KCNS3 Polyclonal Antibody |
ABP59025-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human KCNS3 protein at amino acid sequence of 300-380
- Applications tips:
|
Description: A polyclonal antibody for detection of KCNS3 from Human, Mouse. This KCNS3 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human KCNS3 protein at amino acid sequence of 300-380 |
KCNS3 Rabbit pAb |
A7906-100ul |
Abclonal |
100 ul |
EUR 308 |
KCNS3 Rabbit pAb |
A7906-200ul |
Abclonal |
200 ul |
EUR 459 |
KCNS3 Rabbit pAb |
A7906-20ul |
Abclonal |
20 ul |
EUR 183 |
KCNS3 Rabbit pAb |
A7906-50ul |
Abclonal |
50 ul |
EUR 223 |
KCNS3 Antibody |
46144-100ul |
SAB |
100ul |
EUR 252 |
KCNS3 Antibody |
46144-50ul |
SAB |
50ul |
EUR 187 |
KCNS3 Antibody |
47145-100ul |
SAB |
100ul |
EUR 252 |
KCNS3 Antibody |
DF9769 |
Affbiotech |
200ul |
EUR 304 |
Description: KCNS3 Antibody detects endogenous levels of total KCNS3. |
KCNS3 Antibody |
1-CSB-PA859028ESR1HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
|
Description: A polyclonal antibody against KCNS3. Recognizes KCNS3 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200 |
KCNS3 Antibody |
1-CSB-PA859028ESR2HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
|
Description: A polyclonal antibody against KCNS3. Recognizes KCNS3 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB; Recommended dilution: WB:1:1000-1:5000 |
Polyclonal KCNS3 Antibody (N-term) |
AMM06169G |
Leading Biology |
0.1ml |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human KCNS3 (N-term). This antibody is tested and proven to work in the following applications: |
KCNS3 Conjugated Antibody |
C46144 |
SAB |
100ul |
EUR 397 |
KCNS3 Conjugated Antibody |
C47145 |
SAB |
100ul |
EUR 397 |
Anti-KCNS3 antibody |
STJ110215 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: Voltage-gated potassium channels form the largest and most diversified class of ion channels and are present in both excitable and nonexcitable cells. Their main functions are associated with the regulation of the resting membrane potential and the control of the shape and frequency of action potentials. The alpha subunits are of 2 types: those that are functional by themselves and those that are electrically silent but capable of modulating the activity of specific functional alpha subunits. The protein encoded by this gene is not functional by itself but can form heteromultimers with member 1 and with member 2 (and possibly other members) of the Shab-related subfamily of potassium voltage-gated channel proteins. This gene belongs to the S subfamily of the potassium channel family. Alternatively spliced transcript variants encoding the same protein have been found for this gene. |
Anti-KCNS3 antibody |
STJ191192 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to KCNS3 |
KCNS3 siRNA |
20-abx902822 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
KCNS3 siRNA |
20-abx921320 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
KCNS3 siRNA |
20-abx921321 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
KCNS3 cloning plasmid |
CSB-CL859028HU1-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1476
- Sequence: atggtgtttggtgagtttttccatcgccctggacaagacgaggaacttgtcaacctgaatgtggggggctttaagcagtctgttgaccaaagcaccctcctgcggtttcctcacaccagactggggaagctgcttacttgccattctgaagaggccattctggagctgtgtgatg
- Show more
|
Description: A cloning plasmid for the KCNS3 gene. |
KCNS3 cloning plasmid |
CSB-CL859028HU2-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1476
- Sequence: atggtgtttggtgagtttttccatcgccctggacaagacgaggaacttgtcaacctgaatgtggggggctttaagcagtatgttgaccaaagcaccctcctgcggtttcctcacaccagactggggaagctgcttacttgccattctgaagaggccattctggagctgtgtgatg
- Show more
|
Description: A cloning plasmid for the KCNS3 gene. |
KCNS3 Blocking Peptide |
DF9769-BP |
Affbiotech |
1mg |
EUR 195 |
Rat KCNS3 shRNA Plasmid |
20-abx986809 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Human KCNS3 shRNA Plasmid |
20-abx952563 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Mouse KCNS3 shRNA Plasmid |
20-abx982331 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
KCNS3 Recombinant Protein (Human) |
RP016678 |
ABM |
100 ug |
Ask for price |
KCNS3 Recombinant Protein (Human) |
RP016681 |
ABM |
100 ug |
Ask for price |
KCNS3 Recombinant Protein (Rat) |
RP206957 |
ABM |
100 ug |
