KCNE1 Rabbit Polyclonal Antibody

KCNE1 Polyclonal Antibody

ABP59014-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human KCNE1 protein at amino acid sequence of 40-120
  • Applications tips:
Description: A polyclonal antibody for detection of KCNE1 from Human, Mouse, Rat. This KCNE1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human KCNE1 protein at amino acid sequence of 40-120

KCNE1 Polyclonal Antibody

ABP59014-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human KCNE1 protein at amino acid sequence of 40-120
  • Applications tips:
Description: A polyclonal antibody for detection of KCNE1 from Human, Mouse, Rat. This KCNE1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human KCNE1 protein at amino acid sequence of 40-120

KCNE1 Rabbit pAb

A1176-100ul 100 ul
EUR 308

KCNE1 Rabbit pAb

A1176-200ul 200 ul
EUR 459

KCNE1 Rabbit pAb

A1176-20ul 20 ul
EUR 183

KCNE1 Rabbit pAb

A1176-50ul 50 ul
EUR 223

KCNE1 Rabbit pAb

A14009-100ul 100 ul
EUR 308

KCNE1 Rabbit pAb

A14009-200ul 200 ul
EUR 459

KCNE1 Rabbit pAb

A14009-20ul 20 ul
EUR 183

KCNE1 Rabbit pAb

A14009-50ul 50 ul
EUR 223

KCNE1 Antibody

ABD6310 100 ug
EUR 438

KCNE1 Antibody

32205-100ul 100ul
EUR 252

KCNE1 antibody

70R-18067 50 ul
EUR 435
Description: Rabbit polyclonal KCNE1 antibody

KCNE1 Antibody

DF6310 200ul
EUR 304
Description: KCNE1 Antibody detects endogenous levels of total KCNE1.

KCNE1 Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against KCNE1. Recognizes KCNE1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IF

KCNE1 Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against KCNE1. Recognizes KCNE1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:20-1:200, IF:1:50-1:200

KCNE1 Conjugated Antibody

C32205 100ul
EUR 397

anti- KCNE1 antibody

FNab04482 100µg
EUR 505.25
  • Immunogen: potassium voltage-gated channel, Isk-related family, member 1
  • Uniprot ID: P15382
  • Gene ID: 3753
  • Research Area: Neuroscience, Cardiovascular
Description: Antibody raised against KCNE1

Anti-KCNE1 antibody

PAab04482 100 ug
EUR 355

Anti-KCNE1 antibody

STJ24291 100 µl
EUR 277
Description: The product of this gene belongs to the potassium channel KCNE family. Potassium ion channels are essential to many cellular functions and show a high degree of diversity, varying in their electrophysiologic and pharmacologic properties. This gene encodes a transmembrane protein known to associate with the product of the KVLQT1 gene to form the delayed rectifier potassium channel. Mutation in this gene are associated with both Jervell and Lange-Nielsen and Romano-Ward forms of long-QT syndrome. Alternatively spliced transcript variants encoding the same protein have been identified.

Anti-KCNE1 antibody

STJ191183 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to KCNE1

Anti-KCNE1 antibody

STJ115944 100 µl
EUR 277
Description: The product of this gene belongs to the potassium channel KCNE family. Potassium ion channels are essential to many cellular functions and show a high degree of diversity, varying in their electrophysiologic and pharmacologic properties. This gene encodes a transmembrane protein known to associate with the product of the KVLQT1 gene to form the delayed rectifier potassium channel. Mutation in this gene are associated with both Jervell and Lange-Nielsen and Romano-Ward forms of long-QT syndrome. Alternatively spliced transcript variants encoding the same protein have been identified.

Kcne1/ Rat Kcne1 ELISA Kit

ELI-47884r 96 Tests
EUR 886


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


YF-PA12825 50 ug
EUR 363
Description: Mouse polyclonal to KCNE1


YF-PA12826 100 ul
EUR 403
Description: Rabbit polyclonal to KCNE1


YF-PA12827 100 ug
EUR 403
Description: Rabbit polyclonal to KCNE1


YF-PA24037 50 ul
EUR 334
Description: Mouse polyclonal to KCNE1

KCNE1 Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against KCNE1. Recognizes KCNE1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

KCNE1 Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against KCNE1. Recognizes KCNE1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

KCNE1 Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against KCNE1. Recognizes KCNE1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

KCNE1 cloning plasmid

CSB-CL012025HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 318
  • Sequence: atgatcctgtctaacaccacagcggtgacgccctttctgaccaagctgtggcaggagacagttcagcagggtggcaacatgtcgggcctggcccacaggtccccccgcagcggtgacggcaagctggaggccctctacgtcctcatggtactgggattcttcggcttcttcaccct
  • Show more
Description: A cloning plasmid for the KCNE1 gene.

