NASP Polyclonal Antibody |
ES9930-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against NASP from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA |
NASP Polyclonal Antibody |
ES9930-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against NASP from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA |
NASP Rabbit pAb |
A3972-100ul |
Abclonal |
100 ul |
EUR 308 |
NASP Rabbit pAb |
A3972-200ul |
Abclonal |
200 ul |
EUR 459 |
NASP Rabbit pAb |
A3972-20ul |
Abclonal |
20 ul |
Ask for price |
NASP Rabbit pAb |
A3972-50ul |
Abclonal |
50 ul |
Ask for price |
NASP Rabbit pAb |
A6938-100ul |
Abclonal |
100 ul |
EUR 308 |
NASP Rabbit pAb |
A6938-200ul |
Abclonal |
200 ul |
EUR 459 |
NASP Rabbit pAb |
A6938-20ul |
Abclonal |
20 ul |
EUR 183 |
NASP Rabbit pAb |
A6938-50ul |
Abclonal |
50 ul |
EUR 223 |
NASP antibody |
70R-18758 |
Fitzgerald |
50 ul |
EUR 435 |
Description: Rabbit polyclonal NASP antibody |
NASP antibody |
70R-2036 |
Fitzgerald |
50 ug |
EUR 467 |
Description: Rabbit polyclonal NASP antibody |
NASP Antibody |
47745-100ul |
SAB |
100ul |
EUR 252 |
NASP Antibody |
DF12166 |
Affbiotech |
200ul |
EUR 304 |
Description: NASP antibody detects endogenous levels of NASP. |
NASP Antibody |
1-CSB-PA015462DSR1HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
|
Description: A polyclonal antibody against NASP. Recognizes NASP from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200 |
NASP Antibody |
1-CSB-PA015462GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
|
Description: A polyclonal antibody against NASP. Recognizes NASP from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF |
Polyclonal NASP Antibody (N-term) |
APR05360G |
Leading Biology |
0.1ml |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human NASP (N-term). This antibody is tested and proven to work in the following applications: |
NASP Conjugated Antibody |
C47745 |
SAB |
100ul |
EUR 397 |
anti- NASP antibody |
FNab05559 |
FN Test |
100µg |
EUR 505.25 |
- Recommended dilution: WB: 1:500 - 1:2000
- IHC: 1:50 - 1:200
- Immunogen: nuclear autoantigenic sperm protein (histone-binding)
- Uniprot ID: P49321
- Gene ID: 4678
- Research Area: Metabolism
|
Description: Antibody raised against NASP |
Anti-NASP antibody |
STJ24684 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: This gene encodes a H1 histone binding protein that is involved in transporting histones into the nucleus of dividing cells. Multiple isoforms are encoded by transcript variants of this gene. The somatic form is expressed in all mitotic cells, is localized to the nucleus, and is coupled to the cell cycle. The testicular form is expressed in embryonic tissues, tumor cells, and the testis. In male germ cells, this protein is localized to the cytoplasm of primary spermatocytes, the nucleus of spermatids, and the periacrosomal region of mature spermatozoa. |
Anti-NASP antibody |
STJ29018 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: This gene encodes a H1 histone binding protein that is involved in transporting histones into the nucleus of dividing cells. Multiple isoforms are encoded by transcript variants of this gene. The somatic form is expressed in all mitotic cells, is localized to the nucleus, and is coupled to the cell cycle. The testicular form is expressed in embryonic tissues, tumor cells, and the testis. In male germ cells, this protein is localized to the cytoplasm of primary spermatocytes, the nucleus of spermatids, and the periacrosomal region of mature spermatozoa. |
Anti-NASP antibody |
STJ191088 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to NASP |
NASP siRNA |
20-abx903473 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
NASP siRNA |
