 HCN3 Polyclonal Antibody |
|
ABP58761-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from part region of human HCN3 protein at amino acid sequence of 150-230
- Applications tips:
|
|
Description: A polyclonal antibody for detection of HCN3 from Human, Mouse, Rat. This HCN3 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human HCN3 protein at amino acid sequence of 150-230 |
HCN3 Polyclonal Antibody |
|
ABP58761-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human HCN3 protein at amino acid sequence of 150-230
- Applications tips:
|
|
Description: A polyclonal antibody for detection of HCN3 from Human, Mouse, Rat. This HCN3 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human HCN3 protein at amino acid sequence of 150-230 |
HCN3 Polyclonal Antibody |
|
ES10036-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against HCN3 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA |
HCN3 Polyclonal Antibody |
|
ES10036-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against HCN3 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA |
 Antibody) Polyclonal HCN3 (extracellular) Antibody |
|
APR12352G |
Leading Biology |
0.05ml |
EUR 659 |
|
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human HCN3 (extracellular) . This antibody is tested and proven to work in the following applications: |
 HCN3 antibody |
|
70R-17702 |
Fitzgerald |
50 ul |
EUR 435 |
|
Description: Rabbit polyclonal HCN3 antibody |
 HCN3 Antibody |
|
43682-100ul |
SAB |
100ul |
EUR 252 |
HCN3 Antibody |
|
DF9770 |
Affbiotech |
200ul |
EUR 304 |
|
Description: HCN3 Antibody detects endogenous levels of total HCN3. |
HCN3 antibody |
|
70R-5168 |
Fitzgerald |
50 ug |
EUR 467 |
|
Description: Rabbit polyclonal HCN3 antibody raised against the middle region of HCN3 |
HCN3 Antibody |
|
1-CSB-PA010218GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
|
|
Description: A polyclonal antibody against HCN3. Recognizes HCN3 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB |
) Polyclonal HCN3 Antibody (internal region) |
|
APR12330G |
Leading Biology |
0.1 mg |
EUR 484 |
|
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human HCN3 (internal region). This antibody is tested and proven to work in the following applications: |
 Polyclonal HCN3 antibody - middle region |
|
APR12331G |
Leading Biology |
0.05mg |
EUR 528 |
|
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human HCN3 - middle region. This antibody is tested and proven to work in the following applications: |
 HCN3 Conjugated Antibody |
|
C43682 |
SAB |
100ul |
EUR 397 |
 anti- HCN3 antibody |
|
FNab03789 |
FN Test |
100µg |
EUR 548.75 |
- Recommended dilution: WB: 1:500-1:5000
- Immunogen: hyperpolarization activated cyclic nucleotide-gated potassium channel 3
- Uniprot ID: Q9P1Z3
- Gene ID: 57657
- Research Area: Cardiovascular
|
|
Description: Antibody raised against HCN3 |
 Anti-HCN3 antibody |
|
STJ191194 |
St John's Laboratory |
200 µl |
EUR 197 |
|
Description: Unconjugated Rabbit polyclonal to HCN3 |
 HCN3 siRNA |
|
20-abx902428 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
HCN3 siRNA |
|
20-abx919159 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
HCN3 siRNA |
|
20-abx919160 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
 Monoclonal antibody for HCN3 |
|
SMC-306D |
Stressmarq |
0.1mg |
EUR 353 |
- Hyperpolarization-activated cation channels of the HCN gene family contribute to spontaneous rhythmic activity in both the heart and brain (1).
|
|
Description: A monoclonal antibody from clone S141-28 against Human | Mouse HCN3. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 660-779 (C terminus) of mouse HCN3. The antibody is tested and validated for WB, IHC, ICC/IF, AM assays with the following recommended dilutions: WB (1:1000), IHC (1:1000), ICC/IF (1:100). This MAb for HCN3 is not conjugated. |
Monoclonal antibody for HCN3 |
|
SMC-306D-A390 |
Stressmarq |
0.1mg |
EUR 400 |
- Hyperpolarization-activated cation channels of the HCN gene family contribute to spontaneous rhythmic activity in both the heart and brain (1).
|
|
Description: A monoclonal antibody from clone S141-28 against Human | Mouse HCN3. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 660-779 (C terminus) of mouse HCN3. The antibody is tested and validated for WB, IHC, ICC/IF, AM assays with the following recommended dilutions: WB (1:1000), IHC (1:1000), ICC/IF (1:100). This MAb for HCN3 is conjugated with ATTO 390. |
Monoclonal antibody for HCN3 |
|
SMC-306D-A488 |
Stressmarq |
0.1mg |
EUR 399 |
- Hyperpolarization-activated cation channels of the HCN gene family contribute to spontaneous rhythmic activity in both the heart and brain (1).
