 ELL3 Polyclonal Antibody |
|
ABP58472-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from part region of human ELL3 protein at amino acid sequence of 210-290
- Applications tips:
|
|
Description: A polyclonal antibody for detection of ELL3 from Human, Mouse. This ELL3 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human ELL3 protein at amino acid sequence of 210-290 |
ELL3 Polyclonal Antibody |
|
ABP58472-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human ELL3 protein at amino acid sequence of 210-290
- Applications tips:
|
|
Description: A polyclonal antibody for detection of ELL3 from Human, Mouse. This ELL3 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human ELL3 protein at amino acid sequence of 210-290 |
 Anti-ELL3 antibody |
|
STJ191345 |
St John's Laboratory |
200 µl |
EUR 197 |
|
Description: Unconjugated Rabbit polyclonal to ELL3 |
 ELL3 siRNA |
|
20-abx901698 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
ELL3 siRNA |
|
20-abx915268 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
ELL3 siRNA |
|
20-abx915269 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
 anti-ELL3 |
|
YF-PA21048 |
Abfrontier |
50 ul |
EUR 363 |
|
Description: Mouse polyclonal to ELL3 |
anti-ELL3 |
|
YF-PA21049 |
Abfrontier |
50 ug |
EUR 363 |
|
Description: Mouse polyclonal to ELL3 |
anti-ELL3 |
|
YF-PA21050 |
Abfrontier |
50 ul |
EUR 363 |
|
Description: Mouse polyclonal to ELL3 |
anti-ELL3 |
|
YF-PA21051 |
Abfrontier |
50 ug |
EUR 363 |
|
Description: Mouse polyclonal to ELL3 |
 ELL3 cloning plasmid |
|
CSB-CL864017HU-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1194
- Sequence: atggaggagctccaggagcctctgagaggacagctccggctctgcttcacgcaagctgcccggactagcctcttactgctcaggctcaacgacgctgccctgcgggcgctgcaagagtgtcagcggcaacaggtacggccggtgattgctttccaaggccaccgagggtatctga
- Show more
|
|
Description: A cloning plasmid for the ELL3 gene. |
 Mouse RNA polymerase II elongation factor ELL3, Ell3 ELISA KIT |
|
ELI-27656m |
Lifescience Market |
96 Tests |
EUR 865 |
 Ell3 ELISA Kit| Mouse RNA polymerase II elongation factor ELL3 |
|
EF014772 |
Lifescience Market |
96 Tests |
EUR 689 |
 Human RNA polymerase II elongation factor ELL3, ELL3 ELISA KIT |
|
ELI-47045h |
Lifescience Market |
96 Tests |
EUR 824 |
 Rat ELL3 shRNA Plasmid |
|
20-abx988785 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
 Mouse ELL3 shRNA Plasmid |
|
20-abx983031 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
 Human ELL3 shRNA Plasmid |
|
20-abx962821 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
) ELL3 Recombinant Protein (Human) |
|
RP010579 |
ABM |
100 ug |
Ask for price |
) ELL3 Recombinant Protein (Rat) |
|
RP199490 |
ABM |
100 ug |
Ask for price |
) ELL3 Recombinant Protein (Mouse) |
|
RP131516 |
ABM |
100 ug |
Ask for price |
 (pORF)) ELL3 ORF Vector (Human) (pORF) |
|
ORF003527 |
ABM |
1.0 ug DNA |
EUR 95 |
 (pORF)) Ell3 ORF Vector (Rat) (pORF) |
|
ORF066498 |
ABM |
1.0 ug DNA |
EUR 506 |
 (pORF)) Ell3 ORF Vector (Mouse) (pORF) |
|
ORF043840 |
ABM |
1.0 ug DNA |
EUR 506 |
) ELL3 sgRNA CRISPR Lentivector set (Human) |
|
K0675201 |
ABM |
3 x 1.0 ug |
EUR 339 |
) Ell3 sgRNA CRISPR Lentivector set (Mouse) |
|
K4307201 |
ABM |
3 x 1.0 ug |
EUR 339 |
) Ell3 sgRNA CRISPR Lentivector set (Rat) |
|
K6151701 |
ABM |
3 x 1.0 ug |
EUR 339 |
 Antibody) Elongation Factor RNA Polymerase II-Like 3 (ELL3) Antibody |
|
abx030154-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
Elongation Factor RNA Polymerase II-Like 3 (ELL3) Antibody |
|
abx030154-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
 (Target 1)) ELL3 sgRNA CRISPR Lentivector (Human) (Target 1) |
|
K0675202 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 2)) ELL3 sgRNA CRISPR Lentivector (Human) (Target 2) |
|
K0675203 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 3)) ELL3 sgRNA CRISPR Lentivector (Human) (Target 3) |
|
K0675204 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 1)) Ell3 sgRNA CRISPR Lentivector (Mouse) (Target 1) |
|
K4307202 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 2)) Ell3 sgRNA CRISPR Lentivector (Mouse) (Target 2) |
|
K4307203 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 3)) Ell3 sgRNA CRISPR Lentivector (Mouse) (Target 3) |
|
K4307204 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 1)) Ell3 sgRNA CRISPR Lentivector (Rat) (Target 1) |
|
K6151702 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 2)) Ell3 sgRNA CRISPR Lentivector (Rat) (Target 2) |
|
K6151703 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 3)) Ell3 sgRNA CRISPR Lentivector (Rat) (Target 3) |
|
K6151704 |
ABM |
1.0 ug DNA |
EUR 154 |
 (pPB-C-His)) ELL3 Protein Vector (Mouse) (pPB-C-His) |
|
PV175358 |
ABM |
500 ng |
EUR 603 |
