 KCNE1 Polyclonal Antibody |
|
ABP59014-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from part region of human KCNE1 protein at amino acid sequence of 40-120
- Applications tips:
|
|
Description: A polyclonal antibody for detection of KCNE1 from Human, Mouse, Rat. This KCNE1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human KCNE1 protein at amino acid sequence of 40-120 |
KCNE1 Polyclonal Antibody |
|
ABP59014-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human KCNE1 protein at amino acid sequence of 40-120
- Applications tips:
|
|
Description: A polyclonal antibody for detection of KCNE1 from Human, Mouse, Rat. This KCNE1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human KCNE1 protein at amino acid sequence of 40-120 |
 KCNE1 Rabbit pAb |
|
A1176-100ul |
Abclonal |
100 ul |
EUR 308 |
KCNE1 Rabbit pAb |
|
A1176-200ul |
Abclonal |
200 ul |
EUR 459 |
KCNE1 Rabbit pAb |
|
A1176-20ul |
Abclonal |
20 ul |
EUR 183 |
KCNE1 Rabbit pAb |
|
A1176-50ul |
Abclonal |
50 ul |
EUR 223 |
KCNE1 Rabbit pAb |
|
A14009-100ul |
Abclonal |
100 ul |
EUR 308 |
KCNE1 Rabbit pAb |
|
A14009-200ul |
Abclonal |
200 ul |
EUR 459 |
KCNE1 Rabbit pAb |
|
A14009-20ul |
Abclonal |
20 ul |
EUR 183 |
KCNE1 Rabbit pAb |
|
A14009-50ul |
Abclonal |
50 ul |
EUR 223 |
 KCNE1 Antibody |
|
32205-100ul |
SAB |
100ul |
EUR 252 |
 KCNE1 antibody |
|
70R-18067 |
Fitzgerald |
50 ul |
EUR 435 |
|
Description: Rabbit polyclonal KCNE1 antibody |
 KCNE1 Antibody |
|
DF6310 |
Affbiotech |
200ul |
EUR 304 |
|
Description: KCNE1 Antibody detects endogenous levels of total KCNE1. |
KCNE1 Antibody |
|
1-CSB-PA012025GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
|
|
Description: A polyclonal antibody against KCNE1. Recognizes KCNE1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IF |
KCNE1 Antibody |
|
1-CSB-PA012025LA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
|
|
Description: A polyclonal antibody against KCNE1. Recognizes KCNE1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:20-1:200, IF:1:50-1:200 |
 KCNE1 Conjugated Antibody |
|
C32205 |
SAB |
100ul |
EUR 397 |
 anti- KCNE1 antibody |
|
FNab04482 |
FN Test |
100µg |
EUR 505.25 |
- Immunogen: potassium voltage-gated channel, Isk-related family, member 1
- Uniprot ID: P15382
- Gene ID: 3753
- Research Area: Neuroscience, Cardiovascular
|
|
Description: Antibody raised against KCNE1 |
 Anti-KCNE1 antibody |
|
STJ24291 |
St John's Laboratory |
100 µl |
EUR 277 |
|
Description: The product of this gene belongs to the potassium channel KCNE family. Potassium ion channels are essential to many cellular functions and show a high degree of diversity, varying in their electrophysiologic and pharmacologic properties. This gene encodes a transmembrane protein known to associate with the product of the KVLQT1 gene to form the delayed rectifier potassium channel. Mutation in this gene are associated with both Jervell and Lange-Nielsen and Romano-Ward forms of long-QT syndrome. Alternatively spliced transcript variants encoding the same protein have been identified. |
Anti-KCNE1 antibody |
|
STJ191183 |
St John's Laboratory |
200 µl |
EUR 197 |
|
Description: Unconjugated Rabbit polyclonal to KCNE1 |
Anti-KCNE1 antibody |
|
STJ115944 |
St John's Laboratory |
100 µl |
EUR 277 |
|
Description: The product of this gene belongs to the potassium channel KCNE family. Potassium ion channels are essential to many cellular functions and show a high degree of diversity, varying in their electrophysiologic and pharmacologic properties. This gene encodes a transmembrane protein known to associate with the product of the KVLQT1 gene to form the delayed rectifier potassium channel. Mutation in this gene are associated with both Jervell and Lange-Nielsen and Romano-Ward forms of long-QT syndrome. Alternatively spliced transcript variants encoding the same protein have been identified. |
