HCN3 Rabbit Polyclonal Antibody

HCN3 Polyclonal Antibody

ES10036-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HCN3 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

HCN3 Polyclonal Antibody

ABP58761-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human HCN3 protein at amino acid sequence of 150-230
  • Applications tips:
Description: A polyclonal antibody for detection of HCN3 from Human, Mouse, Rat. This HCN3 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human HCN3 protein at amino acid sequence of 150-230

HCN3 Polyclonal Antibody

ABP58761-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human HCN3 protein at amino acid sequence of 150-230
  • Applications tips:
Description: A polyclonal antibody for detection of HCN3 from Human, Mouse, Rat. This HCN3 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human HCN3 protein at amino acid sequence of 150-230

HCN3 Polyclonal Antibody

ABP58761-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human HCN3 protein at amino acid sequence of 150-230
  • Applications tips:
Description: A polyclonal antibody for detection of HCN3 from Human, Mouse, Rat. This HCN3 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human HCN3 protein at amino acid sequence of 150-230

Polyclonal HCN3 (extracellular) Antibody

APR12352G 0.05ml
EUR 659
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human HCN3 (extracellular) . This antibody is tested and proven to work in the following applications:

HCN3 Antibody

ABD9770 100 ug
EUR 438

HCN3 antibody

70R-5168 50 ug
EUR 467
Description: Rabbit polyclonal HCN3 antibody raised against the middle region of HCN3

HCN3 Antibody

ABD13116 100 ug
EUR 438

HCN3 Antibody

43682-100ul 100ul
EUR 252

HCN3 antibody

70R-17702 50 ul
EUR 435
Description: Rabbit polyclonal HCN3 antibody

HCN3 Antibody

DF9770 200ul
EUR 304
Description: HCN3 Antibody detects endogenous levels of total HCN3.

HCN3 Antibody

1-CSB-PA010218GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against HCN3. Recognizes HCN3 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

Polyclonal HCN3 Antibody (internal region)

APR12330G 0.1 mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human HCN3 (internal region). This antibody is tested and proven to work in the following applications:

Polyclonal HCN3 antibody - middle region

APR12331G 0.05mg
EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human HCN3 - middle region. This antibody is tested and proven to work in the following applications:

HCN3 Conjugated Antibody

C43682 100ul
EUR 397

anti- HCN3 antibody

FNab03789 100µg
EUR 548.75
  • Recommended dilution: WB: 1:500-1:5000
  • Immunogen: hyperpolarization activated cyclic nucleotide-gated potassium channel 3
  • Uniprot ID: Q9P1Z3
  • Gene ID: 57657
  • Research Area: Cardiovascular
Description: Antibody raised against HCN3

Anti-HCN3 antibody

PAab03789 100 ug
EUR 386

Anti-HCN3 antibody

STJ72294 100 µg
EUR 359

Anti-HCN3 antibody

STJ191194 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to HCN3

Hcn3/ Rat Hcn3 ELISA Kit

ELI-31647r 96 Tests
EUR 886

HCN3 siRNA

20-abx902428
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

HCN3 siRNA

20-abx919159
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

HCN3 siRNA

20-abx919160
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

Monoclonal antibody for HCN3

SMC-306D 0.1mg
EUR 353
  • Hyperpolarization-activated cation channels of the HCN gene family contribute to spontaneous rhythmic activity in both the heart and brain (1).
Description: A monoclonal antibody from clone S141-28 against Human | Mouse HCN3. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 660-779 (C terminus) of mouse HCN3. The antibody is tested and validated for WB, IHC, ICC/IF, AM assays with the following recommended dilutions: WB (1:1000), IHC (1:1000), ICC/IF (1:100). This MAb for HCN3 is not conjugated.

