KCNQ1 Polyclonal Antibody |
ABP59023-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human KCNQ1 protein at amino acid sequence of 350-430
- Applications tips:
|
Description: A polyclonal antibody for detection of KCNQ1 from Human. This KCNQ1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human KCNQ1 protein at amino acid sequence of 350-430 |
KCNQ1 Polyclonal Antibody |
ES10032-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against KCNQ1 from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA |
KCNQ1 Polyclonal Antibody |
ES10032-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against KCNQ1 from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA |
KCNQ1 Rabbit pAb |
A2174-100ul |
Abclonal |
100 ul |
EUR 308 |
KCNQ1 Rabbit pAb |
A2174-200ul |
Abclonal |
200 ul |
EUR 459 |
KCNQ1 Rabbit pAb |
A2174-20ul |
Abclonal |
20 ul |
EUR 183 |
KCNQ1 Rabbit pAb |
A2174-50ul |
Abclonal |
50 ul |
EUR 223 |
Polyclonal KV7.1 (KCNQ1) Antibody |
AMM06230G |
Leading Biology |
0.05ml |
EUR 659 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human KV7.1 (KCNQ1) . This antibody is tested and proven to work in the following applications: |
KCNQ1 antibody |
70R-1537 |
Fitzgerald |
100 ug |
EUR 377 |
Description: Rabbit polyclonal KCNQ1 antibody raised against the N terminal of KCNQ1 |
KCNQ1 Antibody |
32641-100ul |
SAB |
100ul |
EUR 252 |
KCNQ1 Antibody |
1-CSB-PA942745 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
Description: A polyclonal antibody against KCNQ1. Recognizes KCNQ1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:2000, WB:1:200-1:1000, IHC:1:50-1:200 |
KCNQ1 Antibody |
DF6897 |
Affbiotech |
200ul |
EUR 304 |
Description: KCNQ1 Antibody detects endogenous levels of total KCNQ1. |
KCNQ1 Antibody |
DF7568 |
Affbiotech |
200ul |
EUR 304 |
Description: KCNQ1 Antibody detects endogenous levels of total KCNQ1. |
KCNQ1 Antibody |
1-CSB-PA237012 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
Description: A polyclonal antibody against KCNQ1. Recognizes KCNQ1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;ELISA:1:1000-1:2000, WB:1:200-1:1000 |
KCNQ1 antibody |
70R-5042 |
Fitzgerald |
50 ug |
EUR 467 |
Description: Rabbit polyclonal KCNQ1 antibody raised against the N terminal of KCNQ1 |
KCNQ1 Antibody |
CSB-PA012087KA01HU- |
Cusabio |
|
EUR 335 |
- Form: liquid
- Buffer: Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Affinity purification
|
Description: A polyclonal antibody against KCNQ1. Recognizes KCNQ1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:2000, IHC:1:50-1:200 |
KCNQ1 Antibody |
CSB-PA012087KA01HU-100ul |
Cusabio |
100ul |
EUR 389 |
- Form: liquid
- Buffer: Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Affinity purification
|
Description: A polyclonal antibody against KCNQ1. Recognizes KCNQ1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:2000, IHC:1:50-1:200 |
Polyclonal Goat Anti-KCNQ1 Antibody |
APR12124G |
Leading Biology |
0.1 mg |
EUR 484 |
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human Goat Anti-KCNQ1 . This antibody is tested and proven to work in the following applications: |
Anti-KCNQ1 Antibody |
A00310-1 |
BosterBio |
100ug/vial |
EUR 294 |
KCNQ1 Conjugated Antibody |
C32641 |
SAB |
100ul |
EUR 397 |
Anti-KCNQ1 antibody |
STJ24299 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: This gene encodes a voltage-gated potassium channel required for repolarization phase of the cardiac action potential. This protein can form heteromultimers with two other potassium channel proteins, KCNE1 and KCNE3. Mutations in this gene are associated with hereditary long QT syndrome 1 (also known as Romano-Ward syndrome), Jervell and Lange-Nielsen syndrome, and familial atrial fibrillation. This gene exhibits tissue-specific imprinting, with preferential expression from the maternal allele in some tissues, and biallelic expression in others. This gene is located in a region of chromosome 11 amongst other imprinted genes that are associated with Beckwith-Wiedemann syndrome (BWS), and itself has been shown to be disrupted by chromosomal rearrangements in patients with BWS. Alternatively spliced transcript variants have been found for this gene. |
Anti-KCNQ1 antibody |
STJ191190 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to KCNQ1 |
