Biocat Net

Amine biocat 3.0

ELL3 Rabbit Polyclonal Antibody

ELL3 Polyclonal Antibody

ABP58472-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human ELL3 protein at amino acid sequence of 210-290
  • Applications tips:
Description: A polyclonal antibody for detection of ELL3 from Human, Mouse. This ELL3 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human ELL3 protein at amino acid sequence of 210-290

ELL3 Polyclonal Antibody

ABP58472-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human ELL3 protein at amino acid sequence of 210-290
  • Applications tips:
Description: A polyclonal antibody for detection of ELL3 from Human, Mouse. This ELL3 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human ELL3 protein at amino acid sequence of 210-290

Anti-ELL3 antibody

STJ191345 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to ELL3

ELL3 siRNA

20-abx901698
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

ELL3 siRNA

20-abx915268
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

ELL3 siRNA

20-abx915269
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

anti-ELL3

YF-PA21048 50 ul
EUR 363
Description: Mouse polyclonal to ELL3

anti-ELL3

YF-PA21049 50 ug
EUR 363
Description: Mouse polyclonal to ELL3

anti-ELL3

YF-PA21050 50 ul
EUR 363
Description: Mouse polyclonal to ELL3

anti-ELL3

YF-PA21051 50 ug
EUR 363
Description: Mouse polyclonal to ELL3

ELL3 cloning plasmid

CSB-CL864017HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1194
  • Sequence: atggaggagctccaggagcctctgagaggacagctccggctctgcttcacgcaagctgcccggactagcctcttactgctcaggctcaacgacgctgccctgcgggcgctgcaagagtgtcagcggcaacaggtacggccggtgattgctttccaaggccaccgagggtatctga
  • Show more
Description: A cloning plasmid for the ELL3 gene.

Mouse RNA polymerase II elongation factor ELL3, Ell3 ELISA KIT

ELI-27656m 96 Tests
EUR 865

Ell3 ELISA Kit| Mouse RNA polymerase II elongation factor ELL3

EF014772 96 Tests
EUR 689

Human RNA polymerase II elongation factor ELL3, ELL3 ELISA KIT

ELI-47045h 96 Tests
EUR 824

Rat ELL3 shRNA Plasmid

20-abx988785
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse ELL3 shRNA Plasmid

20-abx983031
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human ELL3 shRNA Plasmid

20-abx962821
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

ELL3 ELISA KIT|Human

EF004892 96 Tests
EUR 689

ELL3 Recombinant Protein (Human)

RP010579 100 ug Ask for price

ELL3 Recombinant Protein (Rat)

RP199490 100 ug Ask for price

ELL3 Recombinant Protein (Mouse)

RP131516 100 ug Ask for price

ELL3 ORF Vector (Human) (pORF)

ORF003527 1.0 ug DNA
EUR 95

Ell3 ORF Vector (Rat) (pORF)

ORF066498 1.0 ug DNA
EUR 506

Ell3 ORF Vector (Mouse) (pORF)

ORF043840 1.0 ug DNA
EUR 506

ELL3 sgRNA CRISPR Lentivector set (Human)

K0675201 3 x 1.0 ug
EUR 339

Ell3 sgRNA CRISPR Lentivector set (Mouse)

K4307201 3 x 1.0 ug
EUR 339

Ell3 sgRNA CRISPR Lentivector set (Rat)

K6151701 3 x 1.0 ug
EUR 339

Elongation Factor RNA Polymerase II-Like 3 (ELL3) Antibody

abx030154-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Elongation Factor RNA Polymerase II-Like 3 (ELL3) Antibody

abx030154-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

ELL3 sgRNA CRISPR Lentivector (Human) (Target 1)

K0675202 1.0 ug DNA
EUR 154

ELL3 sgRNA CRISPR Lentivector (Human) (Target 2)

K0675203 1.0 ug DNA
EUR 154

ELL3 sgRNA CRISPR Lentivector (Human) (Target 3)

K0675204 1.0 ug DNA
EUR 154

Ell3 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4307202 1.0 ug DNA
EUR 154

Ell3 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4307203 1.0 ug DNA
EUR 154

Ell3 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4307204 1.0 ug DNA
EUR 154