20-abx925422 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
NASP siRNA |
20-abx925423 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
NASP Blocking Peptide |
33R-4313 |
Fitzgerald |
100 ug |
EUR 180 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of NASP antibody, catalog no. 70R-2036 |
NASP Blocking Peptide |
DF12166-BP |
Affbiotech |
1mg |
EUR 195 |
NASP cloning plasmid |
CSB-CL015462HU-10ug |
Cusabio |
10ug |
EUR 488 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1350
- Sequence: atggccatggagtccacagccactgccgccgtcgccgcggagctggtttctgccgacaaaattgaagatgttcctgctccttctacatctgcagataaagtggagagtctggatgtggatagtgaagctaagaaactattgggtttaggacagaaacatctggtgatgggggata
- Show more
|
Description: A cloning plasmid for the NASP gene. |
Rabbit Nuclear autoantigenic sperm protein, NASP ELISA KIT |
ELI-38390Ra |
Lifescience Market |
96 Tests |
EUR 928 |
Nuclear Autoantigenic Sperm Protein (NASP) Antibody |
20-abx006861 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
Nuclear Autoantigenic Sperm Protein (NASP) Antibody |
20-abx002909 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Nuclear Autoantigenic Sperm Protein (NASP) Antibody |
20-abx114162 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Nuclear Autoantigenic Sperm Protein (NASP) Antibody |
abx032340-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
Nuclear Autoantigenic Sperm Protein (NASP) Antibody |
abx032340-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
Nuclear Autoantigenic Sperm Protein (NASP) Antibody |
20-abx320760 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Nuclear Autoantigenic Sperm Protein (NASP) Antibody |
abx235559-100ug |
Abbexa |
100 ug |
EUR 481 |
- Shipped within 5-12 working days.
|
Nuclear Autoantigenic Sperm Protein (NASP) Antibody |
20-abx225305 |
Abbexa |
-
EUR 370.00
-
EUR 606.00
-
EUR 314.00
|
|
- Shipped within 5-10 working days.
|
Rat NASP shRNA Plasmid |
20-abx988926 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Mouse NASP shRNA Plasmid |
20-abx974164 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Human NASP shRNA Plasmid |
20-abx953095 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
NASP Recombinant Protein (Human) |
RP020716 |
ABM |
100 ug |
Ask for price |
NASP Recombinant Protein (Mouse) |
RP153110 |
ABM |
100 ug |
Ask for price |
NASP Recombinant Protein (Mouse) |
RP153113 |
ABM |
100 ug |
Ask for price |
NASP Recombinant Protein (Rat) |
RP213299 |
ABM |
100 ug |
Ask for price |
Nuclear Autoantigenic Sperm Protein, Histone Binding (NASP) Polyclonal Antibody (Rat) |
4-PAC652Ra01 |
Cloud-Clone |
-
EUR 259.00
-
EUR 2708.00
-
EUR 670.00
-
EUR 328.00
-
EUR 219.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: NASP (Thr3~Asp223)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Rat Nuclear Autoantigenic Sperm Protein, Histone Binding (NASP) |
ELISA kit for Rabbit Nuclear autoantigenic sperm protein (NASP) |
KTE90077-48T |
Abbkine |
48T |
EUR 354 |
- Nuclear autoantigenic sperm protein (NASP) encodes a H1 histone binding protein that is involved in transporting histones into the nucleus of dividing cells. Multiple isoforms are encoded by transcript variants of this gene. The somatic form is expre
- Show more
|
Description: Quantitative sandwich ELISA for measuring Rabbit Nuclear autoantigenic sperm protein (NASP) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Rabbit Nuclear autoantigenic sperm protein (NASP) |
KTE90077-5platesof96wells |
Abbkine |
5 plates of 96 wells |
EUR 2252 |
- Nuclear autoantigenic sperm protein (NASP) encodes a H1 histone binding protein that is involved in transporting histones into the nucleus of dividing cells. Multiple isoforms are encoded by transcript variants of this gene. The somatic form is expre