KCNQ1 siRNA |
20-abx902818 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
KCNQ1 siRNA |
20-abx921304 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
KCNQ1 siRNA |
20-abx921305 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Monoclonal antibody for KCNQ1 |
SMC-307D |
Stressmarq |
0.1mg |
EUR 353 |
- Kv7.1 (KvLQT1) is a potassium channel protein coded for by the gene KCNQ1. Kv7.1 is present in the cell membranes of cardiac muscle tissue and in inner ear neurons (1) among other tissues. In the cardiac cells, Kv7.1 mediates the IKs (or slow delayed
- Show more
|
Description: A monoclonal antibody from clone S37A-10 against Human | Rat KCNQ1. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Fusion protein amino acids 2-101 of human KCNQ1. The antibody is tested and validated for WB, IHC, ICC/IF, IP, AM assays with the following recommended dilutions: WB (1:1000), IHC (1:1000), ICC/IF (1:100). This MAb for KCNQ1 is not conjugated. |
Monoclonal antibody for KCNQ1 |
SMC-307D-A390 |
Stressmarq |
0.1mg |
EUR 400 |
- Kv7.1 (KvLQT1) is a potassium channel protein coded for by the gene KCNQ1. Kv7.1 is present in the cell membranes of cardiac muscle tissue and in inner ear neurons (1) among other tissues. In the cardiac cells, Kv7.1 mediates the IKs (or slow delayed
- Show more
|
Description: A monoclonal antibody from clone S37A-10 against Human | Rat KCNQ1. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Fusion protein amino acids 2-101 of human KCNQ1. The antibody is tested and validated for WB, IHC, ICC/IF, IP, AM assays with the following recommended dilutions: WB (1:1000), IHC (1:1000), ICC/IF (1:100). This MAb for KCNQ1 is conjugated with ATTO 390. |
Monoclonal antibody for KCNQ1 |
SMC-307D-A488 |
Stressmarq |
0.1mg |
EUR 399 |
- Kv7.1 (KvLQT1) is a potassium channel protein coded for by the gene KCNQ1. Kv7.1 is present in the cell membranes of cardiac muscle tissue and in inner ear neurons (1) among other tissues. In the cardiac cells, Kv7.1 mediates the IKs (or slow delayed
- Show more
|
Description: A monoclonal antibody from clone S37A-10 against Human | Rat KCNQ1. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Fusion protein amino acids 2-101 of human KCNQ1. The antibody is tested and validated for WB, IHC, ICC/IF, IP, AM assays with the following recommended dilutions: WB (1:1000), IHC (1:1000), ICC/IF (1:100). This MAb for KCNQ1 is conjugated with ATTO 488. |
Monoclonal antibody for KCNQ1 |
SMC-307D-A565 |
Stressmarq |
0.1mg |
EUR 399 |
- Kv7.1 (KvLQT1) is a potassium channel protein coded for by the gene KCNQ1. Kv7.1 is present in the cell membranes of cardiac muscle tissue and in inner ear neurons (1) among other tissues. In the cardiac cells, Kv7.1 mediates the IKs (or slow delayed
- Show more
|
Description: A monoclonal antibody from clone S37A-10 against Human | Rat KCNQ1. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Fusion protein amino acids 2-101 of human KCNQ1. The antibody is tested and validated for WB, IHC, ICC/IF, IP, AM assays with the following recommended dilutions: WB (1:1000), IHC (1:1000), ICC/IF (1:100). This MAb for KCNQ1 is conjugated with ATTO 565. |
Monoclonal antibody for KCNQ1 |
SMC-307D-A594 |
Stressmarq |
0.1mg |
EUR 399 |
- Kv7.1 (KvLQT1) is a potassium channel protein coded for by the gene KCNQ1. Kv7.1 is present in the cell membranes of cardiac muscle tissue and in inner ear neurons (1) among other tissues. In the cardiac cells, Kv7.1 mediates the IKs (or slow delayed
- Show more
|
Description: A monoclonal antibody from clone S37A-10 against Human | Rat KCNQ1. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Fusion protein amino acids 2-101 of human KCNQ1. The antibody is tested and validated for WB, IHC, ICC/IF, IP, AM assays with the following recommended dilutions: WB (1:1000), IHC (1:1000), ICC/IF (1:100). This MAb for KCNQ1 is conjugated with ATTO 594. |
Monoclonal antibody for KCNQ1 |
SMC-307D-A633 |
Stressmarq |
0.1mg |
EUR 399 |
- Kv7.1 (KvLQT1) is a potassium channel protein coded for by the gene KCNQ1. Kv7.1 is present in the cell membranes of cardiac muscle tissue and in inner ear neurons (1) among other tissues. In the cardiac cells, Kv7.1 mediates the IKs (or slow delayed