Monoclonal antibody for HCN3

SMC-306D-A390 0.1mg
EUR 400
  • Hyperpolarization-activated cation channels of the HCN gene family contribute to spontaneous rhythmic activity in both the heart and brain (1).
Description: A monoclonal antibody from clone S141-28 against Human | Mouse HCN3. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 660-779 (C terminus) of mouse HCN3. The antibody is tested and validated for WB, IHC, ICC/IF, AM assays with the following recommended dilutions: WB (1:1000), IHC (1:1000), ICC/IF (1:100). This MAb for HCN3 is conjugated with ATTO 390.

Monoclonal antibody for HCN3

SMC-306D-A488 0.1mg
EUR 399
  • Hyperpolarization-activated cation channels of the HCN gene family contribute to spontaneous rhythmic activity in both the heart and brain (1).
Description: A monoclonal antibody from clone S141-28 against Human | Mouse HCN3. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 660-779 (C terminus) of mouse HCN3. The antibody is tested and validated for WB, IHC, ICC/IF, AM assays with the following recommended dilutions: WB (1:1000), IHC (1:1000), ICC/IF (1:100). This MAb for HCN3 is conjugated with ATTO 488.

Monoclonal antibody for HCN3

SMC-306D-A565 0.1mg
EUR 399
  • Hyperpolarization-activated cation channels of the HCN gene family contribute to spontaneous rhythmic activity in both the heart and brain (1).
Description: A monoclonal antibody from clone S141-28 against Human | Mouse HCN3. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 660-779 (C terminus) of mouse HCN3. The antibody is tested and validated for WB, IHC, ICC/IF, AM assays with the following recommended dilutions: WB (1:1000), IHC (1:1000), ICC/IF (1:100). This MAb for HCN3 is conjugated with ATTO 565.

Monoclonal antibody for HCN3

SMC-306D-A594 0.1mg
EUR 399
  • Hyperpolarization-activated cation channels of the HCN gene family contribute to spontaneous rhythmic activity in both the heart and brain (1).
Description: A monoclonal antibody from clone S141-28 against Human | Mouse HCN3. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 660-779 (C terminus) of mouse HCN3. The antibody is tested and validated for WB, IHC, ICC/IF, AM assays with the following recommended dilutions: WB (1:1000), IHC (1:1000), ICC/IF (1:100). This MAb for HCN3 is conjugated with ATTO 594.

Monoclonal antibody for HCN3

SMC-306D-A633 0.1mg
EUR 399
  • Hyperpolarization-activated cation channels of the HCN gene family contribute to spontaneous rhythmic activity in both the heart and brain (1).
Description: A monoclonal antibody from clone S141-28 against Human | Mouse HCN3. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 660-779 (C terminus) of mouse HCN3. The antibody is tested and validated for WB, IHC, ICC/IF, AM assays with the following recommended dilutions: WB (1:1000), IHC (1:1000), ICC/IF (1:100). This MAb for HCN3 is conjugated with ATTO 633.

Monoclonal antibody for HCN3

SMC-306D-A655 0.1mg
EUR 399
  • Hyperpolarization-activated cation channels of the HCN gene family contribute to spontaneous rhythmic activity in both the heart and brain (1).
Description: A monoclonal antibody from clone S141-28 against Human | Mouse HCN3. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 660-779 (C terminus) of mouse HCN3. The antibody is tested and validated for WB, IHC, ICC/IF, AM assays with the following recommended dilutions: WB (1:1000), IHC (1:1000), ICC/IF (1:100). This MAb for HCN3 is conjugated with ATTO 655.

Monoclonal antibody for HCN3

SMC-306D-A680 0.1mg
EUR 399
  • Hyperpolarization-activated cation channels of the HCN gene family contribute to spontaneous rhythmic activity in both the heart and brain (1).
Description: A monoclonal antibody from clone S141-28 against Human | Mouse HCN3. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 660-779 (C terminus) of mouse HCN3. The antibody is tested and validated for WB, IHC, ICC/IF, AM assays with the following recommended dilutions: WB (1:1000), IHC (1:1000), ICC/IF (1:100). This MAb for HCN3 is conjugated with ATTO 680.