KCNE1 Blocking Peptide

DF6310-BP 1mg
EUR 195

Anti-KCNE1 (2A6)

YF-MA13905 100 ug
EUR 363
Description: Mouse monoclonal to KCNE1

Anti-KCNE1 (5B12)

YF-MA10497 100 ug
EUR 363
Description: Mouse monoclonal to KCNE1

Rat KCNE1 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse Kcne1 ELISA KIT

ELI-15824m 96 Tests
EUR 865


ELI-28086h 96 Tests
EUR 824


EF010448 96 Tests
EUR 689

Mouse KCNE1 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human KCNE1 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

KCNE1 Recombinant Protein (Human)

RP016579 100 ug Ask for price

KCNE1 Recombinant Protein (Rat)

RP206747 100 ug Ask for price

KCNE1 Recombinant Protein (Mouse)

RP144986 100 ug Ask for price

Monoclonal KCNE1 Antibody (monoclonal) (M01), Clone: 5B12

AMM06086G 0.1mg
EUR 484
Description: A Monoclonal antibody against Human KCNE1 (monoclonal) (M01). The antibodies are raised in mouse and are from clone 5B12. This antibody is applicable in WB, E

Monoclonal KCNE1 Antibody (monoclonal) (M13), Clone: 2A6

AMM06087G 0.1mg
EUR 484
Description: A Monoclonal antibody against Human KCNE1 (monoclonal) (M13). The antibodies are raised in mouse and are from clone 2A6. This antibody is applicable in IP, E

KCNE1 ORF Vector (Human) (pORF)

ORF005527 1.0 ug DNA
EUR 95

Kcne1 ORF Vector (Rat) (pORF)

ORF068917 1.0 ug DNA
EUR 506

Kcne1 ORF Vector (Mouse) (pORF)

ORF048330 1.0 ug DNA
EUR 506

KCNE1 sgRNA CRISPR Lentivector set (Human)

K1118301 3 x 1.0 ug
EUR 339

Kcne1 sgRNA CRISPR Lentivector set (Mouse)

K3368901 3 x 1.0 ug
EUR 339

Kcne1 sgRNA CRISPR Lentivector set (Rat)

K6831501 3 x 1.0 ug
EUR 339

Rabbit Potassium voltage gated channel subfamily E member 1(KCNE1) ELISA kit

E04P0810-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Potassium voltage gated channel subfamily E member 1(KCNE1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Potassium voltage gated channel subfamily E member 1(KCNE1) ELISA kit

E04P0810-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Potassium voltage gated channel subfamily E member 1(KCNE1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Potassium voltage gated channel subfamily E member 1(KCNE1) ELISA kit

E04P0810-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Potassium voltage gated channel subfamily E member 1(KCNE1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

KCNE1 sgRNA CRISPR Lentivector (Human) (Target 1)

K1118302 1.0 ug DNA
EUR 154

KCNE1 sgRNA CRISPR Lentivector (Human) (Target 2)

K1118303 1.0 ug DNA
EUR 154

KCNE1 sgRNA CRISPR Lentivector (Human) (Target 3)

K1118304 1.0 ug DNA
EUR 154

Kcne1 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3368902 1.0 ug DNA
EUR 154

Kcne1 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3368903 1.0 ug DNA
EUR 154

Kcne1 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3368904 1.0 ug DNA
EUR 154

Kcne1 sgRNA CRISPR Lentivector (Rat) (Target 1)

K6831502 1.0 ug DNA
EUR 154

Kcne1 sgRNA CRISPR Lentivector (Rat) (Target 2)

K6831503 1.0 ug DNA
EUR 154

Kcne1 sgRNA CRISPR Lentivector (Rat) (Target 3)

K6831504 1.0 ug DNA
EUR 154

KCNE1 Protein Vector (Human) (pPB-C-His)

PV022105 500 ng
EUR 329

KCNE1 Protein Vector (Human) (pPB-N-His)

PV022106 500 ng
EUR 329

KCNE1 Protein Vector (Human) (pPM-C-HA)

PV022107 500 ng
EUR 329

KCNE1 Protein Vector (Human) (pPM-C-His)

PV022108 500 ng
EUR 329

KCNE1 Protein Vector (Rat) (pPB-C-His)

PV275666 500 ng
EUR 603

KCNE1 Protein Vector (Rat) (pPB-N-His)

PV275667 500 ng
EUR 603

KCNE1 Protein Vector (Rat) (pPM-C-HA)

PV275668 500 ng
EUR 603

KCNE1 Protein Vector (Rat) (pPM-C-His)

PV275669 500 ng
EUR 603

KCNE1 Protein Vector (Mouse) (pPB-C-His)

PV193318 500 ng
EUR 603

KCNE1 Protein Vector (Mouse) (pPB-N-His)

PV193319 500 ng
EUR 603

KCNE1 Protein Vector (Mouse) (pPM-C-HA)

PV193320 500 ng
EUR 603

KCNE1 Protein Vector (Mouse) (pPM-C-His)

