Biocat Net

Amine biocat 3.0

CCL13 Rabbit Polyclonal Antibody

CCL13 Polyclonal Antibody

ES10264-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against CCL13 from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA

CCL13 Polyclonal Antibody

ES10264-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against CCL13 from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA

CCL13 Rabbit pAb

A2853-100ul 100 ul
EUR 308

CCL13 Rabbit pAb

A2853-200ul 200 ul
EUR 459

CCL13 Rabbit pAb

A2853-20ul 20 ul Ask for price

CCL13 Rabbit pAb

A2853-50ul 50 ul
EUR 223

CCL13 Antibody

31051-100ul 100ul
EUR 252

CCL13 Antibody

31051-50ul 50ul
EUR 187

CCL13 antibody

70R-10495 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal CCL13 antibody

CCL13 Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CCL13. Recognizes CCL13 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

CCL13 Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against CCL13. Recognizes CCL13 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB;ELISA:1:2000-1:5000, WB:1:500-1:2000

CCL13 Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against CCL13. Recognizes CCL13 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:10000, IHC:1:30-1:150

CCL13 Antibody

DF9911 200ul
EUR 304
Description: CCL13 Antibody detects endogenous levels of total CCL13.

CCL13 Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against CCL13. Recognizes CCL13 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB;ELISA:1:2000-1:5000, WB:1:500-1:2000

CCL13 Antibody

ABD9911 100 ug
EUR 438

CCL13 Conjugated Antibody

C31051 100ul
EUR 397

Anti-CCL13 antibody

STJ22927 100 µl
EUR 277
Description: This antimicrobial gene is one of several Cys-Cys (CC) cytokine genes clustered on the q-arm of chromosome 17. Cytokines are a family of secreted proteins involved in immunoregulatory and inflammatory processes. The CC cytokines are proteins characterized by two adjacent cysteines. The cytokine encoded by this gene displays chemotactic activity for monocytes, lymphocytes, basophils and eosinophils, but not neutrophils. This chemokine plays a role in accumulation of leukocytes during inflammation. It may also be involved in the recruitment of monocytes into the arterial wall during artherosclerosis.

Anti-CCL13 antibody

STJ191422 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to CCL13


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

CCL13 Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CCL13. Recognizes CCL13 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

CCL13 Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CCL13. Recognizes CCL13 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

CCL13 Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CCL13. Recognizes CCL13 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Anti-MCP4/CCL13 Antibody

PB9030 100ug/vial
EUR 294

CCL13 Blocking Peptide

33R-4671 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of CCL13 antibody, catalog no. 70R-10495

CCL13 Blocking Peptide

DF9911-BP 1mg
EUR 195

CCL13 cloning plasmid

CSB-CL858719HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 297
  • Sequence: atgaaagtctctgcagtgcttctgtgcctgctgctcatgacagcagctttcaacccccagggacttgctcagccagatgcactcaacgtcccatctacttgctgcttcacatttagcagtaagaagatctccttgcagaggctgaagagctatgtgatcaccaccagcaggtgtcc
  • Show more
Description: A cloning plasmid for the CCL13 gene.

pENTR223-CCL13 vector

PVT11826 2 ug
EUR 304

CCL13 protein (His tag)

80R-1458 10 ug
EUR 305
Description: Purified recombinant Human CCL13 protein


EF000043 96 Tests
EUR 689

Human CCL13 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

MCP-4/CCL13, Human

HY-P7245 50ug
EUR 533


STJ150385 1 kit
EUR 412
Description: The kit is a sandwich enzyme immunoassay for in vitro quantitative measurement of MCP-4 in Rat serum, plasma and other biological fluids

Human CCL13 ELISA Kit

STJ150538 1 kit
EUR 412
Description: The kit is a sandwich enzyme immunoassay for in vitro quantitative measurement of MCP-4/CCL13 in human serum, plasma and other biological fluids

MCP-4, CCL13, human

RC315-24 5ug
EUR 104.38
  • Product category: Proteins/Recombinant Proteins/Cytokines

Rabbit Monocyte Chemotactic Protein 4 / MCP4 (CCL13) ELISA Kit

abx362528-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

C-C Motif Chemokine 13 (CCL13) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 50 ul
  • Shipped within 5-10 working days.

C-C Motif Chemokine 13 (CCL13) Antibody

abx148993-100ug 100 ug
EUR 439
  • Shipped within 5-10 working days.

CCL13 Rabbit Polyclonal Antibody