Monoclonal antibody for HCN3

SMC-306D-A700 0.1mg
EUR 399
  • Hyperpolarization-activated cation channels of the HCN gene family contribute to spontaneous rhythmic activity in both the heart and brain (1).
Description: A monoclonal antibody from clone S141-28 against Human | Mouse HCN3. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 660-779 (C terminus) of mouse HCN3. The antibody is tested and validated for WB, IHC, ICC/IF, AM assays with the following recommended dilutions: WB (1:1000), IHC (1:1000), ICC/IF (1:100). This MAb for HCN3 is conjugated with ATTO 700.

Monoclonal antibody for HCN3

SMC-306D-ALP 0.1mg
EUR 393
  • Hyperpolarization-activated cation channels of the HCN gene family contribute to spontaneous rhythmic activity in both the heart and brain (1).
Description: A monoclonal antibody from clone S141-28 against Human | Mouse HCN3. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 660-779 (C terminus) of mouse HCN3. The antibody is tested and validated for WB, IHC, ICC/IF, AM assays with the following recommended dilutions: WB (1:1000), IHC (1:1000), ICC/IF (1:100). This MAb for HCN3 is conjugated with Alkaline Phosphatase.

Monoclonal antibody for HCN3

SMC-306D-APC 0.1mg
EUR 398
  • Hyperpolarization-activated cation channels of the HCN gene family contribute to spontaneous rhythmic activity in both the heart and brain (1).
Description: A monoclonal antibody from clone S141-28 against Human | Mouse HCN3. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 660-779 (C terminus) of mouse HCN3. The antibody is tested and validated for WB, IHC, ICC/IF, AM assays with the following recommended dilutions: WB (1:1000), IHC (1:1000), ICC/IF (1:100). This MAb for HCN3 is conjugated with APC.

Monoclonal antibody for HCN3

SMC-306D-APCCY7 0.1mg
EUR 470
  • Hyperpolarization-activated cation channels of the HCN gene family contribute to spontaneous rhythmic activity in both the heart and brain (1).
Description: A monoclonal antibody from clone S141-28 against Human | Mouse HCN3. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 660-779 (C terminus) of mouse HCN3. The antibody is tested and validated for WB, IHC, ICC/IF, AM assays with the following recommended dilutions: WB (1:1000), IHC (1:1000), ICC/IF (1:100). This MAb for HCN3 is conjugated with APC/Cy7.

Monoclonal antibody for HCN3

SMC-306D-BI 0.1mg
EUR 395
  • Hyperpolarization-activated cation channels of the HCN gene family contribute to spontaneous rhythmic activity in both the heart and brain (1).
Description: A monoclonal antibody from clone S141-28 against Human | Mouse HCN3. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 660-779 (C terminus) of mouse HCN3. The antibody is tested and validated for WB, IHC, ICC/IF, AM assays with the following recommended dilutions: WB (1:1000), IHC (1:1000), ICC/IF (1:100). This MAb for HCN3 is conjugated with Biotin.

Monoclonal antibody for HCN3

SMC-306D-DY350 0.1mg
EUR 413
  • Hyperpolarization-activated cation channels of the HCN gene family contribute to spontaneous rhythmic activity in both the heart and brain (1).
Description: A monoclonal antibody from clone S141-28 against Human | Mouse HCN3. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 660-779 (C terminus) of mouse HCN3. The antibody is tested and validated for WB, IHC, ICC/IF, AM assays with the following recommended dilutions: WB (1:1000), IHC (1:1000), ICC/IF (1:100). This MAb for HCN3 is conjugated with Dylight 350.

Monoclonal antibody for HCN3

SMC-306D-DY405 0.1mg
EUR 402
  • Hyperpolarization-activated cation channels of the HCN gene family contribute to spontaneous rhythmic activity in both the heart and brain (1).
Description: A monoclonal antibody from clone S141-28 against Human | Mouse HCN3. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 660-779 (C terminus) of mouse HCN3. The antibody is tested and validated for WB, IHC, ICC/IF, AM assays with the following recommended dilutions: WB (1:1000), IHC (1:1000), ICC/IF (1:100). This MAb for HCN3 is conjugated with Dylight 405.