- Show more
|
Description: A monoclonal antibody from clone S37A-10 against Human | Rat KCNQ1. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Fusion protein amino acids 2-101 of human KCNQ1. The antibody is tested and validated for WB, IHC, ICC/IF, IP, AM assays with the following recommended dilutions: WB (1:1000), IHC (1:1000), ICC/IF (1:100). This MAb for KCNQ1 is conjugated with ATTO 633. |
Monoclonal antibody for KCNQ1 |
SMC-307D-A655 |
Stressmarq |
0.1mg |
EUR 399 |
- Kv7.1 (KvLQT1) is a potassium channel protein coded for by the gene KCNQ1. Kv7.1 is present in the cell membranes of cardiac muscle tissue and in inner ear neurons (1) among other tissues. In the cardiac cells, Kv7.1 mediates the IKs (or slow delayed
- Show more
|
Description: A monoclonal antibody from clone S37A-10 against Human | Rat KCNQ1. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Fusion protein amino acids 2-101 of human KCNQ1. The antibody is tested and validated for WB, IHC, ICC/IF, IP, AM assays with the following recommended dilutions: WB (1:1000), IHC (1:1000), ICC/IF (1:100). This MAb for KCNQ1 is conjugated with ATTO 655. |
Monoclonal antibody for KCNQ1 |
SMC-307D-A680 |
Stressmarq |
0.1mg |
EUR 399 |
- Kv7.1 (KvLQT1) is a potassium channel protein coded for by the gene KCNQ1. Kv7.1 is present in the cell membranes of cardiac muscle tissue and in inner ear neurons (1) among other tissues. In the cardiac cells, Kv7.1 mediates the IKs (or slow delayed
- Show more
|
Description: A monoclonal antibody from clone S37A-10 against Human | Rat KCNQ1. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Fusion protein amino acids 2-101 of human KCNQ1. The antibody is tested and validated for WB, IHC, ICC/IF, IP, AM assays with the following recommended dilutions: WB (1:1000), IHC (1:1000), ICC/IF (1:100). This MAb for KCNQ1 is conjugated with ATTO 680. |
Monoclonal antibody for KCNQ1 |
SMC-307D-A700 |
Stressmarq |
0.1mg |
EUR 399 |
- Kv7.1 (KvLQT1) is a potassium channel protein coded for by the gene KCNQ1. Kv7.1 is present in the cell membranes of cardiac muscle tissue and in inner ear neurons (1) among other tissues. In the cardiac cells, Kv7.1 mediates the IKs (or slow delayed
- Show more
|
Description: A monoclonal antibody from clone S37A-10 against Human | Rat KCNQ1. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Fusion protein amino acids 2-101 of human KCNQ1. The antibody is tested and validated for WB, IHC, ICC/IF, IP, AM assays with the following recommended dilutions: WB (1:1000), IHC (1:1000), ICC/IF (1:100). This MAb for KCNQ1 is conjugated with ATTO 700. |
Monoclonal antibody for KCNQ1 |
SMC-307D-ALP |
Stressmarq |
0.1mg |
EUR 393 |
- Kv7.1 (KvLQT1) is a potassium channel protein coded for by the gene KCNQ1. Kv7.1 is present in the cell membranes of cardiac muscle tissue and in inner ear neurons (1) among other tissues. In the cardiac cells, Kv7.1 mediates the IKs (or slow delayed
- Show more
|
Description: A monoclonal antibody from clone S37A-10 against Human | Rat KCNQ1. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Fusion protein amino acids 2-101 of human KCNQ1. The antibody is tested and validated for WB, IHC, ICC/IF, IP, AM assays with the following recommended dilutions: WB (1:1000), IHC (1:1000), ICC/IF (1:100). This MAb for KCNQ1 is conjugated with Alkaline Phosphatase. |
Monoclonal antibody for KCNQ1 |
SMC-307D-APC |
Stressmarq |
0.1mg |
EUR 398 |
- Kv7.1 (KvLQT1) is a potassium channel protein coded for by the gene KCNQ1. Kv7.1 is present in the cell membranes of cardiac muscle tissue and in inner ear neurons (1) among other tissues. In the cardiac cells, Kv7.1 mediates the IKs (or slow delayed
- Show more
|
Description: A monoclonal antibody from clone S37A-10 against Human | Rat KCNQ1. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Fusion protein amino acids 2-101 of human KCNQ1. The antibody is tested and validated for WB, IHC, ICC/IF, IP, AM assays with the following recommended dilutions: WB (1:1000), IHC (1:1000), ICC/IF (1:100). This MAb for KCNQ1 is conjugated with APC. |
Monoclonal antibody for KCNQ1 |
SMC-307D-APCCY7 |
Stressmarq |
0.1mg |
EUR 470 |