Ask for price |
KCNS3 Recombinant Protein (Mouse) |
RP145379 |
ABM |
100 ug |
Ask for price |
KCNS3 Recombinant Protein (Mouse) |
RP145382 |
ABM |
100 ug |
Ask for price |
KCNS3 ORF Vector (Human) (pORF) |
ORF005560 |
ABM |
1.0 ug DNA |
EUR 95 |
KCNS3 ORF Vector (Human) (pORF) |
ORF005561 |
ABM |
1.0 ug DNA |
EUR 95 |
Kcns3 ORF Vector (Rat) (pORF) |
ORF068987 |
ABM |
1.0 ug DNA |
EUR 506 |
Kcns3 ORF Vector (Mouse) (pORF) |
ORF048461 |
ABM |
1.0 ug DNA |
EUR 506 |
Kcns3 ORF Vector (Mouse) (pORF) |
ORF048462 |
ABM |
1.0 ug DNA |
EUR 506 |
KCNS3 sgRNA CRISPR Lentivector set (Human) |
K1125501 |
ABM |
3 x 1.0 ug |
EUR 339 |
Kcns3 sgRNA CRISPR Lentivector set (Mouse) |
K3571901 |
ABM |
3 x 1.0 ug |
EUR 339 |
Kcns3 sgRNA CRISPR Lentivector set (Rat) |
K7108901 |
ABM |
3 x 1.0 ug |
EUR 339 |
KCNS3 sgRNA CRISPR Lentivector (Human) (Target 1) |
K1125502 |
ABM |
1.0 ug DNA |
EUR 154 |
KCNS3 sgRNA CRISPR Lentivector (Human) (Target 2) |
K1125503 |
ABM |
1.0 ug DNA |
EUR 154 |
KCNS3 sgRNA CRISPR Lentivector (Human) (Target 3) |
K1125504 |
ABM |
1.0 ug DNA |
EUR 154 |
Kcns3 sgRNA CRISPR Lentivector (Mouse) (Target 1) |
K3571902 |
ABM |
1.0 ug DNA |
EUR 154 |
Kcns3 sgRNA CRISPR Lentivector (Mouse) (Target 2) |
K3571903 |
ABM |
1.0 ug DNA |
EUR 154 |
Kcns3 sgRNA CRISPR Lentivector (Mouse) (Target 3) |
K3571904 |
ABM |
1.0 ug DNA |
EUR 154 |
Kcns3 sgRNA CRISPR Lentivector (Rat) (Target 1) |
K7108902 |
ABM |
1.0 ug DNA |
EUR 154 |
Kcns3 sgRNA CRISPR Lentivector (Rat) (Target 2) |
K7108903 |
ABM |
1.0 ug DNA |
EUR 154 |
Kcns3 sgRNA CRISPR Lentivector (Rat) (Target 3) |
K7108904 |
ABM |
1.0 ug DNA |
EUR 154 |
KCNS3 Protein Vector (Human) (pPB-C-His) |
PV022237 |
ABM |
500 ng |
EUR 329 |
KCNS3 Protein Vector (Human) (pPB-N-His) |
PV022238 |
ABM |
500 ng |
EUR 329 |
KCNS3 Protein Vector (Human) (pPM-C-HA) |
PV022239 |
ABM |
500 ng |
EUR 329 |
KCNS3 Protein Vector (Human) (pPM-C-His) |
PV022240 |
ABM |
500 ng |
EUR 329 |
KCNS3 Protein Vector (Human) (pPB-C-His) |
PV022241 |
ABM |
500 ng |
EUR 329 |
KCNS3 Protein Vector (Human) (pPB-N-His) |
PV022242 |
ABM |
500 ng |
EUR 329 |
KCNS3 Protein Vector (Human) (pPM-C-HA) |
PV022243 |
ABM |
500 ng |
EUR 329 |
KCNS3 Protein Vector (Human) (pPM-C-His) |
PV022244 |
ABM |
500 ng |
EUR 329 |
KCNS3 Protein Vector (Rat) (pPB-C-His) |
PV275946 |
ABM |
500 ng |
EUR 603 |
KCNS3 Protein Vector (Rat) (pPB-N-His) |
PV275947 |
ABM |
500 ng |
EUR 603 |
KCNS3 Protein Vector (Rat) (pPM-C-HA) |
PV275948 |
ABM |
500 ng |
EUR 603 |
KCNS3 Protein Vector (Rat) (pPM-C-His) |
PV275949 |
ABM |
500 ng |
EUR 603 |
KCNS3 Protein Vector (Mouse) (pPB-C-His) |
PV193842 |
ABM |
500 ng |
EUR 603 |
KCNS3 Protein Vector (Mouse) (pPB-N-His) |
PV193843 |
ABM |
500 ng |
EUR 603 |
KCNS3 Protein Vector (Mouse) (pPM-C-HA) |
PV193844 |
ABM |
500 ng |
EUR 603 |
KCNS3 Protein Vector (Mouse) (pPM-C-His) |
PV193845 |
ABM |
500 ng |
EUR 603 |
KCNS3 Protein Vector (Mouse) (pPB-C-His) |
PV193846 |
ABM |
500 ng |
EUR 603 |
KCNS3 Protein Vector (Mouse) (pPB-N-His) |
PV193847 |
ABM |
500 ng |
EUR 603 |
KCNS3 Protein Vector (Mouse) (pPM-C-HA) |
PV193848 |
ABM |
500 ng |
EUR 603 |
KCNS3 Protein Vector (Mouse) (pPM-C-His) |
PV193849 |
ABM |
500 ng |
EUR 603 |
Kcns3 3'UTR Luciferase Stable Cell Line |
TU206621 |
ABM |
1.0 ml |
Ask for price |
Kcns3 3'UTR GFP Stable Cell Line |
TU160476 |
ABM |
1.0 ml |
Ask for price |
KCNS3 3'UTR Luciferase Stable Cell Line |
TU011548 |
ABM |
1.0 ml |
EUR 1394 |
Kcns3 3'UTR Luciferase Stable Cell Line |
TU110476 |
ABM |
1.0 ml |
Ask for price |
KCNS3 3'UTR GFP Stable Cell Line |
TU061548 |
ABM |
1.0 ml |
EUR 1394 |
Kcns3 3'UTR GFP Stable Cell Line |
TU256621 |
ABM |
1.0 ml |
Ask for price |
Potassium Voltage-Gated Channel Subfamily S Member 3 (KCNS3) Antibody |
abx036180-100ug |
Abbexa |
100 ug |
EUR 391 |
- Shipped within 5-10 working days.
|
Potassium Voltage-Gated Channel Subfamily S Member 3 (KCNS3) Antibody |
20-abx007090 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
Potassium Voltage-Gated Channel Subfamily S Member 3 (KCNS3) Antibody |
abx029456-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
Potassium Voltage-Gated Channel Subfamily S Member 3 (KCNS3) Antibody |
abx029456-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
Potassium Voltage-Gated Channel Subfamily S Member 3 (KCNS3) Antibody |