|
|
Description: A monoclonal antibody from clone S141-28 against Human | Mouse HCN3. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 660-779 (C terminus) of mouse HCN3. The antibody is tested and validated for WB, IHC, ICC/IF, AM assays with the following recommended dilutions: WB (1:1000), IHC (1:1000), ICC/IF (1:100). This MAb for HCN3 is conjugated with ATTO 488. |
Monoclonal antibody for HCN3 |
|
SMC-306D-A565 |
Stressmarq |
0.1mg |
EUR 399 |
- Hyperpolarization-activated cation channels of the HCN gene family contribute to spontaneous rhythmic activity in both the heart and brain (1).
|
|
Description: A monoclonal antibody from clone S141-28 against Human | Mouse HCN3. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 660-779 (C terminus) of mouse HCN3. The antibody is tested and validated for WB, IHC, ICC/IF, AM assays with the following recommended dilutions: WB (1:1000), IHC (1:1000), ICC/IF (1:100). This MAb for HCN3 is conjugated with ATTO 565. |
Monoclonal antibody for HCN3 |
|
SMC-306D-A594 |
Stressmarq |
0.1mg |
EUR 399 |
- Hyperpolarization-activated cation channels of the HCN gene family contribute to spontaneous rhythmic activity in both the heart and brain (1).
|
|
Description: A monoclonal antibody from clone S141-28 against Human | Mouse HCN3. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 660-779 (C terminus) of mouse HCN3. The antibody is tested and validated for WB, IHC, ICC/IF, AM assays with the following recommended dilutions: WB (1:1000), IHC (1:1000), ICC/IF (1:100). This MAb for HCN3 is conjugated with ATTO 594. |
Monoclonal antibody for HCN3 |
|
SMC-306D-A633 |
Stressmarq |
0.1mg |
EUR 399 |
- Hyperpolarization-activated cation channels of the HCN gene family contribute to spontaneous rhythmic activity in both the heart and brain (1).
|
|
Description: A monoclonal antibody from clone S141-28 against Human | Mouse HCN3. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 660-779 (C terminus) of mouse HCN3. The antibody is tested and validated for WB, IHC, ICC/IF, AM assays with the following recommended dilutions: WB (1:1000), IHC (1:1000), ICC/IF (1:100). This MAb for HCN3 is conjugated with ATTO 633. |
Monoclonal antibody for HCN3 |
|
SMC-306D-A655 |
Stressmarq |
0.1mg |
EUR 399 |
- Hyperpolarization-activated cation channels of the HCN gene family contribute to spontaneous rhythmic activity in both the heart and brain (1).
|
|
Description: A monoclonal antibody from clone S141-28 against Human | Mouse HCN3. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 660-779 (C terminus) of mouse HCN3. The antibody is tested and validated for WB, IHC, ICC/IF, AM assays with the following recommended dilutions: WB (1:1000), IHC (1:1000), ICC/IF (1:100). This MAb for HCN3 is conjugated with ATTO 655. |
Monoclonal antibody for HCN3 |
|
SMC-306D-A680 |
Stressmarq |
0.1mg |
EUR 399 |
- Hyperpolarization-activated cation channels of the HCN gene family contribute to spontaneous rhythmic activity in both the heart and brain (1).
|
|
Description: A monoclonal antibody from clone S141-28 against Human | Mouse HCN3. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 660-779 (C terminus) of mouse HCN3. The antibody is tested and validated for WB, IHC, ICC/IF, AM assays with the following recommended dilutions: WB (1:1000), IHC (1:1000), ICC/IF (1:100). This MAb for HCN3 is conjugated with ATTO 680. |
Monoclonal antibody for HCN3 |
|
SMC-306D-A700 |
Stressmarq |
0.1mg |
EUR 399 |
- Hyperpolarization-activated cation channels of the HCN gene family contribute to spontaneous rhythmic activity in both the heart and brain (1).
|
|
Description: A monoclonal antibody from clone S141-28 against Human | Mouse HCN3. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 660-779 (C terminus) of mouse HCN3. The antibody is tested and validated for WB, IHC, ICC/IF, AM assays with the following recommended dilutions: WB (1:1000), IHC (1:1000), ICC/IF (1:100). This MAb for HCN3 is conjugated with ATTO 700. |
Monoclonal antibody for HCN3 |
|
SMC-306D-ALP |
Stressmarq |
0.1mg |
EUR 393 |
- Hyperpolarization-activated cation channels of the HCN gene family contribute to spontaneous rhythmic activity in both the heart and brain (1).
