NDE1 Rabbit Polyclonal Antibody

NDE1 Polyclonal Antibody

ABP59414-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human NDE1 protein at amino acid sequence of 270-350
  • Applications tips:
Description: A polyclonal antibody for detection of NDE1 from Human, Mouse, Rat. This NDE1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human NDE1 protein at amino acid sequence of 270-350

NDE1 Polyclonal Antibody

30827-100ul 100ul
EUR 252

NDE1 Polyclonal Antibody

30827-50ul 50ul
EUR 187

NDE1 Polyclonal Antibody

28440-100ul 100ul
EUR 252

NDE1 Polyclonal Antibody

28440-50ul 50ul
EUR 187

NDE1 Rabbit pAb

A7112-100ul 100 ul
EUR 308

NDE1 Rabbit pAb

A7112-200ul 200 ul
EUR 459

NDE1 Rabbit pAb

A7112-20ul 20 ul
EUR 183

NDE1 Rabbit pAb

A7112-50ul 50 ul
EUR 223

NDE1 Rabbit pAb

A14136-100ul 100 ul
EUR 308

NDE1 Rabbit pAb

A14136-200ul 200 ul
EUR 459

NDE1 Rabbit pAb

A14136-20ul 20 ul
EUR 183

NDE1 Rabbit pAb

A14136-50ul 50 ul
EUR 223

NDE1 Polyclonal Conjugated Antibody

C30827 100ul
EUR 397

NDE1 Polyclonal Conjugated Antibody

C28440 100ul
EUR 397

NDE1 antibody

70R-2212 50 ug
EUR 467
Description: Rabbit polyclonal NDE1 antibody

NDE1 antibody

10R-7815 50 ul
EUR 208
Description: Mouse monoclonal NDE1 antibody

NDE1 antibody

70R-18792 50 ul
EUR 435
Description: Rabbit polyclonal NDE1 antibody

NDE1 Antibody

  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against NDE1. Recognizes NDE1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

NDE1 Antibody

  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against NDE1. Recognizes NDE1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

NDE1 Antibody

DF12040 200ul
EUR 304
Description: NDE1 antibody detects endogenous levels of NDE1.

NDE1 Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against NDE1. Recognizes NDE1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF

Nde1/ Rat Nde1 ELISA Kit

ELI-46034r 96 Tests
EUR 886

anti- NDE1 antibody

FNab05600 100µg
EUR 505.25
  • Recommended dilution: WB: 1:500 - 1:2000
  • IHC: 1:50 - 1:200
  • Immunogen: nudE nuclear distribution gene E homolog 1 (A. nidulans)
  • Uniprot ID: Q9NXR1
  • Gene ID: 54820
  • Research Area: Neuroscience, Developmental biology
Description: Antibody raised against NDE1

Anti-NDE1 antibody

PAab05600 100 ug
EUR 355

Anti-NDE1 antibody

STJ29192 100 µl
EUR 277
Description: This gene encodes a member of the nuclear distribution E (NudE) family of proteins. The encoded protein is localized at the centrosome and interacts with other centrosome components as part of a multiprotein complex that regulates dynein function. This protein plays an essential role in microtubule organization, mitosis and neuronal migration. Mutations in this gene cause lissencephaly 4, a disorder characterized by lissencephaly, severe brain atrophy, microcephaly, and severe mental retardation. Alternative splicing results in multiple transcript variants.

Anti-NDE1 antibody

STJ191089 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to NDE1

Anti-NDE1 antibody

STJ116071 100 µl
EUR 277
Description: This gene encodes a member of the nuclear distribution E (NudE) family of proteins. The encoded protein is localized at the centrosome and interacts with other centrosome components as part of a multiprotein complex that regulates dynein function. This protein plays an essential role in microtubule organization, mitosis and neuronal migration. Mutations in this gene cause lissencephaly 4, a disorder characterized by lissencephaly, severe brain atrophy, microcephaly, and severe mental retardation. Alternative splicing results in multiple transcript variants.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

NDE1 Blocking Peptide

33R-1254 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of EBF3 antibody, catalog no. 20R-1069

NDE1 Blocking Peptide

DF12040-BP 1mg
EUR 195

NDE1 cloning plasmid

CSB-CL889142HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1008
  • Sequence: atggaggactccggaaagactttcagctccgaggaggaagaagctaactattggaaagatctggcgatgacctacaaacagagggcagaaaatacgcaagaggaactccgagaattccaggagggaagccgagaatatgaagctgaattggagacgcagctgcaacaaattgaaa
  • Show more
Description: A cloning plasmid for the NDE1 gene.

Mouse NDE1 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Rat NDE1 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.


ELI-22196c 96 Tests
EUR 928

Mouse Nde1 ELISA KIT

ELI-16436m 96 Tests
EUR 865


EF001122 96 Tests
EUR 689


ELI-38372h 96 Tests
EUR 824

NDE1 protein (His tag)

80R-1784 100 ug
EUR 305
Description: Purified recombinant Human NDE1 protein

Human NDE1 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

NDE1 Recombinant Protein (Human)

RP020878 100 ug Ask for price

NDE1 Recombinant Protein (Rat)

RP213440 100 ug Ask for price

NDE1 Recombinant Protein (Mouse)

RP153365 100 ug Ask for price

NDE1 Recombinant Protein (Mouse)

RP153368 100 ug Ask for price

Anti-NDE1 (2G11-1C11)

YF-MA18693 100 ug
EUR 363
Description: Mouse monoclonal to NDE1

NudE Neurodevelopment Protein 1 (NDE1) Antibody

  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

NudE Neurodevelopment Protein 1 (NDE1) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

NudE Neurodevelopment Protein 1 (NDE1) Antibody

  • EUR 439.00
  • EUR 328.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

NudE Neurodevelopment Protein 1 (NDE1) Antibody

  • EUR 439.00
  • EUR 328.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

NudE Neurodevelopment Protein 1 (NDE1) Antibody

abx235600-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

NDE1 ORF Vector (Human) (pORF)

ORF006960 1.0 ug DNA
EUR 95

Nde1 ORF Vector (Rat) (pORF)

ORF071148 1.0 ug DNA
EUR 506

Nde1 ORF Vector (Mouse) (pORF)

ORF051123 1.0 ug DNA
EUR 506

Nde1 ORF Vector (Mouse) (pORF)

ORF051124 1.0 ug DNA
EUR 506

Monoclonal NDE1 Antibody (monoclonal) (M01), Clone: 2G11-1C11

AMM06577G 0.1mg
EUR 484
Description: A Monoclonal antibody against Human NDE1 (monoclonal) (M01). The antibodies are raised in mouse and are from clone 2G11-1C11. This antibody is applicable in WB and IF, E

NudE Neurodevelopment Protein 1 (NDE1) Protein

  • EUR 3418.00
  • EUR 328.00
  • EUR 230.00
  • 1 mg
  • 20 ug
  • 5 ug
  • Shipped within 5-10 working days.

NDE1 sgRNA CRISPR Lentivector set (Human)

K1406401 3 x 1.0 ug
EUR 339

Nde1 sgRNA CRISPR Lentivector set (Mouse)

K4574701 3 x 1.0 ug
EUR 339

NDE1 Rabbit Polyclonal Antibody