- Kv7.1 (KvLQT1) is a potassium channel protein coded for by the gene KCNQ1. Kv7.1 is present in the cell membranes of cardiac muscle tissue and in inner ear neurons (1) among other tissues. In the cardiac cells, Kv7.1 mediates the IKs (or slow delayed
- Show more
|
Description: A monoclonal antibody from clone S37A-10 against Human | Rat KCNQ1. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Fusion protein amino acids 2-101 of human KCNQ1. The antibody is tested and validated for WB, IHC, ICC/IF, IP, AM assays with the following recommended dilutions: WB (1:1000), IHC (1:1000), ICC/IF (1:100). This MAb for KCNQ1 is conjugated with APC/Cy7. |
Monoclonal antibody for KCNQ1 |
SMC-307D-BI |
Stressmarq |
0.1mg |
EUR 395 |
- Kv7.1 (KvLQT1) is a potassium channel protein coded for by the gene KCNQ1. Kv7.1 is present in the cell membranes of cardiac muscle tissue and in inner ear neurons (1) among other tissues. In the cardiac cells, Kv7.1 mediates the IKs (or slow delayed
- Show more
|
Description: A monoclonal antibody from clone S37A-10 against Human | Rat KCNQ1. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Fusion protein amino acids 2-101 of human KCNQ1. The antibody is tested and validated for WB, IHC, ICC/IF, IP, AM assays with the following recommended dilutions: WB (1:1000), IHC (1:1000), ICC/IF (1:100). This MAb for KCNQ1 is conjugated with Biotin. |
Monoclonal antibody for KCNQ1 |
SMC-307D-DY350 |
Stressmarq |
0.1mg |
EUR 413 |
- Kv7.1 (KvLQT1) is a potassium channel protein coded for by the gene KCNQ1. Kv7.1 is present in the cell membranes of cardiac muscle tissue and in inner ear neurons (1) among other tissues. In the cardiac cells, Kv7.1 mediates the IKs (or slow delayed
- Show more
|
Description: A monoclonal antibody from clone S37A-10 against Human | Rat KCNQ1. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Fusion protein amino acids 2-101 of human KCNQ1. The antibody is tested and validated for WB, IHC, ICC/IF, IP, AM assays with the following recommended dilutions: WB (1:1000), IHC (1:1000), ICC/IF (1:100). This MAb for KCNQ1 is conjugated with Dylight 350. |
Monoclonal antibody for KCNQ1 |
SMC-307D-DY405 |
Stressmarq |
0.1mg |
EUR 402 |
- Kv7.1 (KvLQT1) is a potassium channel protein coded for by the gene KCNQ1. Kv7.1 is present in the cell membranes of cardiac muscle tissue and in inner ear neurons (1) among other tissues. In the cardiac cells, Kv7.1 mediates the IKs (or slow delayed
- Show more
|
Description: A monoclonal antibody from clone S37A-10 against Human | Rat KCNQ1. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Fusion protein amino acids 2-101 of human KCNQ1. The antibody is tested and validated for WB, IHC, ICC/IF, IP, AM assays with the following recommended dilutions: WB (1:1000), IHC (1:1000), ICC/IF (1:100). This MAb for KCNQ1 is conjugated with Dylight 405. |
Monoclonal antibody for KCNQ1 |
SMC-307D-DY488 |
Stressmarq |
0.1mg |
EUR 392 |
- Kv7.1 (KvLQT1) is a potassium channel protein coded for by the gene KCNQ1. Kv7.1 is present in the cell membranes of cardiac muscle tissue and in inner ear neurons (1) among other tissues. In the cardiac cells, Kv7.1 mediates the IKs (or slow delayed
- Show more
|
Description: A monoclonal antibody from clone S37A-10 against Human | Rat KCNQ1. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Fusion protein amino acids 2-101 of human KCNQ1. The antibody is tested and validated for WB, IHC, ICC/IF, IP, AM assays with the following recommended dilutions: WB (1:1000), IHC (1:1000), ICC/IF (1:100). This MAb for KCNQ1 is conjugated with Dylight 488. |
Monoclonal antibody for KCNQ1 |
SMC-307D-DY594 |
Stressmarq |
0.1mg |
EUR 394 |
- Kv7.1 (KvLQT1) is a potassium channel protein coded for by the gene KCNQ1. Kv7.1 is present in the cell membranes of cardiac muscle tissue and in inner ear neurons (1) among other tissues. In the cardiac cells, Kv7.1 mediates the IKs (or slow delayed
- Show more
|
Description: A monoclonal antibody from clone S37A-10 against Human | Rat KCNQ1. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Fusion protein amino acids 2-101 of human KCNQ1. The antibody is tested and validated for WB, IHC, ICC/IF, IP, AM assays with the following recommended dilutions: WB (1:1000), IHC (1:1000), ICC/IF (1:100). This MAb for KCNQ1 is conjugated with Dylight 594. |