|
|
Description: A monoclonal antibody from clone S141-28 against Human | Mouse HCN3. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 660-779 (C terminus) of mouse HCN3. The antibody is tested and validated for WB, IHC, ICC/IF, AM assays with the following recommended dilutions: WB (1:1000), IHC (1:1000), ICC/IF (1:100). This MAb for HCN3 is conjugated with Alkaline Phosphatase. |
Monoclonal antibody for HCN3 |
|
SMC-306D-APC |
Stressmarq |
0.1mg |
EUR 398 |
- Hyperpolarization-activated cation channels of the HCN gene family contribute to spontaneous rhythmic activity in both the heart and brain (1).
|
|
Description: A monoclonal antibody from clone S141-28 against Human | Mouse HCN3. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 660-779 (C terminus) of mouse HCN3. The antibody is tested and validated for WB, IHC, ICC/IF, AM assays with the following recommended dilutions: WB (1:1000), IHC (1:1000), ICC/IF (1:100). This MAb for HCN3 is conjugated with APC. |
Monoclonal antibody for HCN3 |
|
SMC-306D-APCCY7 |
Stressmarq |
0.1mg |
EUR 470 |
- Hyperpolarization-activated cation channels of the HCN gene family contribute to spontaneous rhythmic activity in both the heart and brain (1).
|
|
Description: A monoclonal antibody from clone S141-28 against Human | Mouse HCN3. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 660-779 (C terminus) of mouse HCN3. The antibody is tested and validated for WB, IHC, ICC/IF, AM assays with the following recommended dilutions: WB (1:1000), IHC (1:1000), ICC/IF (1:100). This MAb for HCN3 is conjugated with APC/Cy7. |
Monoclonal antibody for HCN3 |
|
SMC-306D-BI |
Stressmarq |
0.1mg |
EUR 395 |
- Hyperpolarization-activated cation channels of the HCN gene family contribute to spontaneous rhythmic activity in both the heart and brain (1).
|
|
Description: A monoclonal antibody from clone S141-28 against Human | Mouse HCN3. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 660-779 (C terminus) of mouse HCN3. The antibody is tested and validated for WB, IHC, ICC/IF, AM assays with the following recommended dilutions: WB (1:1000), IHC (1:1000), ICC/IF (1:100). This MAb for HCN3 is conjugated with Biotin. |
Monoclonal antibody for HCN3 |
|
SMC-306D-DY350 |
Stressmarq |
0.1mg |
EUR 413 |
- Hyperpolarization-activated cation channels of the HCN gene family contribute to spontaneous rhythmic activity in both the heart and brain (1).
|
|
Description: A monoclonal antibody from clone S141-28 against Human | Mouse HCN3. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 660-779 (C terminus) of mouse HCN3. The antibody is tested and validated for WB, IHC, ICC/IF, AM assays with the following recommended dilutions: WB (1:1000), IHC (1:1000), ICC/IF (1:100). This MAb for HCN3 is conjugated with Dylight 350. |
Monoclonal antibody for HCN3 |
|
SMC-306D-DY405 |
Stressmarq |
0.1mg |
EUR 402 |
- Hyperpolarization-activated cation channels of the HCN gene family contribute to spontaneous rhythmic activity in both the heart and brain (1).
|
|
Description: A monoclonal antibody from clone S141-28 against Human | Mouse HCN3. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 660-779 (C terminus) of mouse HCN3. The antibody is tested and validated for WB, IHC, ICC/IF, AM assays with the following recommended dilutions: WB (1:1000), IHC (1:1000), ICC/IF (1:100). This MAb for HCN3 is conjugated with Dylight 405. |
Monoclonal antibody for HCN3 |
|
SMC-306D-DY488 |
Stressmarq |
0.1mg |
EUR 392 |
- Hyperpolarization-activated cation channels of the HCN gene family contribute to spontaneous rhythmic activity in both the heart and brain (1).
|
|
Description: A monoclonal antibody from clone S141-28 against Human | Mouse HCN3. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 660-779 (C terminus) of mouse HCN3. The antibody is tested and validated for WB, IHC, ICC/IF, AM assays with the following recommended dilutions: WB (1:1000), IHC (1:1000), ICC/IF (1:100). This MAb for HCN3 is conjugated with Dylight 488. |
Monoclonal antibody for HCN3 |
|
SMC-306D-DY594 |
Stressmarq |
0.1mg |
EUR 394 |
- Hyperpolarization-activated cation channels of the HCN gene family contribute to spontaneous rhythmic activity in both the heart and brain (1).