20-abx322544 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Potassium Voltage-Gated Channel Subfamily S Member 3 (KCNS3) Antibody |
20-abx322545 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Potassium Voltage-Gated Channel Subfamily S Member 3 (KCNS3) Antibody |
20-abx216396 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
KCNS3 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV) |
LV678325 |
ABM |
1.0 ug DNA |
EUR 682 |
KCNS3 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC) |
LV678329 |
ABM |
1.0 ug DNA |
EUR 682 |
KCNS3 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a) |
LV678330 |
ABM |
1.0 ug DNA |
EUR 682 |
KCNS3 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV) |
LV711567 |
ABM |
1.0 ug DNA |
EUR 316 |
KCNS3 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC) |
LV711571 |
ABM |
1.0 ug DNA |
EUR 316 |
KCNS3 Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a) |
LV711572 |
ABM |
1.0 ug DNA |
EUR 316 |
VEGF Rabbit Polyclonal Antibody |
ES8453-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
VEGF Rabbit Polyclonal Antibody |
ES8453-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
CD10 Rabbit Polyclonal Antibody |
ES8454-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
CD10 Rabbit Polyclonal Antibody |
ES8454-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NM23A Rabbit Polyclonal Antibody |
ES8455-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NM23A Rabbit Polyclonal Antibody |
ES8455-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8456-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8456-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8457-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8457-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
HSC70 Rabbit Polyclonal Antibody |
ES8558-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSC70 Rabbit Polyclonal Antibody |
ES8558-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSP40 Rabbit Polyclonal Antibody |
ES8559-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSP40 Rabbit Polyclonal Antibody |
ES8559-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSP90? Rabbit Polyclonal Antibody |
ES8560-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
HSP90? Rabbit Polyclonal Antibody |
ES8560-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
IkB ? Rabbit Polyclonal Antibody |
ES8561-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
IkB ? Rabbit Polyclonal Antibody |
ES8561-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
JAK1 Rabbit Polyclonal Antibody |
ES8562-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JAK1 Rabbit Polyclonal Antibody |
ES8562-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JAK2 Rabbit Polyclonal Antibody |
ES8563-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JAK2 Rabbit Polyclonal Antibody |
ES8563-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JNK2 Rabbit Polyclonal Antibody |
ES8564-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
JNK2 Rabbit Polyclonal Antibody |
ES8564-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
JNK3 Rabbit Polyclonal Antibody |
ES8565-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JNK3 Rabbit Polyclonal Antibody |
ES8565-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
MEK2 Rabbit Polyclonal Antibody |
ES8566-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC |
MEK2 Rabbit Polyclonal Antibody |
ES8566-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC |
MEK3 Rabbit Polyclonal Antibody |
ES8567-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
MEK3 Rabbit Polyclonal Antibody |
ES8567-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
Nrf2 Rabbit Polyclonal Antibody |
ES8568-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
Nrf2 Rabbit Polyclonal Antibody |
ES8568-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4a Rabbit Polyclonal Antibody |
ES8569-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4a Rabbit Polyclonal Antibody |
ES8569-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4b Rabbit Polyclonal Antibody |
ES8570-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4b Rabbit Polyclonal Antibody |
ES8570-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4c Rabbit Polyclonal Antibody |
ES8571-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4c Rabbit Polyclonal Antibody |