Ell3 sgRNA CRISPR Lentivector (Rat) (Target 1)

K6151702 1.0 ug DNA
EUR 154

Ell3 sgRNA CRISPR Lentivector (Rat) (Target 2)

K6151703 1.0 ug DNA
EUR 154

Ell3 sgRNA CRISPR Lentivector (Rat) (Target 3)

K6151704 1.0 ug DNA
EUR 154

ELL3 Protein Vector (Mouse) (pPB-C-His)

PV175358 500 ng
EUR 603

ELL3 Protein Vector (Mouse) (pPB-N-His)

PV175359 500 ng
EUR 603

ELL3 Protein Vector (Mouse) (pPM-C-HA)

PV175360 500 ng
EUR 603

ELL3 Protein Vector (Mouse) (pPM-C-His)

PV175361 500 ng
EUR 603

ELL3 Protein Vector (Human) (pPB-C-His)

PV014105 500 ng
EUR 329

ELL3 Protein Vector (Human) (pPB-N-His)

PV014106 500 ng
EUR 329

ELL3 Protein Vector (Human) (pPM-C-HA)

PV014107 500 ng
EUR 329

ELL3 Protein Vector (Human) (pPM-C-His)

PV014108 500 ng
EUR 329

ELL3 Protein Vector (Rat) (pPB-C-His)

PV265990 500 ng
EUR 603

ELL3 Protein Vector (Rat) (pPB-N-His)

PV265991 500 ng
EUR 603

ELL3 Protein Vector (Rat) (pPM-C-HA)

PV265992 500 ng
EUR 603

ELL3 Protein Vector (Rat) (pPM-C-His)

PV265993 500 ng
EUR 603

Ell3 3'UTR Luciferase Stable Cell Line

TU203932 1.0 ml Ask for price

Ell3 3'UTR GFP Stable Cell Line

TU155765 1.0 ml Ask for price

ELL3 3'UTR Luciferase Stable Cell Line

TU006833 1.0 ml
EUR 1394

Ell3 3'UTR Luciferase Stable Cell Line

TU105765 1.0 ml Ask for price

ELL3 3'UTR GFP Stable Cell Line

TU056833 1.0 ml
EUR 1394

Ell3 3'UTR GFP Stable Cell Line

TU253932 1.0 ml Ask for price

VEGF Rabbit Polyclonal Antibody

ES8453-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

VEGF Rabbit Polyclonal Antibody

ES8453-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody

ES8454-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody

ES8454-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody

ES8455-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody

ES8455-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8456-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8456-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8457-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8457-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSC70 Rabbit Polyclonal Antibody

ES8558-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSC70 Rabbit Polyclonal Antibody

ES8558-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody

ES8559-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody

ES8559-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP90? Rabbit Polyclonal Antibody

ES8560-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSP90? Rabbit Polyclonal Antibody

ES8560-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

IkB ? Rabbit Polyclonal Antibody

ES8561-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

IkB ? Rabbit Polyclonal Antibody

ES8561-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JAK1 Rabbit Polyclonal Antibody

ES8562-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK1 Rabbit Polyclonal Antibody

ES8562-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK2 Rabbit Polyclonal Antibody

ES8563-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK2 Rabbit Polyclonal Antibody

ES8563-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JNK2 Rabbit Polyclonal Antibody

ES8564-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JNK2 Rabbit Polyclonal Antibody

ES8564-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JNK3 Rabbit Polyclonal Antibody

ES8565-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JNK3 Rabbit Polyclonal Antibody

ES8565-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

MEK2 Rabbit Polyclonal Antibody

ES8566-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC

MEK2 Rabbit Polyclonal Antibody

ES8566-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC

MEK3 Rabbit Polyclonal Antibody

ES8567-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

MEK3 Rabbit Polyclonal Antibody

ES8567-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Nrf2 Rabbit Polyclonal Antibody

ES8568-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Nrf2 Rabbit Polyclonal Antibody

ES8568-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4a Rabbit Polyclonal Antibody

ES8569-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4a Rabbit Polyclonal Antibody

ES8569-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ELL3 Rabbit Polyclonal Antibody