|
|
Description: A monoclonal antibody from clone S141-28 against Human | Mouse HCN3. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 660-779 (C terminus) of mouse HCN3. The antibody is tested and validated for WB, IHC, ICC/IF, AM assays with the following recommended dilutions: WB (1:1000), IHC (1:1000), ICC/IF (1:100). This MAb for HCN3 is conjugated with Dylight 594. |
Monoclonal antibody for HCN3 |
|
SMC-306D-DY633 |
Stressmarq |
0.1mg |
EUR 389 |
- Hyperpolarization-activated cation channels of the HCN gene family contribute to spontaneous rhythmic activity in both the heart and brain (1).
|
|
Description: A monoclonal antibody from clone S141-28 against Human | Mouse HCN3. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 660-779 (C terminus) of mouse HCN3. The antibody is tested and validated for WB, IHC, ICC/IF, AM assays with the following recommended dilutions: WB (1:1000), IHC (1:1000), ICC/IF (1:100). This MAb for HCN3 is conjugated with Dylight 633. |
Monoclonal antibody for HCN3 |
|
SMC-306D-FITC |
Stressmarq |
0.1mg |
EUR 391 |
- Hyperpolarization-activated cation channels of the HCN gene family contribute to spontaneous rhythmic activity in both the heart and brain (1).
|
|
Description: A monoclonal antibody from clone S141-28 against Human | Mouse HCN3. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 660-779 (C terminus) of mouse HCN3. The antibody is tested and validated for WB, IHC, ICC/IF, AM assays with the following recommended dilutions: WB (1:1000), IHC (1:1000), ICC/IF (1:100). This MAb for HCN3 is conjugated with FITC. |
Monoclonal antibody for HCN3 |
|
SMC-306D-HRP |
Stressmarq |
0.1mg |
EUR 387 |
- Hyperpolarization-activated cation channels of the HCN gene family contribute to spontaneous rhythmic activity in both the heart and brain (1).
|
|
Description: A monoclonal antibody from clone S141-28 against Human | Mouse HCN3. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 660-779 (C terminus) of mouse HCN3. The antibody is tested and validated for WB, IHC, ICC/IF, AM assays with the following recommended dilutions: WB (1:1000), IHC (1:1000), ICC/IF (1:100). This MAb for HCN3 is conjugated with HRP. |
Monoclonal antibody for HCN3 |
|
SMC-306D-P594 |
Stressmarq |
0.1mg |
EUR 406 |
- Hyperpolarization-activated cation channels of the HCN gene family contribute to spontaneous rhythmic activity in both the heart and brain (1).
|
|
Description: A monoclonal antibody from clone S141-28 against Human | Mouse HCN3. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 660-779 (C terminus) of mouse HCN3. The antibody is tested and validated for WB, IHC, ICC/IF, AM assays with the following recommended dilutions: WB (1:1000), IHC (1:1000), ICC/IF (1:100). This MAb for HCN3 is conjugated with PE/ATTO 594. |
Monoclonal antibody for HCN3 |
|
SMC-306D-PCP |
Stressmarq |
0.1mg |
EUR 398 |
- Hyperpolarization-activated cation channels of the HCN gene family contribute to spontaneous rhythmic activity in both the heart and brain (1).
|
|
Description: A monoclonal antibody from clone S141-28 against Human | Rat HCN3. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 660-779 (C terminus) of mouse HCN3. The antibody is tested and validated for WB, IHC, ICC/IF, AM assays with the following recommended dilutions: WB (1:1000), IHC (1:1000), ICC/IF (1:100). This MAb for HCN3 is conjugated with PerCP. |
Monoclonal antibody for HCN3 |
|
SMC-306D-RPE |
Stressmarq |
0.1mg |
EUR 396 |
- Hyperpolarization-activated cation channels of the HCN gene family contribute to spontaneous rhythmic activity in both the heart and brain (1).
|
|
Description: A monoclonal antibody from clone S141-28 against Human | Rat HCN3. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 660-779 (C terminus) of mouse HCN3. The antibody is tested and validated for WB, IHC, ICC/IF, AM assays with the following recommended dilutions: WB (1:1000), IHC (1:1000), ICC/IF (1:100). This MAb for HCN3 is conjugated with RPE. |
Monoclonal antibody for HCN3 |
|
SMC-306D-STR |
Stressmarq |
0.1mg |
EUR 397 |
- Hyperpolarization-activated cation channels of the HCN gene family contribute to spontaneous rhythmic activity in both the heart and brain (1).