Monoclonal antibody for HCN3

SMC-306D-DY488 0.1mg
EUR 392
  • Hyperpolarization-activated cation channels of the HCN gene family contribute to spontaneous rhythmic activity in both the heart and brain (1).
Description: A monoclonal antibody from clone S141-28 against Human | Mouse HCN3. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 660-779 (C terminus) of mouse HCN3. The antibody is tested and validated for WB, IHC, ICC/IF, AM assays with the following recommended dilutions: WB (1:1000), IHC (1:1000), ICC/IF (1:100). This MAb for HCN3 is conjugated with Dylight 488.

Monoclonal antibody for HCN3

SMC-306D-DY594 0.1mg
EUR 394
  • Hyperpolarization-activated cation channels of the HCN gene family contribute to spontaneous rhythmic activity in both the heart and brain (1).
Description: A monoclonal antibody from clone S141-28 against Human | Mouse HCN3. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 660-779 (C terminus) of mouse HCN3. The antibody is tested and validated for WB, IHC, ICC/IF, AM assays with the following recommended dilutions: WB (1:1000), IHC (1:1000), ICC/IF (1:100). This MAb for HCN3 is conjugated with Dylight 594.

Monoclonal antibody for HCN3

SMC-306D-DY633 0.1mg
EUR 389
  • Hyperpolarization-activated cation channels of the HCN gene family contribute to spontaneous rhythmic activity in both the heart and brain (1).
Description: A monoclonal antibody from clone S141-28 against Human | Mouse HCN3. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 660-779 (C terminus) of mouse HCN3. The antibody is tested and validated for WB, IHC, ICC/IF, AM assays with the following recommended dilutions: WB (1:1000), IHC (1:1000), ICC/IF (1:100). This MAb for HCN3 is conjugated with Dylight 633.

Monoclonal antibody for HCN3

SMC-306D-FITC 0.1mg
EUR 391
  • Hyperpolarization-activated cation channels of the HCN gene family contribute to spontaneous rhythmic activity in both the heart and brain (1).
Description: A monoclonal antibody from clone S141-28 against Human | Mouse HCN3. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 660-779 (C terminus) of mouse HCN3. The antibody is tested and validated for WB, IHC, ICC/IF, AM assays with the following recommended dilutions: WB (1:1000), IHC (1:1000), ICC/IF (1:100). This MAb for HCN3 is conjugated with FITC.

Monoclonal antibody for HCN3

SMC-306D-HRP 0.1mg
EUR 387
  • Hyperpolarization-activated cation channels of the HCN gene family contribute to spontaneous rhythmic activity in both the heart and brain (1).
Description: A monoclonal antibody from clone S141-28 against Human | Mouse HCN3. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 660-779 (C terminus) of mouse HCN3. The antibody is tested and validated for WB, IHC, ICC/IF, AM assays with the following recommended dilutions: WB (1:1000), IHC (1:1000), ICC/IF (1:100). This MAb for HCN3 is conjugated with HRP.

Monoclonal antibody for HCN3

SMC-306D-P594 0.1mg
EUR 406
  • Hyperpolarization-activated cation channels of the HCN gene family contribute to spontaneous rhythmic activity in both the heart and brain (1).
Description: A monoclonal antibody from clone S141-28 against Human | Mouse HCN3. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 660-779 (C terminus) of mouse HCN3. The antibody is tested and validated for WB, IHC, ICC/IF, AM assays with the following recommended dilutions: WB (1:1000), IHC (1:1000), ICC/IF (1:100). This MAb for HCN3 is conjugated with PE/ATTO 594.

Monoclonal antibody for HCN3

SMC-306D-PCP 0.1mg
EUR 398
  • Hyperpolarization-activated cation channels of the HCN gene family contribute to spontaneous rhythmic activity in both the heart and brain (1).
Description: A monoclonal antibody from clone S141-28 against Human | Rat HCN3. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 660-779 (C terminus) of mouse HCN3. The antibody is tested and validated for WB, IHC, ICC/IF, AM assays with the following recommended dilutions: WB (1:1000), IHC (1:1000), ICC/IF (1:100). This MAb for HCN3 is conjugated with PerCP.

