CCL28 Polyclonal Antibody |
ES10268-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against CCL28 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA |
CCL28 Polyclonal Antibody |
ES10268-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against CCL28 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA |
CCL28 Rabbit pAb |
A2596-100ul |
Abclonal |
100 ul |
EUR 308 |
CCL28 Rabbit pAb |
A2596-200ul |
Abclonal |
200 ul |
EUR 459 |
CCL28 Rabbit pAb |
A2596-20ul |
Abclonal |
20 ul |
EUR 183 |
CCL28 Rabbit pAb |
A2596-50ul |
Abclonal |
50 ul |
EUR 223 |
CCL28 antibody |
70R-16226 |
Fitzgerald |
50 ul |
EUR 435 |
Description: Rabbit polyclonal CCL28 antibody |
CCL28 Antibody |
32743-100ul |
SAB |
100ul |
EUR 252 |
CCL28 Antibody |
1-CSB-PA004792GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
|
Description: A polyclonal antibody against CCL28. Recognizes CCL28 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC |
CCL28 Antibody |
1-CSB-PA975229 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
Description: A polyclonal antibody against CCL28. Recognizes CCL28 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB;ELISA:1:2000-1:5000, WB:1:500-1:2000 |
CCL28 Antibody |
1-CSB-PA868302ESR1HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
|
Description: A polyclonal antibody against CCL28. Recognizes CCL28 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:500-1:2000, IHC:1:20-1:200 |
CCL28 Antibody |
1-CSB-PA868302ESR2HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
|
Description: A polyclonal antibody against CCL28. Recognizes CCL28 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200 |
CCL28 Antibody |
DF7045 |
Affbiotech |
200ul |
EUR 304 |
Description: CCL28 Antibody detects endogenous levels of total CCL28. |
CCL28 Conjugated Antibody |
C32743 |
SAB |
100ul |
EUR 397 |
anti- CCL28 antibody |
FNab01383 |
FN Test |
100µg |
EUR 505.25 |
- Immunogen: chemokine(C-C motif) ligand 28
- Uniprot ID: Q9NRJ3
- Gene ID: 56477
- Research Area: Immunology
|
Description: Antibody raised against CCL28 |
Anti-CCL28 antibody |
STJ22934 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: This antimicrobial gene belongs to the subfamily of small cytokine CC genes. Cytokines are a family of secreted proteins involved in immunoregulatory and inflammatory processes. The CC cytokines are proteins characterized by two adjacent cysteines. The cytokine encoded by this gene displays chemotactic activity for resting CD4 or CD8 T cells and eosinophils. The product of this gene binds to chemokine receptors CCR3 and CCR10. This chemokine may play a role in the physiology of extracutaneous epithelial tissues, including diverse mucosal organs. Multiple transcript variants encoding two different isoforms have been found for this gene. |
Anti-CCL28 antibody |
STJ191426 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to CCL28 |
CCL28 siRNA |
20-abx910782 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
CCL28 siRNA |
20-abx910783 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
anti-CCL28 |
YF-PA20001 |
Abfrontier |
50 ul |
EUR 363 |
Description: Mouse polyclonal to CCL28 |
anti-CCL28 |
YF-PA20002 |
Abfrontier |
50 ug |
EUR 363 |
Description: Mouse polyclonal to CCL28 |
CCL28 Blocking Peptide |
DF7045-BP |
Affbiotech |
1mg |
EUR 195 |
CCL28 cloning plasmid |
CSB-CL868302HU-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 384
- Sequence: atgcagcagagaggactcgccatcgtggccttggctgtctgtgcggccctacatgcctcagaagccatacttcccattgcctccagctgttgcacggaggtttcacatcatatttccagaaggctcctggaaagagtgaatatgtgtcgcatccagagagctgatggggattgtga
- Show more
|
Description: A cloning plasmid for the CCL28 gene. |
MEC, CCL28, human |
RC315-39 |
BBI Biotech |
5ug |
EUR 104.38 |
- Product category: Proteins/Recombinant Proteins/Cytokines
|
MEC, CCL28, rat |
RC355-39 |
BBI Biotech |
5ug |
EUR 104.38 |
- Product category: Proteins/Recombinant Proteins/Cytokines
|
MEC/CCL28, human recombinant |
7170-10 |
Biovision |
|
EUR 207 |
MEC/CCL28, human recombinant |
7170-50 |
Biovision |
|
EUR 675 |
MEC/CCL28, murine recombinant |
7171-10 |
Biovision |
|
EUR 207 |
MEC/CCL28, murine recombinant |
7171-50 |
Biovision |
|
EUR 675 |
CCL28 protein (His tag) |
80R-1194 |
Fitzgerald |
100 ug |
EUR 397 |
Description: Purified recombinant Human CCL28 protein |
Mouse CCL28 shRNA Plasmid |
20-abx974920 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Human CCL28 shRNA Plasmid |
20-abx961142 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
CCL28 Rabbit Polyclonal Antibody