- Show more
|
Description: Quantitative sandwich ELISA for measuring Rabbit Nuclear autoantigenic sperm protein (NASP) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Rabbit Nuclear autoantigenic sperm protein (NASP) |
KTE90077-96T |
Abbkine |
96T |
EUR 572 |
- Nuclear autoantigenic sperm protein (NASP) encodes a H1 histone binding protein that is involved in transporting histones into the nucleus of dividing cells. Multiple isoforms are encoded by transcript variants of this gene. The somatic form is expre
- Show more
|
Description: Quantitative sandwich ELISA for measuring Rabbit Nuclear autoantigenic sperm protein (NASP) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
Nuclear Autoantigenic Sperm Protein, Histone Binding (NASP) Polyclonal Antibody (Rat), APC |
4-PAC652Ra01-APC |
Cloud-Clone |
-
EUR 364.00
-
EUR 3545.00
-
EUR 980.00
-
EUR 467.00
-
EUR 227.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: NASP (Thr3~Asp223)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Rat Nuclear Autoantigenic Sperm Protein, Histone Binding (NASP). This antibody is labeled with APC. |
Nuclear Autoantigenic Sperm Protein, Histone Binding (NASP) Polyclonal Antibody (Rat), Biotinylated |
4-PAC652Ra01-Biotin |
Cloud-Clone |
-
EUR 325.00
-
EUR 2658.00
-
EUR 777.00
-
EUR 400.00
-
EUR 225.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: NASP (Thr3~Asp223)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Rat Nuclear Autoantigenic Sperm Protein, Histone Binding (NASP). This antibody is labeled with Biotin. |
Nuclear Autoantigenic Sperm Protein, Histone Binding (NASP) Polyclonal Antibody (Rat), Cy3 |
4-PAC652Ra01-Cy3 |
Cloud-Clone |
-
EUR 444.00
-
EUR 4685.00
-
EUR 1265.00
-
EUR 581.00
-
EUR 261.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: NASP (Thr3~Asp223)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Rat Nuclear Autoantigenic Sperm Protein, Histone Binding (NASP). This antibody is labeled with Cy3. |
Nuclear Autoantigenic Sperm Protein, Histone Binding (NASP) Polyclonal Antibody (Rat), FITC |
4-PAC652Ra01-FITC |
Cloud-Clone |
-
EUR 311.00
-
EUR 2856.00
-
EUR 804.00
-
EUR 393.00
-
EUR 202.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: NASP (Thr3~Asp223)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Rat Nuclear Autoantigenic Sperm Protein, Histone Binding (NASP). This antibody is labeled with FITC. |
Nuclear Autoantigenic Sperm Protein, Histone Binding (NASP) Polyclonal Antibody (Rat), HRP |
4-PAC652Ra01-HRP |
Cloud-Clone |
-
EUR 332.00
-
EUR 3089.00
-
EUR 866.00
-
EUR 421.00
-
EUR 213.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: NASP (Thr3~Asp223)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Rat Nuclear Autoantigenic Sperm Protein, Histone Binding (NASP). This antibody is labeled with HRP. |
Nuclear Autoantigenic Sperm Protein, Histone Binding (NASP) Polyclonal Antibody (Rat), PE |
4-PAC652Ra01-PE |
Cloud-Clone |
-
EUR 311.00
-
EUR 2856.00
-
EUR 804.00
-
EUR 393.00
-
EUR 202.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: NASP (Thr3~Asp223)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Rat Nuclear Autoantigenic Sperm Protein, Histone Binding (NASP). This antibody is labeled with PE. |
Rabbit Nuclear autoantigenic sperm protein(NASP)Â kit ELISA kit |
E04N0604-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rabbit Nuclear autoantigenic sperm protein(NASP)Â kit in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit Nuclear autoantigenic sperm protein(NASP)Â kit ELISA kit |
E04N0604-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rabbit Nuclear autoantigenic sperm protein(NASP)Â kit in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
NASP Rabbit Polyclonal Antibody