 (pPB-N-His)) ELL3 Protein Vector (Mouse) (pPB-N-His) |
|
PV175359 |
ABM |
500 ng |
EUR 603 |
 (pPM-C-HA)) ELL3 Protein Vector (Mouse) (pPM-C-HA) |
|
PV175360 |
ABM |
500 ng |
EUR 603 |
 (pPM-C-His)) ELL3 Protein Vector (Mouse) (pPM-C-His) |
|
PV175361 |
ABM |
500 ng |
EUR 603 |
 (pPB-C-His)) ELL3 Protein Vector (Human) (pPB-C-His) |
|
PV014105 |
ABM |
500 ng |
EUR 329 |
 (pPB-N-His)) ELL3 Protein Vector (Human) (pPB-N-His) |
|
PV014106 |
ABM |
500 ng |
EUR 329 |
 (pPM-C-HA)) ELL3 Protein Vector (Human) (pPM-C-HA) |
|
PV014107 |
ABM |
500 ng |
EUR 329 |
 (pPM-C-His)) ELL3 Protein Vector (Human) (pPM-C-His) |
|
PV014108 |
ABM |
500 ng |
EUR 329 |
 (pPB-C-His)) ELL3 Protein Vector (Rat) (pPB-C-His) |
|
PV265990 |
ABM |
500 ng |
EUR 603 |
 (pPB-N-His)) ELL3 Protein Vector (Rat) (pPB-N-His) |
|
PV265991 |
ABM |
500 ng |
EUR 603 |
 (pPM-C-HA)) ELL3 Protein Vector (Rat) (pPM-C-HA) |
|
PV265992 |
ABM |
500 ng |
EUR 603 |
 (pPM-C-His)) ELL3 Protein Vector (Rat) (pPM-C-His) |
|
PV265993 |
ABM |
500 ng |
EUR 603 |
 Ell3 3'UTR Luciferase Stable Cell Line |
|
TU203932 |
ABM |
1.0 ml |
Ask for price |
 Ell3 3'UTR GFP Stable Cell Line |
|
TU155765 |
ABM |
1.0 ml |
Ask for price |
 ELL3 3'UTR Luciferase Stable Cell Line |
|
TU006833 |
ABM |
1.0 ml |
EUR 1394 |
Ell3 3'UTR Luciferase Stable Cell Line |
|
TU105765 |
ABM |
1.0 ml |
Ask for price |
 ELL3 3'UTR GFP Stable Cell Line |
|
TU056833 |
ABM |
1.0 ml |
EUR 1394 |
Ell3 3'UTR GFP Stable Cell Line |
|
TU253932 |
ABM |
1.0 ml |
Ask for price |
 VEGF Rabbit Polyclonal Antibody |
|
ES8453-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
VEGF Rabbit Polyclonal Antibody |
|
ES8453-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 CD10 Rabbit Polyclonal Antibody |
|
ES8454-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
CD10 Rabbit Polyclonal Antibody |
|
ES8454-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 NM23A Rabbit Polyclonal Antibody |
|
ES8455-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NM23A Rabbit Polyclonal Antibody |
|
ES8455-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 ATM Rabbit Polyclonal Antibody |
|
ES8456-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
|
ES8456-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
|
ES8457-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
|
ES8457-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 HSC70 Rabbit Polyclonal Antibody |
|
ES8558-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSC70 Rabbit Polyclonal Antibody |
|
ES8558-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
 HSP40 Rabbit Polyclonal Antibody |
|
ES8559-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSP40 Rabbit Polyclonal Antibody |
|
ES8559-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
 HSP90? Rabbit Polyclonal Antibody |
|
ES8560-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
HSP90? Rabbit Polyclonal Antibody |
|
ES8560-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 IkB ? Rabbit Polyclonal Antibody |
|
ES8561-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
IkB ? Rabbit Polyclonal Antibody |
|
ES8561-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
 JAK1 Rabbit Polyclonal Antibody |
|
ES8562-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JAK1 Rabbit Polyclonal Antibody |
|
ES8562-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 JAK2 Rabbit Polyclonal Antibody |
|
ES8563-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JAK2 Rabbit Polyclonal Antibody |
|
ES8563-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 JNK2 Rabbit Polyclonal Antibody |
|
ES8564-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
JNK2 Rabbit Polyclonal Antibody |
|
ES8564-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
 JNK3 Rabbit Polyclonal Antibody |
|
ES8565-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JNK3 Rabbit Polyclonal Antibody |
|
ES8565-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 MEK2 Rabbit Polyclonal Antibody |
|
ES8566-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC |
MEK2 Rabbit Polyclonal Antibody |
|
ES8566-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC |
 MEK3 Rabbit Polyclonal Antibody |
|
ES8567-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
MEK3 Rabbit Polyclonal Antibody |
|
ES8567-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 Nrf2 Rabbit Polyclonal Antibody |
|
ES8568-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
Nrf2 Rabbit Polyclonal Antibody |
|
ES8568-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 ATG4a Rabbit Polyclonal Antibody |
|
ES8569-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4a Rabbit Polyclonal Antibody |
|
ES8569-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ELL3 Rabbit Polyclonal Antibody