|
|
Description: A monoclonal antibody from clone S141-28 against Human | Rat HCN3. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 660-779 (C terminus) of mouse HCN3. The antibody is tested and validated for WB, IHC, ICC/IF, AM assays with the following recommended dilutions: WB (1:1000), IHC (1:1000), ICC/IF (1:100). This MAb for HCN3 is conjugated with Streptavidin. |
Monoclonal antibody for HCN3 |
|
SMC-306S |
Stressmarq |
0.012mg |
EUR 65 |
- Hyperpolarization-activated cation channels of the HCN gene family contribute to spontaneous rhythmic activity in both the heart and brain (1).
|
|
Description: A monoclonal antibody from clone S141-28 against Human | Rat HCN3. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 660-779 (C terminus) of mouse HCN3. The antibody is tested and validated for WB, IHC, ICC/IF, AM assays with the following recommended dilutions: WB (1:1000), IHC (1:1000), ICC/IF (1:100). This MAb for HCN3 is not conjugated. |
 Antibody (internal region)) Polyclonal HCN3 (aa 715-728) Antibody (internal region) |
|
APR12351G |
Leading Biology |
0.1 mg |
EUR 484 |
|
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human HCN3 (aa 715-728) (internal region). This antibody is tested and proven to work in the following applications: |
 HCN3 Blocking Peptide |
|
33R-5296 |
Fitzgerald |
100 ug |
EUR 180 |
|
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of HCN3 antibody, catalog no. 70R-5168 |
HCN3 Blocking Peptide |
|
DF9770-BP |
Affbiotech |
1mg |
EUR 195 |
 HCN3 cloning plasmid |
|
CSB-CL868385HU-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1341
- Sequence: atgctcagcatgatcgtaggtgccacatgctacgccatgttcatcggccatgccacggcactcatccagtccctggactcttcccggcgtcagtaccaggagaagtacaagcaggtggagcagtacatgtccttccacaagctgccagcagacacgcggcagcgcatccacgagt
- Show more
|
|
Description: A cloning plasmid for the HCN3 gene. |
 Rat HCN3 shRNA Plasmid |
|
20-abx987186 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
 Human HCN3 shRNA Plasmid |
|
20-abx961610 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
 Mouse HCN3 shRNA Plasmid |
|
20-abx970766 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
) HCN3 Recombinant Protein (Human) |
|
RP014485 |
ABM |
100 ug |
Ask for price |
) HCN3 Recombinant Protein (Rat) |
|
RP204308 |
ABM |
100 ug |
Ask for price |
) HCN3 Recombinant Protein (Mouse) |
|
RP141071 |
ABM |
100 ug |
Ask for price |
 (pORF)) Hcn3 ORF Vector (Rat) (pORF) |
|
ORF068104 |
ABM |
1.0 ug DNA |
EUR 506 |
 (pORF)) HCN3 ORF Vector (Human) (pORF) |
|
ORF004829 |
ABM |
1.0 ug DNA |
EUR 95 |
 (pORF)) Hcn3 ORF Vector (Mouse) (pORF) |
|
ORF047025 |
ABM |
1.0 ug DNA |
EUR 506 |
) Hcn3 sgRNA CRISPR Lentivector set (Mouse) |
|
K5030201 |
ABM |
3 x 1.0 ug |
EUR 339 |
) Hcn3 sgRNA CRISPR Lentivector set (Rat) |
|
K7115901 |
ABM |
3 x 1.0 ug |
EUR 339 |
) HCN3 sgRNA CRISPR Lentivector set (Human) |
|
K0938301 |
ABM |
3 x 1.0 ug |
EUR 339 |
 antiserum) Rabbit Anti-Mouse Hyperpolarization-activated Cyclic Nucleotide-gated channel 3 (HCN3) antiserum |
|
HCN31-S |
Alpha Diagnostics |
100 ul |
EUR 457 |
 (Target 1)) Hcn3 sgRNA CRISPR Lentivector (Mouse) (Target 1) |
|
K5030202 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 2)) Hcn3 sgRNA CRISPR Lentivector (Mouse) (Target 2) |
|
K5030203 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 3)) Hcn3 sgRNA CRISPR Lentivector (Mouse) (Target 3) |
|
K5030204 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 1)) Hcn3 sgRNA CRISPR Lentivector (Rat) (Target 1) |
|
K7115902 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 2)) Hcn3 sgRNA CRISPR Lentivector (Rat) (Target 2) |
|
K7115903 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 3)) Hcn3 sgRNA CRISPR Lentivector (Rat) (Target 3) |
|
K7115904 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 1)) HCN3 sgRNA CRISPR Lentivector (Human) (Target 1) |
|
K0938302 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 2)) HCN3 sgRNA CRISPR Lentivector (Human) (Target 2) |
