CCL28 Rabbit Polyclonal Antibody

CCL28 Polyclonal Antibody
ES10268-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against CCL28 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

CCL28 Polyclonal Antibody
ES10268-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against CCL28 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

CCL28 Rabbit pAb
A2596-100ul 100 ul
EUR 308

CCL28 Rabbit pAb
A2596-200ul 200 ul
EUR 459

CCL28 Rabbit pAb
A2596-20ul 20 ul
EUR 183

CCL28 Rabbit pAb
A2596-50ul 50 ul
EUR 223

CCL28 antibody
70R-16226 50 ul
EUR 435
Description: Rabbit polyclonal CCL28 antibody

CCL28 Antibody
32743-100ul 100ul
EUR 252

CCL28 Antibody
1-CSB-PA004792GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against CCL28. Recognizes CCL28 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

CCL28 Antibody
1-CSB-PA975229
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against CCL28. Recognizes CCL28 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB;ELISA:1:2000-1:5000, WB:1:500-1:2000

CCL28 Antibody
1-CSB-PA868302ESR1HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against CCL28. Recognizes CCL28 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:500-1:2000, IHC:1:20-1:200

CCL28 Antibody
1-CSB-PA868302ESR2HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against CCL28. Recognizes CCL28 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

CCL28 Antibody
DF7045 200ul
EUR 304
Description: CCL28 Antibody detects endogenous levels of total CCL28.

CCL28 Antibody
ABD7045 100 ug
EUR 438

CCL28
E21-095 10ug
EUR 343

CCL28 Conjugated Antibody
C32743 100ul
EUR 397

anti- CCL28 antibody
FNab01383 100µg
EUR 505.25
  • Immunogen: chemokine(C-C motif) ligand 28
  • Uniprot ID: Q9NRJ3
  • Gene ID: 56477
  • Research Area: Immunology
Description: Antibody raised against CCL28

Anti-CCL28 antibody
PAab01383 100 ug
EUR 355

Anti-CCL28 antibody
STJ22934 100 µl
EUR 277
Description: This antimicrobial gene belongs to the subfamily of small cytokine CC genes. Cytokines are a family of secreted proteins involved in immunoregulatory and inflammatory processes. The CC cytokines are proteins characterized by two adjacent cysteines. The cytokine encoded by this gene displays chemotactic activity for resting CD4 or CD8 T cells and eosinophils. The product of this gene binds to chemokine receptors CCR3 and CCR10. This chemokine may play a role in the physiology of extracutaneous epithelial tissues, including diverse mucosal organs. Multiple transcript variants encoding two different isoforms have been found for this gene.

Anti-CCL28 antibody
STJ191426 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to CCL28

CCL28 siRNA
20-abx910782
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

CCL28 siRNA
20-abx910783
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

anti-CCL28
YF-PA20001 50 ul
EUR 363
Description: Mouse polyclonal to CCL28

anti-CCL28
YF-PA20002 50 ug
EUR 363
Description: Mouse polyclonal to CCL28

CCL28 Blocking Peptide
DF7045-BP 1mg
EUR 195

CCL28 cloning plasmid
CSB-CL868302HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 384
  • Sequence: atgcagcagagaggactcgccatcgtggccttggctgtctgtgcggccctacatgcctcagaagccatacttcccattgcctccagctgttgcacggaggtttcacatcatatttccagaaggctcctggaaagagtgaatatgtgtcgcatccagagagctgatggggattgtga
  • Show more
Description: A cloning plasmid for the CCL28 gene.

MEC/CCL28, Human
HY-P7250 10ug
EUR 268

MEC/CCL28, Mouse
HY-P7251 50mg
EUR 533

MEC/CCL28, Rat
HY-P7252 10mg
EUR 268

MEC, CCL28, human
RC315-39 5ug
EUR 104.38
  • Product category: Proteins/Recombinant Proteins/Cytokines

MEC, CCL28, rat
RC355-39 5ug
EUR 104.38
  • Product category: Proteins/Recombinant Proteins/Cytokines

MEC/CCL28, human recombinant
7170-10
EUR 207

MEC/CCL28, human recombinant
7170-50
EUR 675

MEC/CCL28, murine recombinant
7171-10
EUR 207

MEC/CCL28, murine recombinant
7171-50
EUR 675

CCL28 protein (His tag)
80R-1194 100 ug
EUR 397
Description: Purified recombinant Human CCL28 protein

Human CCL28 ELISA Kit
ELA-E1573h 96 Tests
EUR 824

Canine CCL28 ELISA KIT
ELI-05166d 96 Tests
EUR 928

CCL28 ELISA KIT|Human
EF000436 96 Tests
EUR 689

Mouse CCL28 shRNA Plasmid
20-abx974920
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human CCL28 shRNA Plasmid
20-abx961142
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

CCL28 Rabbit Polyclonal Antibody