 KCNE1 siRNA |
|
20-abx902780 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
KCNE1 siRNA |
|
20-abx921189 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
KCNE1 siRNA |
|
20-abx921190 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
 anti-KCNE1 |
|
YF-PA12825 |
Abfrontier |
50 ug |
EUR 363 |
|
Description: Mouse polyclonal to KCNE1 |
anti-KCNE1 |
|
YF-PA12826 |
Abfrontier |
100 ul |
EUR 403 |
|
Description: Rabbit polyclonal to KCNE1 |
anti-KCNE1 |
|
YF-PA12827 |
Abfrontier |
100 ug |
EUR 403 |
|
Description: Rabbit polyclonal to KCNE1 |
anti-KCNE1 |
|
YF-PA24037 |
Abfrontier |
50 ul |
EUR 334 |
|
Description: Mouse polyclonal to KCNE1 |
 KCNE1 Antibody, HRP conjugated |
|
1-CSB-PA012025LB01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
|
|
Description: A polyclonal antibody against KCNE1. Recognizes KCNE1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA |
 KCNE1 Antibody, FITC conjugated |
|
1-CSB-PA012025LC01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
|
|
Description: A polyclonal antibody against KCNE1. Recognizes KCNE1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA |
 KCNE1 Antibody, Biotin conjugated |
|
1-CSB-PA012025LD01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
|
|
Description: A polyclonal antibody against KCNE1. Recognizes KCNE1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA |
 KCNE1 cloning plasmid |
|
CSB-CL012025HU-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 318
- Sequence: atgatcctgtctaacaccacagcggtgacgccctttctgaccaagctgtggcaggagacagttcagcagggtggcaacatgtcgggcctggcccacaggtccccccgcagcggtgacggcaagctggaggccctctacgtcctcatggtactgggattcttcggcttcttcaccct
- Show more
|
|
Description: A cloning plasmid for the KCNE1 gene. |
 KCNE1 Blocking Peptide |
|
DF6310-BP |
Affbiotech |
1mg |
EUR 195 |
) Anti-KCNE1 (2A6) |
|
YF-MA13905 |
Abfrontier |
100 ug |
EUR 363 |
|
Description: Mouse monoclonal to KCNE1 |
) Anti-KCNE1 (5B12) |
|
YF-MA10497 |
Abfrontier |
100 ug |
EUR 363 |
|
Description: Mouse monoclonal to KCNE1 |
 Rat KCNE1 shRNA Plasmid |
|
20-abx985052 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
 Mouse KCNE1 shRNA Plasmid |
|
20-abx971144 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
 Human KCNE1 shRNA Plasmid |
|
20-abx952529 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
) KCNE1 Recombinant Protein (Human) |
|
RP016579 |
ABM |
100 ug |
Ask for price |
) KCNE1 Recombinant Protein (Rat) |
|
RP206747 |
ABM |
100 ug |
Ask for price |
) KCNE1 Recombinant Protein (Mouse) |
|
RP144986 |
ABM |
100 ug |
Ask for price |
 (M01), Clone: 5B12) Monoclonal KCNE1 Antibody (monoclonal) (M01), Clone: 5B12 |
|
AMM06086G |
Leading Biology |
0.1mg |
EUR 484 |
|
Description: A Monoclonal antibody against Human KCNE1 (monoclonal) (M01). The antibodies are raised in mouse and are from clone 5B12. This antibody is applicable in WB, E |
 (M13), Clone: 2A6) Monoclonal KCNE1 Antibody (monoclonal) (M13), Clone: 2A6 |
|
AMM06087G |
Leading Biology |
0.1mg |
EUR 484 |
|
Description: A Monoclonal antibody against Human KCNE1 (monoclonal) (M13). The antibodies are raised in mouse and are from clone 2A6. This antibody is applicable in IP, E |
 (pORF)) KCNE1 ORF Vector (Human) (pORF) |
|
ORF005527 |
ABM |
1.0 ug DNA |
EUR 95 |
 (pORF)) Kcne1 ORF Vector (Rat) (pORF) |
|
ORF068917 |
ABM |
1.0 ug DNA |
EUR 506 |
 (pORF)) Kcne1 ORF Vector (Mouse) (pORF) |
|
ORF048330 |
ABM |
1.0 ug DNA |
EUR 506 |
) KCNE1 sgRNA CRISPR Lentivector set (Human) |
|
K1118301 |
ABM |
3 x 1.0 ug |
EUR 339 |
) Kcne1 sgRNA CRISPR Lentivector set (Mouse) |
|
K3368901 |
ABM |
3 x 1.0 ug |
EUR 339 |
) Kcne1 sgRNA CRISPR Lentivector set (Rat) |
