BOP1 Rabbit Polyclonal Antibody

BOP1 Polyclonal Antibody
ES10183-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against BOP1 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

BOP1 Polyclonal Antibody
ES10183-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against BOP1 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

BOP1 antibody
70R-2410 50 ug
EUR 467
Description: Rabbit polyclonal BOP1 antibody raised against the N terminal of BOP1

BOP1 antibody
70R-2945 50 ug
EUR 467
Description: Rabbit polyclonal BOP1 antibody raised against the N terminal of BOP1

BOP1 Antibody
46933-100ul 100ul
EUR 252

Bop1/ Rat Bop1 ELISA Kit
ELI-11933r 96 Tests
EUR 886

BOP1 Conjugated Antibody
C46933 100ul
EUR 397

Anti-BOP1 antibody
STJ191341 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to BOP1

BOP1 siRNA
20-abx900656
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

BOP1 siRNA
20-abx909226
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

BOP1 siRNA
20-abx909227
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

Human Ribosome biogenesis protein BOP1, BOP1 ELISA KIT
ELI-11932h 96 Tests
EUR 824

Rat Ribosome Biogenesis Protein BOP1 (BOP1) ELISA Kit
abx391027-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Human Ribosome Biogenesis Protein BOP1 (BOP1) ELISA Kit
abx384634-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Mouse Ribosome Biogenesis Protein BOP1 (BOP1) ELISA Kit
abx388693-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Mouse Ribosome biogenesis protein BOP1, Bop1 ELISA KIT
ELI-33369m 96 Tests
EUR 865

BOP1 Blocking Peptide
33R-5670 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of BOP1 antibody, catalog no. 70R-2410

BOP1 Blocking Peptide
33R-7197 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of BOP1 antibody, catalog no. 70R-2945

BOP1 cloning plasmid
CSB-CL621760HU-10ug 10ug
EUR 737
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2241
  • Sequence: atggcgggttcgcggggtgcggggcgcacggcggcgccgagcgtgcggccggagaagcggcggtctgagcccgaactggagcctgagcccgagccggagccccccctcctctgcacctctcctctcagccacagcaccggcagcgattctggcgtctccgacagcgaggagagtg
  • Show more
Description: A cloning plasmid for the BOP1 gene.

pCMV-SPORT6-BOP1
PVT14148 2 ug
EUR 599

Bop1 ELISA Kit| Rat Ribosome biogenesis protein BOP1 ELISA Kit
EF018380 96 Tests
EUR 689

Bop1 ELISA Kit| Mouse Ribosome biogenesis protein BOP1 ELISA Ki
EF014318 96 Tests
EUR 689

BOP1 ELISA KIT|Human
EF004671 96 Tests
EUR 689

Rat BOP1 shRNA Plasmid
20-abx989023
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human BOP1 shRNA Plasmid
20-abx958120
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse BOP1 shRNA Plasmid
20-abx969383
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

BOP1 Recombinant Protein (Human)
RP003163 100 ug Ask for price

BOP1 Recombinant Protein (Rat)
RP192341 100 ug Ask for price

BOP1 Recombinant Protein (Mouse)
RP119774 100 ug Ask for price

Bop1 ORF Vector (Rat) (pORF)
ORF064115 1.0 ug DNA
EUR 506

BOP1 ORF Vector (Human) (pORF)
ORF001055 1.0 ug DNA
EUR 95

Bop1 ORF Vector (Mouse) (pORF)
ORF039926 1.0 ug DNA
EUR 506

Bop1 sgRNA CRISPR Lentivector set (Rat)
K7224901 3 x 1.0 ug
EUR 339

BOP1 sgRNA CRISPR Lentivector set (Human)
K0191801 3 x 1.0 ug
EUR 339

Bop1 sgRNA CRISPR Lentivector set (Mouse)
K3965401 3 x 1.0 ug
EUR 339

Bop1 sgRNA CRISPR Lentivector (Rat) (Target 1)
K7224902 1.0 ug DNA
EUR 154

Bop1 sgRNA CRISPR Lentivector (Rat) (Target 2)
K7224903 1.0 ug DNA
EUR 154

Bop1 sgRNA CRISPR Lentivector (Rat) (Target 3)
K7224904 1.0 ug DNA
EUR 154

BOP1 sgRNA CRISPR Lentivector (Human) (Target 1)
K0191802 1.0 ug DNA
EUR 154

BOP1 sgRNA CRISPR Lentivector (Human) (Target 2)
K0191803 1.0 ug DNA
EUR 154

BOP1 sgRNA CRISPR Lentivector (Human) (Target 3)
K0191804 1.0 ug DNA
EUR 154

Bop1 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K3965402 1.0 ug DNA
EUR 154

