 ELL3 Polyclonal Antibody |
|
ES10187-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ELL3 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA |
ELL3 Polyclonal Antibody |
|
ES10187-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ELL3 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA |
 Anti-ELL3 antibody |
|
STJ191345 |
St John's Laboratory |
200 µl |
EUR 197 |
|
Description: Unconjugated Rabbit polyclonal to ELL3 |
 ELL3 siRNA |
|
20-abx901698 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
ELL3 siRNA |
|
20-abx915268 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
ELL3 siRNA |
|
20-abx915269 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
 anti-ELL3 |
|
YF-PA21048 |
Abfrontier |
50 ul |
EUR 363 |
|
Description: Mouse polyclonal to ELL3 |
anti-ELL3 |
|
YF-PA21049 |
Abfrontier |
50 ug |
EUR 363 |
|
Description: Mouse polyclonal to ELL3 |
anti-ELL3 |
|
YF-PA21050 |
Abfrontier |
50 ul |
EUR 363 |
|
Description: Mouse polyclonal to ELL3 |
anti-ELL3 |
|
YF-PA21051 |
Abfrontier |
50 ug |
EUR 363 |
|
Description: Mouse polyclonal to ELL3 |
 ELL3 cloning plasmid |
|
CSB-CL864017HU-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1194
- Sequence: atggaggagctccaggagcctctgagaggacagctccggctctgcttcacgcaagctgcccggactagcctcttactgctcaggctcaacgacgctgccctgcgggcgctgcaagagtgtcagcggcaacaggtacggccggtgattgctttccaaggccaccgagggtatctga
- Show more
|
|
Description: A cloning plasmid for the ELL3 gene. |
 Mouse RNA polymerase II elongation factor ELL3, Ell3 ELISA KIT |
|
ELI-27656m |
Lifescience Market |
96 Tests |
EUR 865 |
 Ell3 ELISA Kit| Mouse RNA polymerase II elongation factor ELL3 |
|
EF014772 |
Lifescience Market |
96 Tests |
EUR 689 |
 Human RNA polymerase II elongation factor ELL3, ELL3 ELISA KIT |
|
ELI-47045h |
Lifescience Market |
96 Tests |
EUR 824 |
 Rat ELL3 shRNA Plasmid |
|
20-abx988785 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
 Mouse ELL3 shRNA Plasmid |
|
20-abx983031 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
 Human ELL3 shRNA Plasmid |
|
20-abx962821 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
) ELL3 Recombinant Protein (Human) |
|
RP010579 |
ABM |
100 ug |
Ask for price |
) ELL3 Recombinant Protein (Rat) |
|
RP199490 |
ABM |
100 ug |
Ask for price |
) ELL3 Recombinant Protein (Mouse) |
|
RP131516 |
ABM |
100 ug |
Ask for price |
 (pORF)) Ell3 ORF Vector (Rat) (pORF) |
|
ORF066498 |
ABM |
1.0 ug DNA |
EUR 506 |
 (pORF)) ELL3 ORF Vector (Human) (pORF) |
|
ORF003527 |
ABM |
1.0 ug DNA |
EUR 95 |
 (pORF)) Ell3 ORF Vector (Mouse) (pORF) |
|
ORF043840 |
ABM |
1.0 ug DNA |
EUR 506 |
) ELL3 sgRNA CRISPR Lentivector set (Human) |
|
K0675201 |
ABM |
3 x 1.0 ug |
EUR 339 |
) Ell3 sgRNA CRISPR Lentivector set (Rat) |
|
K6151701 |
ABM |
3 x 1.0 ug |
EUR 339 |
) Ell3 sgRNA CRISPR Lentivector set (Mouse) |
|
K4307201 |
ABM |
3 x 1.0 ug |
EUR 339 |
 Antibody) Elongation Factor RNA Polymerase II-Like 3 (ELL3) Antibody |
|
abx030154-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
Elongation Factor RNA Polymerase II-Like 3 (ELL3) Antibody |
|
abx030154-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
