protein BOP1 ELISA Ki |
EF014318 |
Lifescience Market |
96 Tests |
EUR 689 |
Rat BOP1 shRNA Plasmid |
20-abx989023 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Human BOP1 shRNA Plasmid |
20-abx958120 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Mouse BOP1 shRNA Plasmid |
20-abx969383 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
BOP1 Recombinant Protein (Human) |
RP003163 |
ABM |
100 ug |
Ask for price |
BOP1 Recombinant Protein (Rat) |
RP192341 |
ABM |
100 ug |
Ask for price |
BOP1 Recombinant Protein (Mouse) |
RP119774 |
ABM |
100 ug |
Ask for price |
BOP1 ORF Vector (Human) (pORF) |
ORF001055 |
ABM |
1.0 ug DNA |
EUR 95 |
Bop1 ORF Vector (Mouse) (pORF) |
ORF039926 |
ABM |
1.0 ug DNA |
EUR 506 |
Bop1 ORF Vector (Rat) (pORF) |
ORF064115 |
ABM |
1.0 ug DNA |
EUR 506 |
BOP1 sgRNA CRISPR Lentivector set (Human) |
K0191801 |
ABM |
3 x 1.0 ug |
EUR 339 |
Bop1 sgRNA CRISPR Lentivector set (Rat) |
K7224901 |
ABM |
3 x 1.0 ug |
EUR 339 |
Bop1 sgRNA CRISPR Lentivector set (Mouse) |
K3965401 |
ABM |
3 x 1.0 ug |
EUR 339 |
BOP1 sgRNA CRISPR Lentivector (Human) (Target 1) |
K0191802 |
ABM |
1.0 ug DNA |
EUR 154 |
BOP1 sgRNA CRISPR Lentivector (Human) (Target 2) |
K0191803 |
ABM |
1.0 ug DNA |
EUR 154 |
BOP1 sgRNA CRISPR Lentivector (Human) (Target 3) |
K0191804 |
ABM |
1.0 ug DNA |
EUR 154 |
Bop1 sgRNA CRISPR Lentivector (Rat) (Target 1) |
K7224902 |
ABM |
1.0 ug DNA |
EUR 154 |
Bop1 sgRNA CRISPR Lentivector (Rat) (Target 2) |
K7224903 |
ABM |
1.0 ug DNA |
EUR 154 |
Bop1 sgRNA CRISPR Lentivector (Rat) (Target 3) |
K7224904 |
ABM |
1.0 ug DNA |
EUR 154 |
Bop1 sgRNA CRISPR Lentivector (Mouse) (Target 1) |
K3965402 |
ABM |
1.0 ug DNA |
EUR 154 |
Bop1 sgRNA CRISPR Lentivector (Mouse) (Target 2) |
K3965403 |
ABM |
1.0 ug DNA |
EUR 154 |
Bop1 sgRNA CRISPR Lentivector (Mouse) (Target 3) |
K3965404 |
ABM |
1.0 ug DNA |
EUR 154 |
BOP1 Protein Vector (Human) (pPB-C-His) |
PV004217 |
ABM |
500 ng |
EUR 329 |
BOP1 Protein Vector (Human) (pPB-N-His) |
PV004218 |
ABM |
500 ng |
EUR 329 |
BOP1 Protein Vector (Human) (pPM-C-HA) |
PV004219 |
ABM |
500 ng |
EUR 329 |
BOP1 Protein Vector (Human) (pPM-C-His) |
PV004220 |
ABM |
500 ng |
EUR 329 |
BOP1 Protein Vector (Human) (pPB-His-MBP) |
PV327318 |
ABM |
500 ng |
EUR 329 |
BOP1 Protein Vector (Human) (pPB-His-GST) |
PV327319 |
ABM |
500 ng |
EUR 329 |
BOP1 Protein Vector (Rat) (pPB-C-His) |
PV256458 |
ABM |
500 ng |
EUR 1166 |
BOP1 Protein Vector (Rat) (pPB-N-His) |
PV256459 |
ABM |
500 ng |
EUR 1166 |
BOP1 Protein Vector (Rat) (pPM-C-HA) |
PV256460 |
ABM |
500 ng |
EUR 1166 |
BOP1 Protein Vector (Rat) (pPM-C-His) |
PV256461 |
ABM |
500 ng |
EUR 1166 |
BOP1 Protein Vector (Mouse) (pPB-C-His) |
PV159702 |
ABM |
500 ng |
EUR 1065 |
BOP1 Protein Vector (Mouse) (pPB-N-His) |
PV159703 |
ABM |
500 ng |
EUR 1065 |
BOP1 Protein Vector (Mouse) (pPM-C-HA) |
PV159704 |
ABM |
500 ng |
EUR 1065 |
BOP1 Protein Vector (Mouse) (pPM-C-His) |
PV159705 |
ABM |
500 ng |
EUR 1065 |
Bop1 3'UTR Luciferase Stable Cell Line |
TU201385 |
ABM |
1.0 ml |
Ask for price |
Bop1 3'UTR GFP Stable Cell Line |
TU152808 |
ABM |
1.0 ml |
Ask for price |
BOP1 3'UTR Luciferase Stable Cell Line |
TU001861 |
ABM |
1.0 ml |
EUR 1394 |
Bop1 3'UTR Luciferase Stable Cell Line |
TU102808 |
ABM |
1.0 ml |
Ask for price |
BOP1 3'UTR GFP Stable Cell Line |
TU051861 |
ABM |
1.0 ml |
EUR 1394 |
Bop1 3'UTR GFP Stable Cell Line |
TU251385 |
ABM |
1.0 ml |
Ask for price |
BOP1 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV) |
LV661063 |
ABM |
1.0 ug DNA |
EUR 1355 |
BOP1 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC) |
LV661067 |
ABM |
1.0 ug DNA |
EUR 1355 |
BOP1 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a) |
LV661068 |
ABM |
1.0 ug DNA |
EUR 1355 |
VEGF Rabbit Polyclonal Antibody |
ES8453-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
VEGF Rabbit Polyclonal Antibody |
ES8453-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
CD10 Rabbit Polyclonal Antibody |
ES8454-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
CD10 Rabbit Polyclonal Antibody |
ES8454-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NM23A Rabbit Polyclonal Antibody |
ES8455-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NM23A Rabbit Polyclonal Antibody |
ES8455-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8456-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8456-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8457-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8457-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
HSC70 Rabbit Polyclonal Antibody |
ES8558-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSC70 Rabbit Polyclonal Antibody |
ES8558-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSP40 Rabbit Polyclonal Antibody |
ES8559-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSP40 Rabbit Polyclonal Antibody |
ES8559-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSP90? Rabbit Polyclonal Antibody |
ES8560-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
HSP90? Rabbit Polyclonal Antibody |
ES8560-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
IkB ? Rabbit Polyclonal Antibody |
ES8561-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
IkB ? Rabbit Polyclonal Antibody |
ES8561-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
JAK1 Rabbit Polyclonal Antibody |
ES8562-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
BOP1 Rabbit Polyclonal Antibody