Bop1 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K3965403 1.0 ug DNA
EUR 154

Bop1 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K3965404 1.0 ug DNA
EUR 154

BOP1 Protein Vector (Mouse) (pPB-C-His)
PV159702 500 ng
EUR 1065

BOP1 Protein Vector (Mouse) (pPB-N-His)
PV159703 500 ng
EUR 1065

BOP1 Protein Vector (Mouse) (pPM-C-HA)
PV159704 500 ng
EUR 1065

BOP1 Protein Vector (Mouse) (pPM-C-His)
PV159705 500 ng
EUR 1065

BOP1 Protein Vector (Rat) (pPB-C-His)
PV256458 500 ng
EUR 1166

BOP1 Protein Vector (Rat) (pPB-N-His)
PV256459 500 ng
EUR 1166

BOP1 Protein Vector (Rat) (pPM-C-HA)
PV256460 500 ng
EUR 1166

BOP1 Protein Vector (Rat) (pPM-C-His)
PV256461 500 ng
EUR 1166

BOP1 Protein Vector (Human) (pPB-His-MBP)
PV327318 500 ng
EUR 329

BOP1 Protein Vector (Human) (pPB-His-GST)
PV327319 500 ng
EUR 329

BOP1 Protein Vector (Human) (pPB-C-His)
PV004217 500 ng
EUR 329

BOP1 Protein Vector (Human) (pPB-N-His)
PV004218 500 ng
EUR 329

BOP1 Protein Vector (Human) (pPM-C-HA)
PV004219 500 ng
EUR 329

BOP1 Protein Vector (Human) (pPM-C-His)
PV004220 500 ng
EUR 329

Bop1 3'UTR GFP Stable Cell Line
TU152808 1.0 ml Ask for price

Bop1 3'UTR Luciferase Stable Cell Line
TU102808 1.0 ml Ask for price

Bop1 3'UTR Luciferase Stable Cell Line
TU201385 1.0 ml Ask for price

Bop1 3'UTR GFP Stable Cell Line
TU251385 1.0 ml Ask for price

BOP1 3'UTR GFP Stable Cell Line
TU051861 1.0 ml
EUR 1394

BOP1 3'UTR Luciferase Stable Cell Line
TU001861 1.0 ml
EUR 1394

BOP1 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)
LV661063 1.0 ug DNA
EUR 1355

BOP1 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)
LV661067 1.0 ug DNA
EUR 1355

BOP1 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)
LV661068 1.0 ug DNA
EUR 1355

GAPDH Rabbit Polyclonal Antibody
37985-100ul 100ul
EUR 252

GAPDH Rabbit Polyclonal Antibody
37985-50ul 50ul
EUR 187

EFHD1 Rabbit Polyclonal Antibody
38001-100ul 100ul
EUR 252

EFHD1 Rabbit Polyclonal Antibody
38001-50ul 50ul
EUR 187

Alliinase Rabbit Polyclonal Antibody
38042-100ul 100ul
EUR 252

Alliinase Rabbit Polyclonal Antibody
38042-50ul 50ul
EUR 187

ECFP Rabbit Polyclonal Antibody
38077-100ul 100ul
EUR 252

ECFP Rabbit Polyclonal Antibody
38077-50ul 50ul
EUR 187

EYFP Rabbit Polyclonal Antibody
38078-100ul 100ul
EUR 252

EYFP Rabbit Polyclonal Antibody
38078-50ul 50ul
EUR 187

mOrange Rabbit Polyclonal Antibody
38079-100ul 100ul
EUR 252

mOrange Rabbit Polyclonal Antibody
38079-50ul 50ul
EUR 187

mStrawberry Rabbit Polyclonal Antibody
38083-100ul 100ul
EUR 252

mStrawberry Rabbit Polyclonal Antibody
38083-50ul 50ul
EUR 187

AmCyan Rabbit Polyclonal Antibody
38086-100ul 100ul
EUR 252

AmCyan Rabbit Polyclonal Antibody
38086-50ul 50ul
EUR 187

EBFP Rabbit Polyclonal Antibody
38087-100ul 100ul
EUR 252

EBFP Rabbit Polyclonal Antibody
38087-50ul 50ul
EUR 187

Vimentin Rabbit Polyclonal Antibody
38104-100ul 100ul
EUR 252

BOP1 Rabbit Polyclonal Antibody