Monoclonal antibody for KCNQ1 |
SMC-307D-DY633 |
Stressmarq |
0.1mg |
EUR 389 |
- Kv7.1 (KvLQT1) is a potassium channel protein coded for by the gene KCNQ1. Kv7.1 is present in the cell membranes of cardiac muscle tissue and in inner ear neurons (1) among other tissues. In the cardiac cells, Kv7.1 mediates the IKs (or slow delayed
- Show more
|
Description: A monoclonal antibody from clone S37A-10 against Human | Rat KCNQ1. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Fusion protein amino acids 2-101 of human KCNQ1. The antibody is tested and validated for WB, IHC, ICC/IF, IP, AM assays with the following recommended dilutions: WB (1:1000), IHC (1:1000), ICC/IF (1:100). This MAb for KCNQ1 is conjugated with Dylight 633. |
Monoclonal antibody for KCNQ1 |
SMC-307D-FITC |
Stressmarq |
0.1mg |
EUR 391 |
- Kv7.1 (KvLQT1) is a potassium channel protein coded for by the gene KCNQ1. Kv7.1 is present in the cell membranes of cardiac muscle tissue and in inner ear neurons (1) among other tissues. In the cardiac cells, Kv7.1 mediates the IKs (or slow delayed
- Show more
|
Description: A monoclonal antibody from clone S37A-10 against Human | Rat KCNQ1. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Fusion protein amino acids 2-101 of human KCNQ1. The antibody is tested and validated for WB, IHC, ICC/IF, IP, AM assays with the following recommended dilutions: WB (1:1000), IHC (1:1000), ICC/IF (1:100). This MAb for KCNQ1 is conjugated with FITC. |
Monoclonal antibody for KCNQ1 |
SMC-307D-HRP |
Stressmarq |
0.1mg |
EUR 387 |
- Kv7.1 (KvLQT1) is a potassium channel protein coded for by the gene KCNQ1. Kv7.1 is present in the cell membranes of cardiac muscle tissue and in inner ear neurons (1) among other tissues. In the cardiac cells, Kv7.1 mediates the IKs (or slow delayed
- Show more
|
Description: A monoclonal antibody from clone S37A-10 against Human | Rat KCNQ1. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Fusion protein amino acids 2-101 of human KCNQ1. The antibody is tested and validated for WB, IHC, ICC/IF, IP, AM assays with the following recommended dilutions: WB (1:1000), IHC (1:1000), ICC/IF (1:100). This MAb for KCNQ1 is conjugated with HRP. |
Monoclonal antibody for KCNQ1 |
SMC-307D-P594 |
Stressmarq |
0.1mg |
EUR 406 |
- Kv7.1 (KvLQT1) is a potassium channel protein coded for by the gene KCNQ1. Kv7.1 is present in the cell membranes of cardiac muscle tissue and in inner ear neurons (1) among other tissues. In the cardiac cells, Kv7.1 mediates the IKs (or slow delayed
- Show more
|
Description: A monoclonal antibody from clone S37A-10 against Human | Rat KCNQ1. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Fusion protein amino acids 2-101 of human KCNQ1. The antibody is tested and validated for WB, IHC, ICC/IF, IP, AM assays with the following recommended dilutions: WB (1:1000), IHC (1:1000), ICC/IF (1:100). This MAb for KCNQ1 is conjugated with PE/ATTO 594. |
Monoclonal antibody for KCNQ1 |
SMC-307D-PCP |
Stressmarq |
0.1mg |
EUR 398 |
- Kv7.1 (KvLQT1) is a potassium channel protein coded for by the gene KCNQ1. Kv7.1 is present in the cell membranes of cardiac muscle tissue and in inner ear neurons (1) among other tissues. In the cardiac cells, Kv7.1 mediates the IKs (or slow delayed
- Show more
|
Description: A monoclonal antibody from clone S37A-10 against Human | Rat KCNQ1. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Fusion protein amino acids 2-101 of human KCNQ1. The antibody is tested and validated for WB, IHC, ICC/IF, IP, AM assays with the following recommended dilutions: WB (1:1000), IHC (1:1000), ICC/IF (1:100). This MAb for KCNQ1 is conjugated with PerCP. |
Monoclonal antibody for KCNQ1 |
SMC-307D-RPE |
Stressmarq |
0.1mg |
EUR 396 |
- Kv7.1 (KvLQT1) is a potassium channel protein coded for by the gene KCNQ1. Kv7.1 is present in the cell membranes of cardiac muscle tissue and in inner ear neurons (1) among other tissues. In the cardiac cells, Kv7.1 mediates the IKs (or slow delayed
- Show more
|
Description: A monoclonal antibody from clone S37A-10 against Human | Rat KCNQ1. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Fusion protein amino acids 2-101 of human KCNQ1. The antibody is tested and validated for WB, IHC, ICC/IF, IP, AM assays with the following recommended dilutions: WB (1:1000), IHC (1:1000), ICC/IF (1:100). This MAb for KCNQ1 is conjugated with RPE. |
