CCL13 Polyclonal Antibody |
ES10264-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against CCL13 from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA |
CCL13 Polyclonal Antibody |
ES10264-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against CCL13 from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA |
CCL13 Rabbit pAb |
A2853-100ul |
Abclonal |
100 ul |
EUR 308 |
CCL13 Rabbit pAb |
A2853-200ul |
Abclonal |
200 ul |
EUR 459 |
CCL13 Rabbit pAb |
A2853-20ul |
Abclonal |
20 ul |
Ask for price |
CCL13 Rabbit pAb |
A2853-50ul |
Abclonal |
50 ul |
EUR 223 |
CCL13 Antibody |
31051-100ul |
SAB |
100ul |
EUR 252 |
CCL13 Antibody |
31051-50ul |
SAB |
50ul |
EUR 187 |
CCL13 antibody |
70R-10495 |
Fitzgerald |
50 ug |
EUR 467 |
Description: Affinity purified rabbit polyclonal CCL13 antibody |
CCL13 Antibody |
1-CSB-PA08939A0Rb |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against CCL13. Recognizes CCL13 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200 |
CCL13 Antibody |
1-CSB-PA937680 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
Description: A polyclonal antibody against CCL13. Recognizes CCL13 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB;ELISA:1:2000-1:5000, WB:1:500-1:2000 |
CCL13 Antibody |
1-CSB-PA908097 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
Description: A polyclonal antibody against CCL13. Recognizes CCL13 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:10000, IHC:1:30-1:150 |
CCL13 Antibody |
DF9911 |
Affbiotech |
200ul |
EUR 304 |
Description: CCL13 Antibody detects endogenous levels of total CCL13. |
CCL13 Antibody |
1-CSB-PA218529 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
Description: A polyclonal antibody against CCL13. Recognizes CCL13 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB;ELISA:1:2000-1:5000, WB:1:500-1:2000 |
CCL13 Conjugated Antibody |
C31051 |
SAB |
100ul |
EUR 397 |
Anti-CCL13 antibody |
STJ22927 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: This antimicrobial gene is one of several Cys-Cys (CC) cytokine genes clustered on the q-arm of chromosome 17. Cytokines are a family of secreted proteins involved in immunoregulatory and inflammatory processes. The CC cytokines are proteins characterized by two adjacent cysteines. The cytokine encoded by this gene displays chemotactic activity for monocytes, lymphocytes, basophils and eosinophils, but not neutrophils. This chemokine plays a role in accumulation of leukocytes during inflammation. It may also be involved in the recruitment of monocytes into the arterial wall during artherosclerosis. |
Anti-CCL13 antibody |
STJ191422 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to CCL13 |
CCL13 siRNA |
20-abx910755 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
CCL13 Antibody, HRP conjugated |
1-CSB-PA08939B0Rb |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against CCL13. Recognizes CCL13 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA |
CCL13 Antibody, FITC conjugated |
1-CSB-PA08939C0Rb |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against CCL13. Recognizes CCL13 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA |
CCL13 Antibody, Biotin conjugated |
1-CSB-PA08939D0Rb |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against CCL13. Recognizes CCL13 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA |
Anti-MCP4/CCL13 Antibody |
PB9030 |
BosterBio |
100ug/vial |
EUR 294 |
CCL13 Blocking Peptide |
33R-4671 |
Fitzgerald |
100 ug |
EUR 180 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of CCL13 antibody, catalog no. 70R-10495 |
CCL13 Blocking Peptide |
DF9911-BP |
Affbiotech |
1mg |
EUR 195 |
CCL13 cloning plasmid |
CSB-CL858719HU-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 297
- Sequence: atgaaagtctctgcagtgcttctgtgcctgctgctcatgacagcagctttcaacccccagggacttgctcagccagatgcactcaacgtcccatctacttgctgcttcacatttagcagtaagaagatctccttgcagaggctgaagagctatgtgatcaccaccagcaggtgtcc
- Show more
|
Description: A cloning plasmid for the CCL13 gene. |
CCL13 protein (His tag) |
80R-1458 |
Fitzgerald |
10 ug |
EUR 305 |
Description: Purified recombinant Human CCL13 protein |
Human CCL13 shRNA Plasmid |
20-abx954290 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
MCP-4, CCL13, human |
RC315-24 |
BBI Biotech |
5ug |
EUR 104.38 |
- Product category: Proteins/Recombinant Proteins/Cytokines
|
Rat CCL13 ELISA Kit |
STJ150385 |
St John's Laboratory |
1 kit |
EUR 412 |
Description: The kit is a sandwich enzyme immunoassay for in vitro quantitative measurement of MCP-4 in Rat serum, plasma and other biological fluids |
Human CCL13 ELISA Kit |
STJ150538 |
St John's Laboratory |
1 kit |
EUR 412 |
Description: The kit is a sandwich enzyme immunoassay for in vitro quantitative measurement of MCP-4/CCL13 in human serum, plasma and other biological fluids |
Rabbit Monocyte Chemotactic Protein 4 / MCP4 (CCL13) ELISA Kit |
abx362528-96tests |
Abbexa |
96 tests |
EUR 825 |
- Shipped within 5-12 working days.
|
C-C Motif Chemokine 13 (CCL13) Antibody |
20-abx007329 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 314.00
|
|
- Shipped within 5-10 working days.
|
C-C Motif Chemokine 13 (CCL13) Antibody |
abx148993-100ug |
Abbexa |
100 ug |
EUR 439 |
- Shipped within 5-10 working days.
|
CCL13 Rabbit Polyclonal Antibody