|
K0938303 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 3)) HCN3 sgRNA CRISPR Lentivector (Human) (Target 3) |
|
K0938304 |
ABM |
1.0 ug DNA |
EUR 154 |
 (pPB-C-His)) HCN3 Protein Vector (Rat) (pPB-C-His) |
|
PV272414 |
ABM |
500 ng |
EUR 1166 |
 (pPB-N-His)) HCN3 Protein Vector (Rat) (pPB-N-His) |
|
PV272415 |
ABM |
500 ng |
EUR 1166 |
 (pPM-C-HA)) HCN3 Protein Vector (Rat) (pPM-C-HA) |
|
PV272416 |
ABM |
500 ng |
EUR 1166 |
 (pPM-C-His)) HCN3 Protein Vector (Rat) (pPM-C-His) |
|
PV272417 |
ABM |
500 ng |
EUR 1166 |
 (pPB-C-His)) HCN3 Protein Vector (Mouse) (pPB-C-His) |
|
PV188098 |
ABM |
500 ng |
EUR 1065 |
 (pPB-N-His)) HCN3 Protein Vector (Mouse) (pPB-N-His) |
|
PV188099 |
ABM |
500 ng |
EUR 1065 |
 (pPM-C-HA)) HCN3 Protein Vector (Mouse) (pPM-C-HA) |
|
PV188100 |
ABM |
500 ng |
EUR 1065 |
 (pPM-C-His)) HCN3 Protein Vector (Mouse) (pPM-C-His) |
|
PV188101 |
ABM |
500 ng |
EUR 1065 |
 (pPB-C-His)) HCN3 Protein Vector (Human) (pPB-C-His) |
|
PV019313 |
ABM |
500 ng |
EUR 329 |
 (pPB-N-His)) HCN3 Protein Vector (Human) (pPB-N-His) |
|
PV019314 |
ABM |
500 ng |
EUR 329 |
 (pPM-C-HA)) HCN3 Protein Vector (Human) (pPM-C-HA) |
|
PV019315 |
ABM |
500 ng |
EUR 329 |
 (pPM-C-His)) HCN3 Protein Vector (Human) (pPM-C-His) |
|
PV019316 |
ABM |
500 ng |
EUR 329 |
 Hcn3 3'UTR Luciferase Stable Cell Line |
|
TU109397 |
ABM |
1.0 ml |
Ask for price |
Hcn3 3'UTR Luciferase Stable Cell Line |
|
TU205674 |
ABM |
1.0 ml |
Ask for price |
 Hcn3 3'UTR GFP Stable Cell Line |
|
TU159397 |
ABM |
1.0 ml |
Ask for price |
Hcn3 3'UTR GFP Stable Cell Line |
|
TU255674 |
ABM |
1.0 ml |
Ask for price |
 HCN3 3'UTR GFP Stable Cell Line |
|
TU059641 |
ABM |
1.0 ml |
EUR 1394 |
 HCN3 3'UTR Luciferase Stable Cell Line |
|
TU009641 |
ABM |
1.0 ml |
EUR 1394 |
 GAPDH Rabbit Polyclonal Antibody |
|
37985-100ul |
SAB |
100ul |
EUR 252 |
GAPDH Rabbit Polyclonal Antibody |
|
37985-50ul |
SAB |
50ul |
EUR 187 |
 EFHD1 Rabbit Polyclonal Antibody |
|
38001-100ul |
SAB |
100ul |
EUR 252 |
EFHD1 Rabbit Polyclonal Antibody |
|
38001-50ul |
SAB |
50ul |
EUR 187 |
 Alliinase Rabbit Polyclonal Antibody |
|
38042-100ul |
SAB |
100ul |
EUR 252 |
Alliinase Rabbit Polyclonal Antibody |
|
38042-50ul |
SAB |
50ul |
EUR 187 |
 ECFP Rabbit Polyclonal Antibody |
|
38077-100ul |
SAB |
100ul |
EUR 252 |
ECFP Rabbit Polyclonal Antibody |
|
38077-50ul |
SAB |
50ul |
EUR 187 |
 EYFP Rabbit Polyclonal Antibody |
|
38078-100ul |
SAB |
100ul |
EUR 252 |
EYFP Rabbit Polyclonal Antibody |
|
38078-50ul |
SAB |
50ul |
EUR 187 |
 mOrange Rabbit Polyclonal Antibody |
|
38079-100ul |
SAB |
100ul |
EUR 252 |
mOrange Rabbit Polyclonal Antibody |
|
38079-50ul |
SAB |
50ul |
EUR 187 |
 mStrawberry Rabbit Polyclonal Antibody |
|
38083-100ul |
SAB |
100ul |
EUR 252 |
mStrawberry Rabbit Polyclonal Antibody |
|
38083-50ul |
SAB |
50ul |
EUR 187 |
 AmCyan Rabbit Polyclonal Antibody |
|
38086-100ul |
SAB |
100ul |
EUR 252 |
AmCyan Rabbit Polyclonal Antibody |
|
38086-50ul |
SAB |
50ul |
EUR 187 |
 EBFP Rabbit Polyclonal Antibody |
|
38087-100ul |
SAB |
100ul |
EUR 252 |
EBFP Rabbit Polyclonal Antibody |
|
38087-50ul |
SAB |
50ul |
EUR 187 |
 Vimentin Rabbit Polyclonal Antibody |
|
38104-100ul |
SAB |
100ul |
EUR 252 |
Vimentin Rabbit Polyclonal Antibody |
|
38104-50ul |
SAB |
50ul |
EUR 187 |
 LDHD Rabbit Polyclonal Antibody |
|
38105-100ul |
SAB |
100ul |
EUR 252 |
LDHD Rabbit Polyclonal Antibody |
|
38105-50ul |
SAB |
50ul |
EUR 187 |
GAPDH Rabbit Polyclonal Antibody |
|
A01021-005ml |
Abbkine |
0.05ml |
EUR 147 |
- Immunogen information: Recombinant Protein
- Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
- Show more
|
|
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein |
GAPDH Rabbit Polyclonal Antibody |
|
A01021-02ml |
Abbkine |
0.2ml |
EUR 332 |
- Immunogen information: Recombinant Protein
- Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
- Show more
|
|
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein |
GAPDH Rabbit Polyclonal Antibody |