|
K6831501 |
ABM |
3 x 1.0 ug |
EUR 339 |
 ELISA kit) Rabbit Potassium voltage gated channel subfamily E member 1(KCNE1) ELISA kit |
|
E04P0810-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A sandwich ELISA for quantitative measurement of Rabbit Potassium voltage gated channel subfamily E member 1(KCNE1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit Potassium voltage gated channel subfamily E member 1(KCNE1) ELISA kit |
|
E04P0810-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A sandwich ELISA for quantitative measurement of Rabbit Potassium voltage gated channel subfamily E member 1(KCNE1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit Potassium voltage gated channel subfamily E member 1(KCNE1) ELISA kit |
|
E04P0810-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A sandwich ELISA for quantitative measurement of Rabbit Potassium voltage gated channel subfamily E member 1(KCNE1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
 (Target 1)) KCNE1 sgRNA CRISPR Lentivector (Human) (Target 1) |
|
K1118302 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 2)) KCNE1 sgRNA CRISPR Lentivector (Human) (Target 2) |
|
K1118303 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 3)) KCNE1 sgRNA CRISPR Lentivector (Human) (Target 3) |
|
K1118304 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 1)) Kcne1 sgRNA CRISPR Lentivector (Mouse) (Target 1) |
|
K3368902 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 2)) Kcne1 sgRNA CRISPR Lentivector (Mouse) (Target 2) |
|
K3368903 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 3)) Kcne1 sgRNA CRISPR Lentivector (Mouse) (Target 3) |
|
K3368904 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 1)) Kcne1 sgRNA CRISPR Lentivector (Rat) (Target 1) |
|
K6831502 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 2)) Kcne1 sgRNA CRISPR Lentivector (Rat) (Target 2) |
|
K6831503 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 3)) Kcne1 sgRNA CRISPR Lentivector (Rat) (Target 3) |
|
K6831504 |
ABM |
1.0 ug DNA |
EUR 154 |
 (pPB-C-His)) KCNE1 Protein Vector (Human) (pPB-C-His) |
|
PV022105 |
ABM |
500 ng |
EUR 329 |
 (pPB-N-His)) KCNE1 Protein Vector (Human) (pPB-N-His) |
|
PV022106 |
ABM |
500 ng |
EUR 329 |
 (pPM-C-HA)) KCNE1 Protein Vector (Human) (pPM-C-HA) |
|
PV022107 |
ABM |
500 ng |
EUR 329 |
 (pPM-C-His)) KCNE1 Protein Vector (Human) (pPM-C-His) |
|
PV022108 |
ABM |
500 ng |
EUR 329 |
 (pPB-C-His)) KCNE1 Protein Vector (Rat) (pPB-C-His) |
|
PV275666 |
ABM |
500 ng |
EUR 603 |
 (pPB-N-His)) KCNE1 Protein Vector (Rat) (pPB-N-His) |
|
PV275667 |
ABM |
500 ng |
EUR 603 |
 (pPM-C-HA)) KCNE1 Protein Vector (Rat) (pPM-C-HA) |
|
PV275668 |
ABM |
500 ng |
EUR 603 |
 (pPM-C-His)) KCNE1 Protein Vector (Rat) (pPM-C-His) |
|
PV275669 |
ABM |
500 ng |
EUR 603 |
 (pPB-C-His)) KCNE1 Protein Vector (Mouse) (pPB-C-His) |
|
PV193318 |
ABM |
500 ng |
EUR 603 |
 (pPB-N-His)) KCNE1 Protein Vector (Mouse) (pPB-N-His) |
|
PV193319 |
ABM |
500 ng |
EUR 603 |
 (pPM-C-HA)) KCNE1 Protein Vector (Mouse) (pPM-C-HA) |
|
PV193320 |
ABM |
500 ng |
EUR 603 |
 (pPM-C-His)) KCNE1 Protein Vector (Mouse) (pPM-C-His) |
|
PV193321 |
ABM |
500 ng |
EUR 603 |
 Kcne1 3'UTR Luciferase Stable Cell Line |
|
TU206554 |
ABM |
1.0 ml |
Ask for price |
 Kcne1 3'UTR GFP Stable Cell Line |
|
TU160409 |
ABM |
1.0 ml |
Ask for price |
 KCNE1 3'UTR Luciferase Stable Cell Line |
|
TU011476 |
ABM |
1.0 ml |
EUR 4617 |
Kcne1 3'UTR Luciferase Stable Cell Line |
|
TU110409 |
ABM |
1.0 ml |
Ask for price |
 KCNE1 3'UTR GFP Stable Cell Line |
|
TU061476 |
ABM |
1.0 ml |
EUR 4617 |
Kcne1 3'UTR GFP Stable Cell Line |
|
TU256554 |
ABM |
1.0 ml |
Ask for price |
 Antibody) Potassium Voltage-Gated Channel Subfamily E Member 1 (KCNE1) Antibody |
|
