Biocat Net

Amine biocat 3.0

GPM6B Rabbit Polyclonal Antibody

GPM6B Polyclonal Antibody

ES9920-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against GPM6B from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

GPM6B Antibody

46094-100ul 100ul
EUR 252

GPM6B Antibody

46094-50ul 50ul
EUR 187

GPM6B Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GPM6B. Recognizes GPM6B from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:500-1:2000, IHC:1:20-1:200, IF:1:50-1:200

GPM6B Antibody

DF9700 200ul
EUR 304
Description: GPM6B Antibody detects endogenous levels of total GPM6B.

GPM6B Antibody

ABD9700 100 ug
EUR 438

Polyclonal GPM6B Antibody (N-term)

APR12203G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human GPM6B (N-term). This antibody is tested and proven to work in the following applications:

GPM6B Polyclonal Antibody, HRP Conjugated

A64671 100 µg
EUR 570.55
Description: The best epigenetics products

GPM6B Polyclonal Antibody, FITC Conjugated

A64672 100 µg
EUR 570.55
Description: kits suitable for this type of research

GPM6B Polyclonal Antibody, Biotin Conjugated

A64673 100 µg
EUR 570.55
Description: fast delivery possible

GPM6B Conjugated Antibody

C46094 100ul
EUR 397

Anti-GPM6B antibody

STJ191078 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to GPM6B


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

GPM6B Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GPM6B. Recognizes GPM6B from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

GPM6B Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GPM6B. Recognizes GPM6B from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

GPM6B Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GPM6B. Recognizes GPM6B from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

GPM6B Blocking Peptide

DF9700-BP 1mg
EUR 195

GPM6B cloning plasmid

CSB-CL614417HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 918
  • Sequence: atgaagccagccatggaaactgcagccgaggaaaatactgaacaaagccaagagagaaaagtgaacagcagagctgaaatggaaattggcaggtaccactggatgtacccaggctcaaagaaccaccagtaccatcccgtgccaaccctgggggacagggctagccccttgagcag
  • Show more
Description: A cloning plasmid for the GPM6B gene.


PVT12814 2 ug
EUR 391


EF005057 96 Tests
EUR 689

Rat GPM6B shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human GPM6B shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse GPM6B shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

GPM6B Recombinant Protein (Human)

RP013756 100 ug Ask for price

GPM6B Recombinant Protein (Rat)

RP203252 100 ug Ask for price

GPM6B Recombinant Protein (Mouse)

RP139346 100 ug Ask for price

GPM6B Recombinant Protein (Mouse)

RP139349 100 ug Ask for price

GPM6B Recombinant Protein (Mouse)

RP139352 100 ug Ask for price

GPM6B Recombinant Protein (Mouse)

RP139355 100 ug Ask for price

GPM6B Recombinant Protein (Mouse)

RP139358 100 ug Ask for price

GPM6B Recombinant Protein (Mouse)

RP139361 100 ug Ask for price

GPM6B Recombinant Protein (Mouse)

RP139364 100 ug Ask for price

GPM6B Recombinant Protein (Mouse)

RP139367 100 ug Ask for price

GPM6B Recombinant Protein (Mouse)

RP139370 100 ug Ask for price

Neuronal Membrane Glycoprotein M6-B (GPM6B) Antibody

abx026488-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Neuronal Membrane Glycoprotein M6-B (GPM6B) Antibody

abx026488-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Neuronal Membrane Glycoprotein M6-B (GPM6B) Antibody

  • EUR 425.00
  • EUR 342.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Neuronal Membrane Glycoprotein M6-B (GPM6B) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Gpm6b ORF Vector (Rat) (pORF)

ORF067752 1.0 ug DNA
EUR 506

GPM6B ORF Vector (Human) (pORF)

ORF004586 1.0 ug DNA
EUR 95

Gpm6b ORF Vector (Mouse) (pORF)

ORF046450 1.0 ug DNA
EUR 506

Gpm6b ORF Vector (Mouse) (pORF)

ORF046451 1.0 ug DNA
EUR 506

Gpm6b ORF Vector (Mouse) (pORF)

ORF046452 1.0 ug DNA
EUR 506

Gpm6b ORF Vector (Mouse) (pORF)

ORF046453 1.0 ug DNA
EUR 506

Gpm6b ORF Vector (Mouse) (pORF)

ORF046454 1.0 ug DNA
EUR 506

Gpm6b ORF Vector (Mouse) (pORF)

ORF046455 1.0 ug DNA
EUR 506

Gpm6b ORF Vector (Mouse) (pORF)

ORF046456 1.0 ug DNA
EUR 506

GPM6B Rabbit Polyclonal Antibody