|
A01021-02ml5 |
Abbkine |
0.2ml×5 |
EUR 920 |
- Immunogen information: Recombinant Protein
- Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
- Show more
|
|
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein |
 Rabbit Hemoglobin Polyclonal Antibody |
|
A53073 |
EpiGentek |
100 µg |
EUR 570.55 |
|
Description: The best epigenetics products |
 Met Rabbit Polyclonal Antibody |
|
ABP57458-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
Met Rabbit Polyclonal Antibody |
|
ABP57458-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
Met Rabbit Polyclonal Antibody |
|
ABP57458-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
 VEGF Rabbit Polyclonal Antibody |
|
ABP57460-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
VEGF Rabbit Polyclonal Antibody |
|
ABP57460-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
VEGF Rabbit Polyclonal Antibody |
|
ABP57460-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
 CD10 Rabbit Polyclonal Antibody |
|
ABP57461-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of CD10 of MME
- Applications tips:
|
|
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME |
CD10 Rabbit Polyclonal Antibody |
|
ABP57461-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of CD10 of MME
- Applications tips:
|
|
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME |
CD10 Rabbit Polyclonal Antibody |
|
ABP57461-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of CD10 of MME
- Applications tips:
|
|
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME |
 NM23A Rabbit Polyclonal Antibody |
|
ABP57462-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of NM23A of NME1
- Applications tips:
|
|
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1 |
NM23A Rabbit Polyclonal Antibody |
|
ABP57462-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of NM23A of NME1
- Applications tips:
|
|
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1 |
NM23A Rabbit Polyclonal Antibody |
|
ABP57462-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of NM23A of NME1
- Applications tips:
|
|
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1 |
 ATM Rabbit Polyclonal Antibody |
|
ABP57463-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
ATM Rabbit Polyclonal Antibody |
|
ABP57463-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
ATM Rabbit Polyclonal Antibody |
|
ABP57463-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
ATM Rabbit Polyclonal Antibody |
|
ABP57464-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
ATM Rabbit Polyclonal Antibody |
|
ABP57464-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
ATM Rabbit Polyclonal Antibody |
|
ABP57464-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
 HSC70 Rabbit Polyclonal Antibody |
|
ABP57565-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
- Applications tips:
|
|
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8) |
HSC70 Rabbit Polyclonal Antibody |
|
ABP57565-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
- Applications tips:
|
|
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8) |
HSC70 Rabbit Polyclonal Antibody |
|
ABP57565-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
- Applications tips:
|
|
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8) |
 HSP40 Rabbit Polyclonal Antibody |
|
ABP57566-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of HSP40
- Applications tips:
|
|
Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40 |
HSP40 Rabbit Polyclonal Antibody |
|
ABP57566-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of HSP40
- Applications tips:
|
|
Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40 |
HSP40 Rabbit Polyclonal Antibody |
|
ABP57566-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of HSP40
- Applications tips:
|
|
Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40 |
 HSP90Alpha Rabbit Polyclonal Antibody |
|
ABP57567-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of HSP90?