20-abx114637 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Potassium Voltage-Gated Channel Subfamily E Member 1 (KCNE1) Antibody |
|
20-abx001090 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
Potassium Voltage-Gated Channel Subfamily E Member 1 (KCNE1) Antibody |
|
abx234482-100ug |
Abbexa |
100 ug |
EUR 481 |
- Shipped within 5-12 working days.
|
Potassium Voltage-Gated Channel Subfamily E Member 1 (KCNE1) Antibody |
|
20-abx302181 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Potassium Voltage-Gated Channel Subfamily E Member 1 (KCNE1) Antibody |
|
20-abx225257 |
Abbexa |
-
EUR 370.00
-
EUR 606.00
-
EUR 314.00
|
|
- Shipped within 5-10 working days.
|
 (CMV) (pLenti-GIII-CMV)) KCNE1 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV) |
|
LV673873 |
ABM |
1.0 ug DNA |
EUR 514 |
 (UbC) (pLenti-GIII-UbC)) KCNE1 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC) |
|
LV673877 |
ABM |
1.0 ug DNA |
EUR 514 |
 (EF1a) (pLenti-GIII-EF1a)) KCNE1 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a) |
|
LV673878 |
ABM |
1.0 ug DNA |
EUR 514 |
 VEGF Rabbit Polyclonal Antibody |
|
ES8453-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
VEGF Rabbit Polyclonal Antibody |
|
ES8453-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 CD10 Rabbit Polyclonal Antibody |
|
ES8454-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
CD10 Rabbit Polyclonal Antibody |
|
ES8454-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 NM23A Rabbit Polyclonal Antibody |
|
ES8455-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NM23A Rabbit Polyclonal Antibody |
|
ES8455-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 ATM Rabbit Polyclonal Antibody |
|
ES8456-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
|
ES8456-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
|
ES8457-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
|
ES8457-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 HSC70 Rabbit Polyclonal Antibody |
|
ES8558-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSC70 Rabbit Polyclonal Antibody |
|
ES8558-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
 HSP40 Rabbit Polyclonal Antibody |
|
ES8559-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSP40 Rabbit Polyclonal Antibody |
|
ES8559-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
 HSP90? Rabbit Polyclonal Antibody |
|
ES8560-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
HSP90? Rabbit Polyclonal Antibody |
|
ES8560-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 IkB ? Rabbit Polyclonal Antibody |
|
ES8561-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
IkB ? Rabbit Polyclonal Antibody |
|
ES8561-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
 JAK1 Rabbit Polyclonal Antibody |
|
ES8562-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JAK1 Rabbit Polyclonal Antibody |
|
ES8562-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 JAK2 Rabbit Polyclonal Antibody |
|
ES8563-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JAK2 Rabbit Polyclonal Antibody |
|
ES8563-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 JNK2 Rabbit Polyclonal Antibody |
|
ES8564-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
JNK2 Rabbit Polyclonal Antibody |
|
ES8564-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
 JNK3 Rabbit Polyclonal Antibody |
|
ES8565-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JNK3 Rabbit Polyclonal Antibody |
|
ES8565-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 MEK2 Rabbit Polyclonal Antibody |
|
ES8566-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC |
MEK2 Rabbit Polyclonal Antibody |
|
ES8566-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC |
 MEK3 Rabbit Polyclonal Antibody |
|