Monoclonal antibody for HCN3

SMC-306D-RPE 0.1mg
EUR 396
  • Hyperpolarization-activated cation channels of the HCN gene family contribute to spontaneous rhythmic activity in both the heart and brain (1).
Description: A monoclonal antibody from clone S141-28 against Human | Rat HCN3. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 660-779 (C terminus) of mouse HCN3. The antibody is tested and validated for WB, IHC, ICC/IF, AM assays with the following recommended dilutions: WB (1:1000), IHC (1:1000), ICC/IF (1:100). This MAb for HCN3 is conjugated with RPE.

Monoclonal antibody for HCN3

SMC-306D-STR 0.1mg
EUR 397
  • Hyperpolarization-activated cation channels of the HCN gene family contribute to spontaneous rhythmic activity in both the heart and brain (1).
Description: A monoclonal antibody from clone S141-28 against Human | Rat HCN3. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 660-779 (C terminus) of mouse HCN3. The antibody is tested and validated for WB, IHC, ICC/IF, AM assays with the following recommended dilutions: WB (1:1000), IHC (1:1000), ICC/IF (1:100). This MAb for HCN3 is conjugated with Streptavidin.

Monoclonal antibody for HCN3

SMC-306S 0.012mg
EUR 65
  • Hyperpolarization-activated cation channels of the HCN gene family contribute to spontaneous rhythmic activity in both the heart and brain (1).
Description: A monoclonal antibody from clone S141-28 against Human | Rat HCN3. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 660-779 (C terminus) of mouse HCN3. The antibody is tested and validated for WB, IHC, ICC/IF, AM assays with the following recommended dilutions: WB (1:1000), IHC (1:1000), ICC/IF (1:100). This MAb for HCN3 is not conjugated.

Polyclonal HCN3 (aa 715-728) Antibody (internal region)

APR12351G 0.1 mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human HCN3 (aa 715-728) (internal region). This antibody is tested and proven to work in the following applications:

HCN3 Blocking Peptide

33R-5296 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of HCN3 antibody, catalog no. 70R-5168

HCN3 cloning plasmid

CSB-CL868385HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1341
  • Sequence: atgctcagcatgatcgtaggtgccacatgctacgccatgttcatcggccatgccacggcactcatccagtccctggactcttcccggcgtcagtaccaggagaagtacaagcaggtggagcagtacatgtccttccacaagctgccagcagacacgcggcagcgcatccacgagt
  • Show more
Description: A cloning plasmid for the HCN3 gene.

HCN3 Blocking Peptide

DF9770-BP 1mg
EUR 195

Anti-HCN3 (aa 715-728) antibody

STJ72293 100 µg
EUR 359

Rat HCN3 shRNA Plasmid

20-abx987186
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

HCN3 ELISA KIT|Human

EF010077 96 Tests
EUR 689

Human HCN3 ELISA KIT

ELI-31591h 96 Tests
EUR 824

Mouse Hcn3 ELISA KIT

ELI-38902m 96 Tests
EUR 865

Mouse HCN3 shRNA Plasmid

20-abx970766
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human HCN3 shRNA Plasmid

20-abx961610
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

HCN3 Recombinant Protein (Human)

RP014485 100 ug Ask for price

pCMV-SPORT6-HCN3 Plasmid

PVT16573 2 ug
EUR 325

HCN3 Recombinant Protein (Rat)

RP204308 100 ug Ask for price

HCN3 Recombinant Protein (Mouse)

RP141071 100 ug Ask for price

HCN3 ORF Vector (Human) (pORF)

ORF004829 1.0 ug DNA
EUR 95

Hcn3 ORF Vector (Rat) (pORF)