Monoclonal antibody for KCNQ1 |
SMC-307D-STR |
Stressmarq |
0.1mg |
EUR 397 |
- Kv7.1 (KvLQT1) is a potassium channel protein coded for by the gene KCNQ1. Kv7.1 is present in the cell membranes of cardiac muscle tissue and in inner ear neurons (1) among other tissues. In the cardiac cells, Kv7.1 mediates the IKs (or slow delayed
- Show more
|
Description: A monoclonal antibody from clone S37A-10 against Human | Rat KCNQ1. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Fusion protein amino acids 2-101 of human KCNQ1. The antibody is tested and validated for WB, IHC, ICC/IF, IP, AM assays with the following recommended dilutions: WB (1:1000), IHC (1:1000), ICC/IF (1:100). This MAb for KCNQ1 is conjugated with Streptavidin. |
Monoclonal antibody for KCNQ1 |
SMC-307S |
Stressmarq |
0.012mg |
EUR 65 |
- Kv7.1 (KvLQT1) is a potassium channel protein coded for by the gene KCNQ1. Kv7.1 is present in the cell membranes of cardiac muscle tissue and in inner ear neurons (1) among other tissues. In the cardiac cells, Kv7.1 mediates the IKs (or slow delayed
- Show more
|
Description: A monoclonal antibody from clone S37A-10 against Human | Rat KCNQ1. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Fusion protein amino acids 2-101 of human KCNQ1. The antibody is tested and validated for WB, IHC, ICC/IF, IP, AM assays with the following recommended dilutions: WB (1:1000), IHC (1:1000), ICC/IF (1:100). This MAb for KCNQ1 is not conjugated. |
KCNQ1 Blocking Peptide |
33R-4211 |
Fitzgerald |
100 ug |
EUR 180 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of KCNQ1 antibody, catalog no. 70R-1537 |
KCNQ1 Blocking Peptide |
33R-8193 |
Fitzgerald |
100 ug |
EUR 180 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of KCNQ1 antibody, catalog no. 70R-5042 |
KCNQ1 Blocking Peptide |
DF6897-BP |
Affbiotech |
1mg |
EUR 195 |
KCNQ1 Blocking Peptide |
DF7568-BP |
Affbiotech |
1mg |
EUR 195 |
KCNQ1 cloning plasmid |
CSB-CL012087HU-10ug |
Cusabio |
10ug |
EUR 572 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1650
- Sequence: atggacttcctcatcgtcctggtctgcctcatcttcagcgtgctgtccaccatcgagcagtatgccgccctggccacggggactctcttctggatggagatcgtgctggtggtgttcttcgggacggagtacgtggtccgcctctggtccgccggctgccgcagcaagtacgtgg
- Show more
|
Description: A cloning plasmid for the KCNQ1 gene. |
anti-KCNQ1 (5E12) |
LF-MA30660 |
Abfrontier |
100 ul |
EUR 527 |
Description: Mouse Monoclonal to KCNQ1 |
Monoclonal KCNQ1 Antibody, Clone: 5E12 |
APR16986G |
Leading Biology |
0.1ml |
EUR 528 |
Description: A Monoclonal antibody against Human KCNQ1. The antibodies are raised in Mouse and are from clone 5E12. This antibody is applicable in WB, FC, E |
KCNQ1 Downstream Neighbor Protein (KCNQ1DN) Antibody |
abx234500-100ug |
Abbexa |
100 ug |
EUR 551 |
- Shipped within 5-12 working days.
|
Rat KCNQ1 shRNA Plasmid |
20-abx986895 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Human KCNQ1 shRNA Plasmid |
20-abx952558 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Mouse KCNQ1 shRNA Plasmid |
20-abx971167 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Kv7.1/KCNQ1 K+ channel |
MO50022 |
Neuromics |
100 ul |
EUR 579 |
KCNQ1 Recombinant Protein (Human) |
RP040264 |
ABM |
100 ug |
Ask for price |
KCNQ1 Recombinant Protein (Rat) |
RP206939 |
ABM |
100 ug |
Ask for price |
KCNQ1 Recombinant Protein (Mouse) |
RP145316 |
ABM |
100 ug |
Ask for price |
Kcnq1 ORF Vector (Rat) (pORF) |
ORF068981 |
ABM |
1.0 ug DNA |
EUR 506 |
KCNQ1 ORF Vector (Human) (pORF) |
ORF013422 |
ABM |
1.0 ug DNA |
EUR 354 |
Kcnq1 ORF Vector (Mouse) (pORF) |
ORF048440 |
ABM |
1.0 ug DNA |
EUR 506 |
Kcnq1 sgRNA CRISPR Lentivector set (Rat) |
K7015801 |
ABM |
3 x 1.0 ug |
EUR 339 |
Kcnq1 sgRNA CRISPR Lentivector set (Mouse) |
K3951901 |
ABM |
3 x 1.0 ug |
EUR 339 |
KCNQ1 sgRNA CRISPR Lentivector set (Human) |
K1124501 |
ABM |
3 x 1.0 ug |
EUR 339 |
KCNQ1-AS1 ORF Vector (Human) (pORF) |
ORF022146 |
ABM |
1.0 ug DNA |
Ask for price |
Rabbit Potassium voltage gated channel subfamily KQT member 1(KCNQ1) ELISA kit |