ES8567-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
MEK3 Rabbit Polyclonal Antibody |
|
ES8567-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 Nrf2 Rabbit Polyclonal Antibody |
|
ES8568-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
Nrf2 Rabbit Polyclonal Antibody |
|
ES8568-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 ATG4a Rabbit Polyclonal Antibody |
|
ES8569-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4a Rabbit Polyclonal Antibody |
|
ES8569-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 ATG4b Rabbit Polyclonal Antibody |
|
ES8570-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4b Rabbit Polyclonal Antibody |
|
ES8570-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 ATG4c Rabbit Polyclonal Antibody |
|
ES8571-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4c Rabbit Polyclonal Antibody |
|
ES8571-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 ATG5 Rabbit Polyclonal Antibody |
|
ES8572-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG5 Rabbit Polyclonal Antibody |
|
ES8572-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 ATG7 Rabbit Polyclonal Antibody |
|
ES8573-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG7 Rabbit Polyclonal Antibody |
|
ES8573-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 ATG13 Rabbit Polyclonal Antibody |
|
ES8574-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG13 Rabbit Polyclonal Antibody |
|
ES8574-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG13 Rabbit Polyclonal Antibody |
|
ES8575-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG13 Rabbit Polyclonal Antibody |
|
ES8575-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 ATG14L Rabbit Polyclonal Antibody |
|
ES8576-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATG14L Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG14L Rabbit Polyclonal Antibody |
|
ES8576-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATG14L Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 NBR1 Rabbit Polyclonal Antibody |
|
ES8578-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NBR1 Rabbit Polyclonal Antibody |
|
ES8578-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NBR1 Rabbit Polyclonal Antibody |
|
ES8579-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NBR1 Rabbit Polyclonal Antibody |
|
ES8579-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 WIPI2 Rabbit Polyclonal Antibody |
|
ES8580-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against WIPI2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
WIPI2 Rabbit Polyclonal Antibody |
|
ES8580-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against WIPI2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 Gab1 Rabbit Polyclonal Antibody |
|
ES8582-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against Gab1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
Gab1 Rabbit Polyclonal Antibody |
|
ES8582-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against Gab1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 ERK1 Rabbit Polyclonal Antibody |
|
ES8583-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ERK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ERK1 Rabbit Polyclonal Antibody |
|
ES8583-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ERK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 Met Rabbit Polyclonal Antibody |
|
ABP57458-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
Met Rabbit Polyclonal Antibody |
|
ABP57458-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
Met Rabbit Polyclonal Antibody |
|
ABP57458-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
VEGF Rabbit Polyclonal Antibody |
|
ABP57460-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
KCNE1 Rabbit Polyclonal Antibody