ORF068104 1.0 ug DNA
EUR 506

Hcn3 ORF Vector (Mouse) (pORF)

ORF047025 1.0 ug DNA
EUR 506

HCN3 sgRNA CRISPR Lentivector set (Human)

K0938301 3 x 1.0 ug
EUR 339

Hcn3 sgRNA CRISPR Lentivector set (Mouse)

K5030201 3 x 1.0 ug
EUR 339

Hcn3 sgRNA CRISPR Lentivector set (Rat)

K7115901 3 x 1.0 ug
EUR 339

Rabbit Anti-Mouse Hyperpolarization-activated Cyclic Nucleotide-gated channel 3 (HCN3) antiserum

HCN31-S 100 ul
EUR 457

HCN3 sgRNA CRISPR Lentivector (Human) (Target 1)

K0938302 1.0 ug DNA
EUR 154

HCN3 sgRNA CRISPR Lentivector (Human) (Target 2)

K0938303 1.0 ug DNA
EUR 154

HCN3 sgRNA CRISPR Lentivector (Human) (Target 3)

K0938304 1.0 ug DNA
EUR 154

Hcn3 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K5030202 1.0 ug DNA
EUR 154

Hcn3 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K5030203 1.0 ug DNA
EUR 154

Hcn3 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K5030204 1.0 ug DNA
EUR 154

Hcn3 sgRNA CRISPR Lentivector (Rat) (Target 1)

K7115902 1.0 ug DNA
EUR 154

Hcn3 sgRNA CRISPR Lentivector (Rat) (Target 2)

K7115903 1.0 ug DNA
EUR 154

Hcn3 sgRNA CRISPR Lentivector (Rat) (Target 3)

K7115904 1.0 ug DNA
EUR 154

HCN3 Protein Vector (Rat) (pPB-C-His)

PV272414 500 ng
EUR 1166

HCN3 Protein Vector (Rat) (pPB-N-His)

PV272415 500 ng
EUR 1166

HCN3 Protein Vector (Rat) (pPM-C-HA)

PV272416 500 ng
EUR 1166

HCN3 Protein Vector (Rat) (pPM-C-His)

PV272417 500 ng
EUR 1166

HCN3 Protein Vector (Human) (pPB-C-His)

PV019313 500 ng
EUR 329

HCN3 Protein Vector (Human) (pPB-N-His)

PV019314 500 ng
EUR 329

HCN3 Protein Vector (Human) (pPM-C-HA)

PV019315 500 ng
EUR 329

HCN3 Protein Vector (Human) (pPM-C-His)

PV019316 500 ng
EUR 329

HCN3 Protein Vector (Mouse) (pPB-C-His)

PV188098 500 ng
EUR 1065

HCN3 Protein Vector (Mouse) (pPB-N-His)

PV188099 500 ng
EUR 1065

HCN3 Protein Vector (Mouse) (pPM-C-HA)

PV188100 500 ng
EUR 1065

HCN3 Protein Vector (Mouse) (pPM-C-His)

PV188101 500 ng
EUR 1065

Hcn3 3'UTR Luciferase Stable Cell Line

TU205674 1.0 ml Ask for price

Hcn3 3'UTR GFP Stable Cell Line

TU159397 1.0 ml Ask for price

HCN3 3'UTR Luciferase Stable Cell Line

TU009641 1.0 ml
EUR 1394

Hcn3 3'UTR Luciferase Stable Cell Line

TU109397 1.0 ml Ask for price

HCN3 3'UTR GFP Stable Cell Line

TU059641 1.0 ml
EUR 1394

Hcn3 3'UTR GFP Stable Cell Line

TU255674 1.0 ml Ask for price

HCN3 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)

LV678709 1.0 ug DNA
EUR 1355

HCN3 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)

LV678713 1.0 ug DNA
EUR 1355

HCN3 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)

LV678714 1.0 ug DNA
EUR 1355

Rabbit Anti-Mouse Hyperpolarization-activated Cyclic Nucleotide-gated channel 3 (HCN3) IgG, aff pure