 (Target 1)) ELL3 sgRNA CRISPR Lentivector (Human) (Target 1) |
|
K0675202 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 2)) ELL3 sgRNA CRISPR Lentivector (Human) (Target 2) |
|
K0675203 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 3)) ELL3 sgRNA CRISPR Lentivector (Human) (Target 3) |
|
K0675204 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 1)) Ell3 sgRNA CRISPR Lentivector (Rat) (Target 1) |
|
K6151702 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 2)) Ell3 sgRNA CRISPR Lentivector (Rat) (Target 2) |
|
K6151703 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 3)) Ell3 sgRNA CRISPR Lentivector (Rat) (Target 3) |
|
K6151704 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 1)) Ell3 sgRNA CRISPR Lentivector (Mouse) (Target 1) |
|
K4307202 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 2)) Ell3 sgRNA CRISPR Lentivector (Mouse) (Target 2) |
|
K4307203 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 3)) Ell3 sgRNA CRISPR Lentivector (Mouse) (Target 3) |
|
K4307204 |
ABM |
1.0 ug DNA |
EUR 154 |
 (pPB-C-His)) ELL3 Protein Vector (Mouse) (pPB-C-His) |
|
PV175358 |
ABM |
500 ng |
EUR 603 |
 (pPB-N-His)) ELL3 Protein Vector (Mouse) (pPB-N-His) |
|
PV175359 |
ABM |
500 ng |
EUR 603 |
 (pPM-C-HA)) ELL3 Protein Vector (Mouse) (pPM-C-HA) |
|
PV175360 |
ABM |
500 ng |
EUR 603 |
 (pPM-C-His)) ELL3 Protein Vector (Mouse) (pPM-C-His) |
|
PV175361 |
ABM |
500 ng |
EUR 603 |
 (pPB-C-His)) ELL3 Protein Vector (Rat) (pPB-C-His) |
|
PV265990 |
ABM |
500 ng |
EUR 603 |
 (pPB-N-His)) ELL3 Protein Vector (Rat) (pPB-N-His) |
|
PV265991 |
ABM |
500 ng |
EUR 603 |
 (pPM-C-HA)) ELL3 Protein Vector (Rat) (pPM-C-HA) |
|
PV265992 |
ABM |
500 ng |
EUR 603 |
 (pPM-C-His)) ELL3 Protein Vector (Rat) (pPM-C-His) |
|
PV265993 |
ABM |
500 ng |
EUR 603 |
 (pPB-C-His)) ELL3 Protein Vector (Human) (pPB-C-His) |
|
PV014105 |
ABM |
500 ng |
EUR 329 |
 (pPB-N-His)) ELL3 Protein Vector (Human) (pPB-N-His) |
|
PV014106 |
ABM |
500 ng |
EUR 329 |
 (pPM-C-HA)) ELL3 Protein Vector (Human) (pPM-C-HA) |
|
PV014107 |
ABM |
500 ng |
EUR 329 |
 (pPM-C-His)) ELL3 Protein Vector (Human) (pPM-C-His) |
|
PV014108 |
ABM |
500 ng |
EUR 329 |
 Ell3 3'UTR GFP Stable Cell Line |
|
TU155765 |
ABM |
1.0 ml |
Ask for price |
 Ell3 3'UTR Luciferase Stable Cell Line |
|
TU105765 |
ABM |
1.0 ml |
Ask for price |
Ell3 3'UTR Luciferase Stable Cell Line |
|
TU203932 |
ABM |
1.0 ml |
Ask for price |
Ell3 3'UTR GFP Stable Cell Line |
|
TU253932 |
ABM |
1.0 ml |
Ask for price |
 ELL3 3'UTR GFP Stable Cell Line |
|
TU056833 |
ABM |
1.0 ml |
EUR 1394 |
 ELL3 3'UTR Luciferase Stable Cell Line |
|
TU006833 |
ABM |
1.0 ml |
EUR 1394 |
 GAPDH Rabbit Polyclonal Antibody |
|
37985-100ul |
SAB |
100ul |
EUR 252 |
GAPDH Rabbit Polyclonal Antibody |
|
37985-50ul |
SAB |
50ul |
EUR 187 |
 EFHD1 Rabbit Polyclonal Antibody |
|
38001-100ul |
SAB |
100ul |
EUR 252 |
EFHD1 Rabbit Polyclonal Antibody |
|
38001-50ul |
SAB |
50ul |
EUR 187 |
 Alliinase Rabbit Polyclonal Antibody |
|
38042-100ul |
SAB |
100ul |
EUR 252 |
Alliinase Rabbit Polyclonal Antibody |
|
38042-50ul |
SAB |
50ul |
EUR 187 |