E04P0812-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rabbit Potassium voltage gated channel subfamily KQT member 1(KCNQ1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit Potassium voltage gated channel subfamily KQT member 1(KCNQ1) ELISA kit |
E04P0812-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rabbit Potassium voltage gated channel subfamily KQT member 1(KCNQ1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit Potassium voltage gated channel subfamily KQT member 1(KCNQ1) ELISA kit |
E04P0812-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rabbit Potassium voltage gated channel subfamily KQT member 1(KCNQ1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Kcnq1 sgRNA CRISPR Lentivector (Rat) (Target 1) |
K7015802 |
ABM |
1.0 ug DNA |
EUR 154 |
Kcnq1 sgRNA CRISPR Lentivector (Rat) (Target 2) |
K7015803 |
ABM |
1.0 ug DNA |
EUR 154 |
Kcnq1 sgRNA CRISPR Lentivector (Rat) (Target 3) |
K7015804 |
ABM |
1.0 ug DNA |
EUR 154 |
Kcnq1 sgRNA CRISPR Lentivector (Mouse) (Target 1) |
K3951902 |
ABM |
1.0 ug DNA |
EUR 154 |
Kcnq1 sgRNA CRISPR Lentivector (Mouse) (Target 2) |
K3951903 |
ABM |
1.0 ug DNA |
EUR 154 |
Kcnq1 sgRNA CRISPR Lentivector (Mouse) (Target 3) |
K3951904 |
ABM |
1.0 ug DNA |
EUR 154 |
KCNQ1 sgRNA CRISPR Lentivector (Human) (Target 1) |
K1124502 |
ABM |
1.0 ug DNA |
EUR 154 |
KCNQ1 sgRNA CRISPR Lentivector (Human) (Target 2) |
K1124503 |
ABM |
1.0 ug DNA |
EUR 154 |
KCNQ1 sgRNA CRISPR Lentivector (Human) (Target 3) |
K1124504 |
ABM |
1.0 ug DNA |
EUR 154 |
KCNQ1 Protein Vector (Rat) (pPB-C-His) |
PV275922 |
ABM |
500 ng |
EUR 1166 |
KCNQ1 Protein Vector (Rat) (pPB-N-His) |
PV275923 |
ABM |
500 ng |
EUR 1166 |
KCNQ1 Protein Vector (Rat) (pPM-C-HA) |
PV275924 |
ABM |
500 ng |
EUR 1166 |
KCNQ1 Protein Vector (Rat) (pPM-C-His) |
PV275925 |
ABM |
500 ng |
EUR 1166 |
KCNQ1 Protein Vector (Mouse) (pPB-C-His) |
PV193758 |
ABM |
500 ng |
EUR 1065 |
KCNQ1 Protein Vector (Mouse) (pPB-N-His) |
PV193759 |
ABM |
500 ng |
EUR 1065 |
KCNQ1 Protein Vector (Mouse) (pPM-C-HA) |
PV193760 |
ABM |
500 ng |
EUR 1065 |
KCNQ1 Protein Vector (Mouse) (pPM-C-His) |
PV193761 |
ABM |
500 ng |
EUR 1065 |
KCNQ1 Protein Vector (Human) (pPB-C-His) |
PV053685 |
ABM |
500 ng |
EUR 481 |
KCNQ1 Protein Vector (Human) (pPB-N-His) |
PV053686 |
ABM |
500 ng |
EUR 481 |
KCNQ1 Protein Vector (Human) (pPM-C-HA) |
PV053687 |
ABM |
500 ng |
EUR 481 |
KCNQ1 Protein Vector (Human) (pPM-C-His) |
PV053688 |
ABM |
500 ng |
EUR 481 |
Kcnq1 3'UTR Luciferase Stable Cell Line |
TU110468 |
ABM |
1.0 ml |
Ask for price |
Kcnq1 3'UTR GFP Stable Cell Line |
TU160468 |
ABM |
1.0 ml |
Ask for price |
Kcnq1 3'UTR Luciferase Stable Cell Line |
TU206613 |
ABM |
1.0 ml |
Ask for price |
Kcnq1 3'UTR GFP Stable Cell Line |
TU256613 |
ABM |
1.0 ml |
Ask for price |
KCNQ1 3'UTR GFP Stable Cell Line |
TU061538 |
ABM |
1.0 ml |
EUR 1394 |
KCNQ1 3'UTR Luciferase Stable Cell Line |
TU011538 |
ABM |
1.0 ml |
EUR 1394 |
Potassium Voltage-Gated Channel Subfamily Q Member 1 (KCNQ1) Antibody |
abx026614-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
Potassium Voltage-Gated Channel Subfamily Q Member 1 (KCNQ1) Antibody |
abx026614-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
Potassium Voltage-Gated Channel Subfamily Q Member 1 (KCNQ1) Antibody |
abx015902-100ul |
Abbexa |
100 ul |
EUR 411 |
- Shipped within 5-10 working days.
|
Potassium Voltage-Gated Channel Subfamily Q Member 1 (KCNQ1) Antibody |
20-abx214196 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Potassium Voltage-Gated Channel Subfamily Q Member 1 (KCNQ1) Antibody |
20-abx214279 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Potassium Voltage-Gated Channel Subfamily Q Member 1 (KCNQ1) Antibody |
abx117240-100ug |
Abbexa |
100 ug |
EUR 467 |
- Shipped within 5-10 working days.
|
Potassium Voltage-Gated Channel Subfamily Q Member 1 (KCNQ1) Antibody |
abx145734-100ug |
Abbexa |
100 ug |
EUR 391 |
- Shipped within 5-10 working days.
|
Potassium Voltage-Gated Channel Subfamily Q Member 1 (KCNQ1) Antibody |
abx034169-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
Potassium Voltage-Gated Channel Subfamily Q Member 1 (KCNQ1) Antibody |
abx034169-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
Potassium Voltage-Gated Channel Subfamily Q Member 1 (KCNQ1) Antibody |
abx431372-200ul |
Abbexa |
200 ul |
EUR 384 |
- Shipped within 1-3 working days.