HCN31-A 100 ug
EUR 482

VEGF Rabbit Polyclonal Antibody

ES8453-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

VEGF Rabbit Polyclonal Antibody

ES8453-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody

ES8454-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody

ES8454-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody

ES8455-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody

ES8455-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8456-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8456-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8457-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8457-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSC70 Rabbit Polyclonal Antibody

ES8558-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSC70 Rabbit Polyclonal Antibody

ES8558-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody

ES8559-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody

ES8559-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP90? Rabbit Polyclonal Antibody

ES8560-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSP90? Rabbit Polyclonal Antibody

ES8560-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

IkB ? Rabbit Polyclonal Antibody

ES8561-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

IkB ? Rabbit Polyclonal Antibody

ES8561-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JAK1 Rabbit Polyclonal Antibody

ES8562-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK1 Rabbit Polyclonal Antibody

ES8562-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK2 Rabbit Polyclonal Antibody

ES8563-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK2 Rabbit Polyclonal Antibody

ES8563-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JNK2 Rabbit Polyclonal Antibody

ES8564-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JNK2 Rabbit Polyclonal Antibody

ES8564-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JNK3 Rabbit Polyclonal Antibody

ES8565-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JNK3 Rabbit Polyclonal Antibody

ES8565-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

MEK2 Rabbit Polyclonal Antibody

ES8566-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC

MEK2 Rabbit Polyclonal Antibody

ES8566-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC

MEK3 Rabbit Polyclonal Antibody

ES8567-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

MEK3 Rabbit Polyclonal Antibody

ES8567-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Nrf2 Rabbit Polyclonal Antibody

ES8568-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Nrf2 Rabbit Polyclonal Antibody

ES8568-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4a Rabbit Polyclonal Antibody

ES8569-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4a Rabbit Polyclonal Antibody

ES8569-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4b Rabbit Polyclonal Antibody

ES8570-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4b Rabbit Polyclonal Antibody

ES8570-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4c Rabbit Polyclonal Antibody

ES8571-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4c Rabbit Polyclonal Antibody

ES8571-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG5 Rabbit Polyclonal Antibody

ES8572-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG5 Rabbit Polyclonal Antibody

ES8572-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG7 Rabbit Polyclonal Antibody

ES8573-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG7 Rabbit Polyclonal Antibody

ES8573-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG13 Rabbit Polyclonal Antibody

ES8574-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG13 Rabbit Polyclonal Antibody

ES8574-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG13 Rabbit Polyclonal Antibody

ES8575-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG13 Rabbit Polyclonal Antibody

ES8575-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG14L Rabbit Polyclonal Antibody

ES8576-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG14L Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG14L Rabbit Polyclonal Antibody

ES8576-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG14L Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NBR1 Rabbit Polyclonal Antibody

ES8578-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NBR1 Rabbit Polyclonal Antibody

ES8578-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NBR1 Rabbit Polyclonal Antibody

ES8579-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NBR1 Rabbit Polyclonal Antibody

ES8579-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

WIPI2 Rabbit Polyclonal Antibody

ES8580-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against WIPI2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

WIPI2 Rabbit Polyclonal Antibody

ES8580-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against WIPI2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Gab1 Rabbit Polyclonal Antibody

ES8582-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against Gab1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Gab1 Rabbit Polyclonal Antibody

ES8582-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against Gab1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ERK1 Rabbit Polyclonal Antibody

ES8583-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ERK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ERK1 Rabbit Polyclonal Antibody

ES8583-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ERK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Met Rabbit Polyclonal Antibody

ABP57458-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

Met Rabbit Polyclonal Antibody

ABP57458-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

Met Rabbit Polyclonal Antibody

ABP57458-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

VEGF Rabbit Polyclonal Antibody

ABP57460-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

VEGF Rabbit Polyclonal Antibody

ABP57460-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

VEGF Rabbit Polyclonal Antibody

ABP57460-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

HCN3 Rabbit Polyclonal Antibody