CCL28 Rabbit Polyclonal Antibody

CCL28 Polyclonal Antibody
ES10268-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against CCL28 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

CCL28 Polyclonal Antibody
ES10268-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against CCL28 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

CCL28 Rabbit pAb
A2596-100ul	Abclonal	100 ul	EUR 308

CCL28 Rabbit pAb
A2596-200ul	Abclonal	200 ul	EUR 459

CCL28 Rabbit pAb
A2596-20ul	Abclonal	20 ul	EUR 183

CCL28 Rabbit pAb
A2596-50ul	Abclonal	50 ul	EUR 223

CCL28 antibody
70R-16226	Fitzgerald	50 ul	EUR 435
Description: Rabbit polyclonal CCL28 antibody

CCL28 Antibody
32743-100ul	SAB	100ul	EUR 252

CCL28 Antibody
1-CSB-PA004792GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against CCL28. Recognizes CCL28 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

CCL28 Antibody
1-CSB-PA975229	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against CCL28. Recognizes CCL28 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB;ELISA:1:2000-1:5000, WB:1:500-1:2000

CCL28 Antibody
1-CSB-PA868302ESR1HU	Cusabio	EUR 222.00 EUR 335.00	100ul 50ul
Form: Liquid Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against CCL28. Recognizes CCL28 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:500-1:2000, IHC:1:20-1:200

CCL28 Antibody
1-CSB-PA868302ESR2HU	Cusabio	EUR 222.00 EUR 335.00	100ul 50ul
Form: Liquid Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against CCL28. Recognizes CCL28 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

CCL28 Antibody
DF7045	Affbiotech	200ul	EUR 304
Description: CCL28 Antibody detects endogenous levels of total CCL28.

CCL28 Antibody
ABD7045	Lifescience Market	100 ug	EUR 438

CCL28
E21-095	EnoGene	10ug	EUR 343

CCL28 Conjugated Antibody
C32743	SAB	100ul	EUR 397

anti- CCL28 antibody
FNab01383	FN Test	100µg	EUR 505.25
Immunogen: chemokine(C-C motif) ligand 28 Uniprot ID: Q9NRJ3 Gene ID: 56477 Research Area: Immunology
Description: Antibody raised against CCL28

Anti-CCL28 antibody
PAab01383	Lifescience Market	100 ug	EUR 355

Anti-CCL28 antibody
STJ22934	St John's Laboratory	100 µl	EUR 277
Description: This antimicrobial gene belongs to the subfamily of small cytokine CC genes. Cytokines are a family of secreted proteins involved in immunoregulatory and inflammatory processes. The CC cytokines are proteins characterized by two adjacent cysteines. The cytokine encoded by this gene displays chemotactic activity for resting CD4 or CD8 T cells and eosinophils. The product of this gene binds to chemokine receptors CCR3 and CCR10. This chemokine may play a role in the physiology of extracutaneous epithelial tissues, including diverse mucosal organs. Multiple transcript variants encoding two different isoforms have been found for this gene.

Anti-CCL28 antibody
STJ191426	St John's Laboratory	200 µl	EUR 197
Description: Unconjugated Rabbit polyclonal to CCL28

CCL28 siRNA
20-abx910782	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

CCL28 siRNA
20-abx910783	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

anti-CCL28
YF-PA20001	Abfrontier	50 ul	EUR 363
Description: Mouse polyclonal to CCL28

anti-CCL28
YF-PA20002	Abfrontier	50 ug	EUR 363
Description: Mouse polyclonal to CCL28

CCL28 Blocking Peptide
DF7045-BP	Affbiotech	1mg	EUR 195

CCL28 cloning plasmid
CSB-CL868302HU-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 384 Sequence: atgcagcagagaggactcgccatcgtggccttggctgtctgtgcggccctacatgcctcagaagccatacttcccattgcctccagctgttgcacggaggtttcacatcatatttccagaaggctcctggaaagagtgaatatgtgtcgcatccagagagctgatggggattgtga Show more
Description: A cloning plasmid for the CCL28 gene.

MEC/CCL28, Human
HY-P7250	MedChemExpress	10ug	EUR 268

MEC/CCL28, Mouse
HY-P7251	MedChemExpress	50mg	EUR 533

MEC/CCL28, Rat
HY-P7252	MedChemExpress	10mg	EUR 268

MEC, CCL28, human
RC315-39	Bio Basic	5ug	EUR 104.38
Product category: Proteins/Recombinant Proteins/Cytokines

MEC, CCL28, rat
RC355-39	Bio Basic	5ug	EUR 104.38
Product category: Proteins/Recombinant Proteins/Cytokines

MEC/CCL28, human recombinant
7170-10	Biovision		EUR 207

MEC/CCL28, human recombinant
7170-50	Biovision		EUR 675

MEC/CCL28, murine recombinant
7171-10	Biovision		EUR 207

MEC/CCL28, murine recombinant
7171-50	Biovision		EUR 675

CCL28 protein (His tag)
80R-1194	Fitzgerald	100 ug	EUR 397
Description: Purified recombinant Human CCL28 protein

Human CCL28 ELISA Kit
ELA-E1573h	Lifescience Market	96 Tests	EUR 824

Canine CCL28 ELISA KIT
ELI-05166d	Lifescience Market	96 Tests	EUR 928

CCL28 ELISA KIT|Human
EF000436	Lifescience Market	96 Tests	EUR 689

Mouse CCL28 shRNA Plasmid
20-abx974920	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Human CCL28 shRNA Plasmid
20-abx961142	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

CCL28 Rabbit Polyclonal Antibody