 ECFP Rabbit Polyclonal Antibody |
|
38077-100ul |
SAB |
100ul |
EUR 252 |
ECFP Rabbit Polyclonal Antibody |
|
38077-50ul |
SAB |
50ul |
EUR 187 |
 EYFP Rabbit Polyclonal Antibody |
|
38078-100ul |
SAB |
100ul |
EUR 252 |
EYFP Rabbit Polyclonal Antibody |
|
38078-50ul |
SAB |
50ul |
EUR 187 |
 mOrange Rabbit Polyclonal Antibody |
|
38079-100ul |
SAB |
100ul |
EUR 252 |
mOrange Rabbit Polyclonal Antibody |
|
38079-50ul |
SAB |
50ul |
EUR 187 |
 mStrawberry Rabbit Polyclonal Antibody |
|
38083-100ul |
SAB |
100ul |
EUR 252 |
mStrawberry Rabbit Polyclonal Antibody |
|
38083-50ul |
SAB |
50ul |
EUR 187 |
 AmCyan Rabbit Polyclonal Antibody |
|
38086-100ul |
SAB |
100ul |
EUR 252 |
AmCyan Rabbit Polyclonal Antibody |
|
38086-50ul |
SAB |
50ul |
EUR 187 |
 EBFP Rabbit Polyclonal Antibody |
|
38087-100ul |
SAB |
100ul |
EUR 252 |
EBFP Rabbit Polyclonal Antibody |
|
38087-50ul |
SAB |
50ul |
EUR 187 |
 Vimentin Rabbit Polyclonal Antibody |
|
38104-100ul |
SAB |
100ul |
EUR 252 |
Vimentin Rabbit Polyclonal Antibody |
|
38104-50ul |
SAB |
50ul |
EUR 187 |
 LDHD Rabbit Polyclonal Antibody |
|
38105-100ul |
SAB |
100ul |
EUR 252 |
LDHD Rabbit Polyclonal Antibody |
|
38105-50ul |
SAB |
50ul |
EUR 187 |
GAPDH Rabbit Polyclonal Antibody |
|
A01021-005ml |
Abbkine |
0.05ml |
EUR 147 |
- Immunogen information: Recombinant Protein
- Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
- Show more
|
|
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein |
GAPDH Rabbit Polyclonal Antibody |
|
A01021-02ml |
Abbkine |
0.2ml |
EUR 332 |
- Immunogen information: Recombinant Protein
- Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
- Show more
|
|
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein |
GAPDH Rabbit Polyclonal Antibody |
|
A01021-02ml5 |
Abbkine |
0.2ml×5 |
EUR 920 |
- Immunogen information: Recombinant Protein
- Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
- Show more
|
|
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein |
 Rabbit Hemoglobin Polyclonal Antibody |
|
A53073 |
EpiGentek |
100 µg |
EUR 570.55 |
|
Description: The best epigenetics products |
 Met Rabbit Polyclonal Antibody |
|
ABP57458-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
Met Rabbit Polyclonal Antibody |
|
ABP57458-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
Met Rabbit Polyclonal Antibody |
|
ABP57458-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
 VEGF Rabbit Polyclonal Antibody |
|
ABP57460-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
VEGF Rabbit Polyclonal Antibody |
|
ABP57460-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
VEGF Rabbit Polyclonal Antibody |
|
ABP57460-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
 CD10 Rabbit Polyclonal Antibody |
|
ABP57461-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of CD10 of MME
- Applications tips:
|
|
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME |
CD10 Rabbit Polyclonal Antibody |
|
ABP57461-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of CD10 of MME
- Applications tips:
|
|
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME |
ELL3 Rabbit Polyclonal Antibody
