CCL25 Polyclonal Antibody |
ABP58014-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Synthesized peptide derived from part region of human CCL25 protein at amino acid sequence of 30-110
- Applications tips:
|
Description: A polyclonal antibody for detection of CCL25 from Human, Mouse. This CCL25 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human CCL25 protein at amino acid sequence of 30-110 |
CCL25 Polyclonal Antibody |
ABP58014-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from part region of human CCL25 protein at amino acid sequence of 30-110
- Applications tips:
|
Description: A polyclonal antibody for detection of CCL25 from Human, Mouse. This CCL25 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human CCL25 protein at amino acid sequence of 30-110 |
CCL25 Polyclonal Antibody |
ABP58014-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human CCL25 protein at amino acid sequence of 30-110
- Applications tips:
|
Description: A polyclonal antibody for detection of CCL25 from Human, Mouse. This CCL25 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human CCL25 protein at amino acid sequence of 30-110 |
CCL25 Polyclonal Antibody |
ES10267-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against CCL25 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA |
CCL25 Polyclonal Antibody |
ES10267-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against CCL25 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA |
CCL25 Rabbit pAb |
A6543-100ul |
Abclonal |
100 ul |
EUR 308 |
CCL25 Rabbit pAb |
A6543-200ul |
Abclonal |
200 ul |
EUR 459 |
CCL25 Rabbit pAb |
A6543-20ul |
Abclonal |
20 ul |
EUR 183 |
CCL25 Rabbit pAb |
A6543-50ul |
Abclonal |
50 ul |
EUR 223 |
CCL25 Rabbit pAb |
A2685-100ul |
Abclonal |
100 ul |
EUR 308 |
CCL25 Rabbit pAb |
A2685-200ul |
Abclonal |
200 ul |
EUR 459 |
CCL25 Rabbit pAb |
A2685-20ul |
Abclonal |
20 ul |
EUR 183 |
CCL25 Rabbit pAb |
A2685-50ul |
Abclonal |
50 ul |
EUR 223 |
CCL25 antibody |
38996-100ul |
SAB |
100ul |
EUR 252 |
CCL25 Antibody |
42700-100ul |
SAB |
100ul |
EUR 252 |
CCL25 Antibody |
1-CSB-PA004789ESR2HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
|
Description: A polyclonal antibody against CCL25. Recognizes CCL25 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200 |
Ccl25 Antibody |
1-CSB-PA09189A0Rb |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against Ccl25. Recognizes Ccl25 from Mouse. This antibody is Unconjugated. Tested in the following application: ELISA |
CCL25 Antibody |
1-CSB-PA118672 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
Description: A polyclonal antibody against CCL25. Recognizes CCL25 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:25-1:100 |
Ccl25 Polyclonal Antibody, Biotin Conjugated |
A53082 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: The best epigenetics products |
Ccl25 Polyclonal Antibody, FITC Conjugated |
A53083 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: kits suitable for this type of research |
Ccl25 Polyclonal Antibody, HRP Conjugated |
A53084 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: fast delivery possible |
CCL25 Conjugated Antibody |
C38996 |
SAB |
100ul |
EUR 397 |
Anti-CCL25 antibody |
STJ28626 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: This antimicrobial gene belongs to the subfamily of small cytokine CC genes. Cytokines are a family of secreted proteins involved in immunoregulatory and inflammatory processes. The CC cytokines are proteins characterized by two adjacent cysteines. The cytokine encoded by this gene displays chemotactic activity for dendritic cells, thymocytes, and activated macrophages but is inactive on peripheral blood lymphocytes and neutrophils. The product of this gene binds to chemokine receptor CCR9. Alternative splicing results in multiple transcript variants. |
Anti-CCL25 antibody |
STJ116184 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: This antimicrobial gene belongs to the subfamily of small cytokine CC genes. Cytokines are a family of secreted proteins involved in immunoregulatory and inflammatory processes. The CC cytokines are proteins characterized by two adjacent cysteines. The cytokine encoded by this gene displays chemotactic activity for dendritic cells, thymocytes, and activated macrophages but is inactive on peripheral blood lymphocytes and neutrophils. The product of this gene binds to chemokine receptor CCR9. Alternative splicing results in multiple transcript variants. |
Anti-CCL25 antibody |
STJ191425 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to CCL25 |
CCL25 siRNA |
20-abx910776 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
CCL25 siRNA |
20-abx910777 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Ccl25 Antibody, HRP conjugated |
1-CSB-PA09189B0Rb |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against Ccl25. Recognizes Ccl25 from Mouse. This antibody is HRP conjugated. Tested in the following application: ELISA |
Ccl25 Antibody, FITC conjugated |
1-CSB-PA09189C0Rb |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against Ccl25. Recognizes Ccl25 from Mouse. This antibody is FITC conjugated. Tested in the following application: ELISA |
Ccl25 Antibody, Biotin conjugated |
1-CSB-PA09189D0Rb |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against Ccl25. Recognizes Ccl25 from Mouse. This antibody is Biotin conjugated. Tested in the following application: ELISA |
anti- CCL25/TECK antibody |
FNab01381 |
FN Test |
100µg |
EUR 505.25 |
- Immunogen: chemokine(C-C motif) ligand 25
- Uniprot ID: O15444
- Gene ID: 6370
- Research Area: Immunology, Signal Transduction
|
Description: Antibody raised against CCL25/TECK |
CCL25 cloning plasmid |
CSB-CL004789HU-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 453
- Sequence: atgaacctgtggctcctggcctgcctggtggccggcttcctgggagcctgggcccccgctgtccacacccaaggtgtctttgaggactgctgcctggcctaccactaccccattgggtgggctgtgctccggcgcgcctggacttaccggatccaggaggtgagcgggagctgcaa
- Show more
|
Description: A cloning plasmid for the CCL25 gene. |
TECK, CCL25, human |
RC315-36 |
Bio Basic |
5ug |
EUR 104.38 |
- Product category: Proteins/Recombinant Proteins/Cytokines
|
CCL25, murine (mouse) |
RC335-36 |
Bio Basic |
5ug |
EUR 101.33 |
- Product category: Proteins/Recombinant Proteins/Cytokines
|
Thymus Expressed Chemokine (CCL25) Antibody |
abx231381-100ug |
Abbexa |
100 ug |
EUR 481 |
- Shipped within 5-12 working days.
|
Rabbit Thymus Expressed Chemokine / TECK (CCL25) ELISA Kit |
abx363170-96tests |
Abbexa |
96 tests |
EUR 825 |
- Shipped within 5-12 working days.
|
CCL25 protein (His tag) |
80R-4131 |
Fitzgerald |
100 ug |
EUR 327 |
Description: Recombinant Human CCL25 protein (His tag) |
TECK (CCL25), human recombinant |
7214-10 |
Biovision |
|
EUR 207 |
CCL25 Rabbit Polyclonal Antibody