PV193321 500 ng
EUR 603

Kcne1 3'UTR Luciferase Stable Cell Line

TU206554 1.0 ml Ask for price

Kcne1 3'UTR GFP Stable Cell Line

TU160409 1.0 ml Ask for price

KCNE1 3'UTR Luciferase Stable Cell Line

TU011476 1.0 ml
EUR 4617

Kcne1 3'UTR Luciferase Stable Cell Line

TU110409 1.0 ml Ask for price

KCNE1 3'UTR GFP Stable Cell Line

TU061476 1.0 ml
EUR 4617

Kcne1 3'UTR GFP Stable Cell Line

TU256554 1.0 ml Ask for price

Potassium Voltage-Gated Channel Subfamily E Member 1 (KCNE1) Antibody

  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Potassium Voltage-Gated Channel Subfamily E Member 1 (KCNE1) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Potassium Voltage-Gated Channel Subfamily E Member 1 (KCNE1) Antibody

abx234482-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

Potassium Voltage-Gated Channel Subfamily E Member 1 (KCNE1) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Potassium Voltage-Gated Channel Subfamily E Member 1 (KCNE1) Antibody

  • EUR 370.00
  • EUR 606.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 50 ul
  • Shipped within 5-10 working days.

KCNE1 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)

LV673873 1.0 ug DNA
EUR 514

KCNE1 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)

LV673877 1.0 ug DNA
EUR 514

KCNE1 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)

LV673878 1.0 ug DNA
EUR 514

VEGF Rabbit Polyclonal Antibody

ES8453-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

VEGF Rabbit Polyclonal Antibody

ES8453-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody

ES8454-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody

ES8454-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody

ES8455-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody

ES8455-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8456-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8456-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8457-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8457-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSC70 Rabbit Polyclonal Antibody

ES8558-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSC70 Rabbit Polyclonal Antibody

ES8558-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody

ES8559-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody

ES8559-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP90? Rabbit Polyclonal Antibody

ES8560-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSP90? Rabbit Polyclonal Antibody

ES8560-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

IkB ? Rabbit Polyclonal Antibody

ES8561-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

IkB ? Rabbit Polyclonal Antibody

ES8561-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JAK1 Rabbit Polyclonal Antibody

ES8562-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK1 Rabbit Polyclonal Antibody

ES8562-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK2 Rabbit Polyclonal Antibody

ES8563-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK2 Rabbit Polyclonal Antibody

ES8563-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JNK2 Rabbit Polyclonal Antibody

ES8564-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JNK2 Rabbit Polyclonal Antibody

ES8564-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JNK3 Rabbit Polyclonal Antibody

ES8565-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JNK3 Rabbit Polyclonal Antibody

ES8565-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

MEK2 Rabbit Polyclonal Antibody

ES8566-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC

MEK2 Rabbit Polyclonal Antibody

ES8566-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC

MEK3 Rabbit Polyclonal Antibody

ES8567-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

MEK3 Rabbit Polyclonal Antibody

ES8567-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Nrf2 Rabbit Polyclonal Antibody

ES8568-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Nrf2 Rabbit Polyclonal Antibody

ES8568-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4a Rabbit Polyclonal Antibody

ES8569-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4a Rabbit Polyclonal Antibody

ES8569-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4b Rabbit Polyclonal Antibody

ES8570-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4b Rabbit Polyclonal Antibody

ES8570-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4c Rabbit Polyclonal Antibody

ES8571-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4c Rabbit Polyclonal Antibody

ES8571-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG5 Rabbit Polyclonal Antibody

ES8572-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG5 Rabbit Polyclonal Antibody

ES8572-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG7 Rabbit Polyclonal Antibody

ES8573-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG7 Rabbit Polyclonal Antibody

ES8573-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG13 Rabbit Polyclonal Antibody

ES8574-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG13 Rabbit Polyclonal Antibody

ES8574-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG13 Rabbit Polyclonal Antibody

ES8575-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG13 Rabbit Polyclonal Antibody

ES8575-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG14L Rabbit Polyclonal Antibody

ES8576-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG14L Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG14L Rabbit Polyclonal Antibody

ES8576-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG14L Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NBR1 Rabbit Polyclonal Antibody

ES8578-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NBR1 Rabbit Polyclonal Antibody

ES8578-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NBR1 Rabbit Polyclonal Antibody

ES8579-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NBR1 Rabbit Polyclonal Antibody

ES8579-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

WIPI2 Rabbit Polyclonal Antibody

ES8580-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against WIPI2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

WIPI2 Rabbit Polyclonal Antibody

ES8580-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against WIPI2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Gab1 Rabbit Polyclonal Antibody

ES8582-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against Gab1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Gab1 Rabbit Polyclonal Antibody

ES8582-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against Gab1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ERK1 Rabbit Polyclonal Antibody

ES8583-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ERK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ERK1 Rabbit Polyclonal Antibody

ES8583-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ERK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Met Rabbit Polyclonal Antibody

ABP57458-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

Met Rabbit Polyclonal Antibody

ABP57458-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

Met Rabbit Polyclonal Antibody

ABP57458-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

VEGF Rabbit Polyclonal Antibody

ABP57460-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

KCNE1 Rabbit Polyclonal Antibody