ES8571-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG5 Rabbit Polyclonal Antibody |
ES8572-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG5 Rabbit Polyclonal Antibody |
ES8572-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG7 Rabbit Polyclonal Antibody |
ES8573-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG7 Rabbit Polyclonal Antibody |
ES8573-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG13 Rabbit Polyclonal Antibody |
ES8574-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG13 Rabbit Polyclonal Antibody |
ES8574-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG13 Rabbit Polyclonal Antibody |
ES8575-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG13 Rabbit Polyclonal Antibody |
ES8575-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG14L Rabbit Polyclonal Antibody |
ES8576-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG14L Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG14L Rabbit Polyclonal Antibody |
ES8576-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG14L Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NBR1 Rabbit Polyclonal Antibody |
ES8578-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NBR1 Rabbit Polyclonal Antibody |
ES8578-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NBR1 Rabbit Polyclonal Antibody |
ES8579-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NBR1 Rabbit Polyclonal Antibody |
ES8579-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
WIPI2 Rabbit Polyclonal Antibody |
ES8580-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against WIPI2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
WIPI2 Rabbit Polyclonal Antibody |
ES8580-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against WIPI2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
Gab1 Rabbit Polyclonal Antibody |
ES8582-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against Gab1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
Gab1 Rabbit Polyclonal Antibody |
ES8582-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against Gab1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ERK1 Rabbit Polyclonal Antibody |
ES8583-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ERK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ERK1 Rabbit Polyclonal Antibody |
ES8583-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ERK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
Met Rabbit Polyclonal Antibody |
ABP57458-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
Met Rabbit Polyclonal Antibody |
ABP57458-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
Met Rabbit Polyclonal Antibody |
ABP57458-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
VEGF Rabbit Polyclonal Antibody |
ABP57460-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
VEGF Rabbit Polyclonal Antibody |
ABP57460-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
VEGF Rabbit Polyclonal Antibody |
ABP57460-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
CD10 Rabbit Polyclonal Antibody |
ABP57461-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of CD10 of MME
- Applications tips:
|
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME |
CD10 Rabbit Polyclonal Antibody |
ABP57461-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of CD10 of MME
- Applications tips:
|
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME |
CD10 Rabbit Polyclonal Antibody |
ABP57461-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of CD10 of MME
- Applications tips:
|
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME |
NM23A Rabbit Polyclonal Antibody |
ABP57462-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of NM23A of NME1
- Applications tips:
|
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1 |
NM23A Rabbit Polyclonal Antibody |
ABP57462-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of NM23A of NME1
- Applications tips:
|
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1 |
NM23A Rabbit Polyclonal Antibody |
ABP57462-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of NM23A of NME1
- Applications tips:
|
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1 |
ATM Rabbit Polyclonal Antibody |
ABP57463-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
KCNS3 Rabbit Polyclonal Antibody