|
Potassium Voltage-Gated Channel Subfamily Q Member 1 (KCNQ1) Antibody |
abx444962-100ug |
Abbexa |
100 ug |
EUR 523 |
- Shipped within 5-12 working days.
|
Potassium Voltage-Gated Channel Subfamily Q Member 1 (KCNQ1) Antibody |
20-abx001786 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
GAPDH Rabbit Polyclonal Antibody |
37985-100ul |
SAB |
100ul |
EUR 252 |
GAPDH Rabbit Polyclonal Antibody |
37985-50ul |
SAB |
50ul |
EUR 187 |
EFHD1 Rabbit Polyclonal Antibody |
38001-100ul |
SAB |
100ul |
EUR 252 |
EFHD1 Rabbit Polyclonal Antibody |
38001-50ul |
SAB |
50ul |
EUR 187 |
Alliinase Rabbit Polyclonal Antibody |
38042-100ul |
SAB |
100ul |
EUR 252 |
Alliinase Rabbit Polyclonal Antibody |
38042-50ul |
SAB |
50ul |
EUR 187 |
ECFP Rabbit Polyclonal Antibody |
38077-100ul |
SAB |
100ul |
EUR 252 |
ECFP Rabbit Polyclonal Antibody |
38077-50ul |
SAB |
50ul |
EUR 187 |
EYFP Rabbit Polyclonal Antibody |
38078-100ul |
SAB |
100ul |
EUR 252 |
EYFP Rabbit Polyclonal Antibody |
38078-50ul |
SAB |
50ul |
EUR 187 |
mOrange Rabbit Polyclonal Antibody |
38079-100ul |
SAB |
100ul |
EUR 252 |
mOrange Rabbit Polyclonal Antibody |
38079-50ul |
SAB |
50ul |
EUR 187 |
mStrawberry Rabbit Polyclonal Antibody |
38083-100ul |
SAB |
100ul |
EUR 252 |
mStrawberry Rabbit Polyclonal Antibody |
38083-50ul |
SAB |
50ul |
EUR 187 |
AmCyan Rabbit Polyclonal Antibody |
38086-100ul |
SAB |
100ul |
EUR 252 |
AmCyan Rabbit Polyclonal Antibody |
38086-50ul |
SAB |
50ul |
EUR 187 |
EBFP Rabbit Polyclonal Antibody |
38087-100ul |
SAB |
100ul |
EUR 252 |
EBFP Rabbit Polyclonal Antibody |
38087-50ul |
SAB |
50ul |
EUR 187 |
Vimentin Rabbit Polyclonal Antibody |
38104-100ul |
SAB |
100ul |
EUR 252 |
Vimentin Rabbit Polyclonal Antibody |
38104-50ul |
SAB |
50ul |
EUR 187 |
LDHD Rabbit Polyclonal Antibody |
38105-100ul |
SAB |
100ul |
EUR 252 |
LDHD Rabbit Polyclonal Antibody |
38105-50ul |
SAB |
50ul |
EUR 187 |
GAPDH Rabbit Polyclonal Antibody |
A01021-005ml |
Abbkine |
0.05ml |
EUR 147 |
- Immunogen information: Recombinant Protein
- Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
- Show more
|
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein |
GAPDH Rabbit Polyclonal Antibody |
A01021-02ml |
Abbkine |
0.2ml |
EUR 332 |
- Immunogen information: Recombinant Protein
- Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
- Show more
|
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein |
GAPDH Rabbit Polyclonal Antibody |
A01021-02ml5 |
Abbkine |
0.2ml×5 |
EUR 920 |
- Immunogen information: Recombinant Protein
- Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
- Show more
|
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein |
Rabbit Hemoglobin Polyclonal Antibody |
A53073 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: The best epigenetics products |
Met Rabbit Polyclonal Antibody |
ABP57458-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
Met Rabbit Polyclonal Antibody |
ABP57458-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
Met Rabbit Polyclonal Antibody |
ABP57458-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
VEGF Rabbit Polyclonal Antibody |
ABP57460-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
VEGF Rabbit Polyclonal Antibody |
ABP57460-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
VEGF Rabbit Polyclonal Antibody |
ABP57460-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
CD10 Rabbit Polyclonal Antibody |
ABP57461-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of CD10 of MME
- Applications tips:
|
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME |
CD10 Rabbit Polyclonal Antibody |
ABP57461-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of CD10 of MME
- Applications tips:
|
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME |
CD10 Rabbit Polyclonal Antibody |
ABP57461-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of CD10 of MME
- Applications tips:
|
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME |
NM23A Rabbit Polyclonal Antibody |
ABP57462-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of NM23A of NME1
- Applications tips:
|
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1 |
NM23A Rabbit Polyclonal Antibody |
ABP57462-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of NM23A of NME1
- Applications tips:
|
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1 |
NM23A Rabbit Polyclonal Antibody |
ABP57462-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of NM23A of NME1
- Applications tips:
|
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1 |
ATM Rabbit Polyclonal Antibody |
ABP57463-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
ATM Rabbit Polyclonal Antibody |
ABP57463-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
KCNQ1 Rabbit Polyclonal Antibody