- Applications tips:
|
|
Description: A polyclonal antibody for detection of HSP90Alpha from Human, Mouse, Rat. This HSP90Alpha antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP90? |
HSP90Alpha Rabbit Polyclonal Antibody |
|
ABP57567-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of HSP90?
- Applications tips:
|
|
Description: A polyclonal antibody for detection of HSP90Alpha from Human, Mouse, Rat. This HSP90Alpha antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP90? |
HSP90Alpha Rabbit Polyclonal Antibody |
|
ABP57567-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of HSP90?
- Applications tips:
|
|
Description: A polyclonal antibody for detection of HSP90Alpha from Human, Mouse, Rat. This HSP90Alpha antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP90? |
 JAK1 Rabbit Polyclonal Antibody |
|
ABP57569-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of JAK1
- Applications tips:
|
|
Description: A polyclonal antibody for detection of JAK1 from Human, Mouse, Rat. This JAK1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK1 |
JAK1 Rabbit Polyclonal Antibody |
|
ABP57569-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of JAK1
- Applications tips:
|
|
Description: A polyclonal antibody for detection of JAK1 from Human, Mouse, Rat. This JAK1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK1 |
JAK1 Rabbit Polyclonal Antibody |
|
ABP57569-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of JAK1
- Applications tips:
|
|
Description: A polyclonal antibody for detection of JAK1 from Human, Mouse, Rat. This JAK1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK1 |
 JAK2 Rabbit Polyclonal Antibody |
|
ABP57570-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of JAK2
- Applications tips:
|
|
Description: A polyclonal antibody for detection of JAK2 from Human, Mouse, Rat. This JAK2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK2 |
JAK2 Rabbit Polyclonal Antibody |
|
ABP57570-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of JAK2
- Applications tips:
|
|
Description: A polyclonal antibody for detection of JAK2 from Human, Mouse, Rat. This JAK2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK2 |
JAK2 Rabbit Polyclonal Antibody |
|
ABP57570-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of JAK2
- Applications tips:
|
|
Description: A polyclonal antibody for detection of JAK2 from Human, Mouse, Rat. This JAK2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK2 |
 JNK2 Rabbit Polyclonal Antibody |
|
ABP57571-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of JNK2
- Applications tips:
|
|
Description: A polyclonal antibody for detection of JNK2 from Human, Mouse, Rat. This JNK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK2 |
JNK2 Rabbit Polyclonal Antibody |
|
ABP57571-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of JNK2
- Applications tips:
|
|
Description: A polyclonal antibody for detection of JNK2 from Human, Mouse, Rat. This JNK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK2 |
JNK2 Rabbit Polyclonal Antibody |
|
ABP57571-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of JNK2
- Applications tips:
|
|
Description: A polyclonal antibody for detection of JNK2 from Human, Mouse, Rat. This JNK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK2 |
 JNK3 Rabbit Polyclonal Antibody |
|
ABP57572-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of JNK3
- Applications tips:
|
|
Description: A polyclonal antibody for detection of JNK3 from Human, Mouse, Rat. This JNK3 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK3 |
JNK3 Rabbit Polyclonal Antibody |
|
ABP57572-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of JNK3
- Applications tips:
|
|
Description: A polyclonal antibody for detection of JNK3 from Human, Mouse, Rat. This JNK3 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK3 |
JNK3 Rabbit Polyclonal Antibody |
|
ABP57572-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of JNK3
- Applications tips:
|
|
Description: A polyclonal antibody for detection of JNK3 from Human, Mouse, Rat. This JNK3 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK3 |
 MEK2 Rabbit Polyclonal Antibody |
|
ABP57573-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of MEK2
- Applications tips:
|
|
Description: A polyclonal antibody for detection of MEK2 from Human. This MEK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of MEK2 |
MEK2 Rabbit Polyclonal Antibody |
|
ABP57573-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of MEK2
- Applications tips:
|
|
Description: A polyclonal antibody for detection of MEK2 from Human. This MEK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of MEK2 |
MEK2 Rabbit Polyclonal Antibody |
|
ABP57573-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of MEK2
- Applications tips:
|
|
Description: A polyclonal antibody for detection of MEK2 from Human. This MEK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of MEK2 |
HCN3 Rabbit Polyclonal Antibody
 antibody)
