NEK6 Rabbit Polyclonal Antibody

NEK6 Rabbit pAb

A8481-100ul 100 ul
EUR 308

NEK6 Rabbit pAb

A8481-200ul 200 ul
EUR 459

NEK6 Rabbit pAb

A8481-20ul 20 ul
EUR 183

NEK6 Rabbit pAb

A8481-50ul 50 ul
EUR 223

NEK6 antibody

70R-18840 50 ul
EUR 435
Description: Rabbit polyclonal NEK6 antibody

NEK6 antibody

10R-4953 100 ul
EUR 726
Description: Mouse monoclonal NEK6 antibody

NEK6 antibody

10R-4954 100 ul
EUR 691
Description: Mouse monoclonal NEK6 antibody

NEK6 antibody

10R-4956 100 ul
EUR 691
Description: Mouse monoclonal NEK6 antibody

NEK6 Antibody

45255-100ul 100ul
EUR 252

NEK6 Antibody

45255-50ul 50ul
EUR 187

NEK6 Antibody

DF8259 200ul
EUR 304
Description: NEK6 Antibody detects endogenous levels of total NEK6.

NEK6 Antibody

1-CSB-PA015704GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20oC, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against NEK6. Recognizes NEK6 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA

NEK6 antibody

70R-5777 50 ug
EUR 467
Description: Rabbit polyclonal NEK6 antibody

NEK6 Antibody

abx122675-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

NEK6 Antibody

ABD8259 100 ug
EUR 438

NEK6 Antibody

ABD8277 100 ug
EUR 438

Polyclonal NEK6 Antibody (C-Terminus)

APR02058G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human NEK6 (C-Terminus). This antibody is tested and proven to work in the following applications:

Serine/threonine-Protein Kinase Nek6 (NEK6) Antibody

20-abx005847
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Serine/threonine-Protein Kinase Nek6 (NEK6) Antibody

20-abx217109
  • EUR 425.00
  • EUR 342.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Serine/threonine-Protein Kinase Nek6 (NEK6) Antibody

abx033855-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Serine/threonine-Protein Kinase Nek6 (NEK6) Antibody

abx033855-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Nek6/ Rat Nek6 ELISA Kit

ELI-13801r 96 Tests
EUR 886

NEK6 Conjugated Antibody

C45255 100ul
EUR 397

Anti-NEK6 antibody

STJ110779 100 µl
EUR 277
Description: The protein encoded by this gene is a kinase required for progression through the metaphase portion of mitosis. Inhibition of the encoded protein can lead to apoptosis. This protein also can enhance tumorigenesis by suppressing tumor cell senescence. Several transcript variants encoding a few different isoforms have been found for this gene.

Anti-NEK6 antibody

STJ191367 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to NEK6

NEK6 protein

30R-2831 5 ug
EUR 503
Description: Purified recombinant Human NEK6 protein

NEK6, Active

7716-5
EUR 370

NEK6 siRNA

20-abx903526
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

NEK6 siRNA

20-abx925722
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

NEK6 siRNA

20-abx925723
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

pOTB7-NEK6

PVT18482 2 ug
EUR 231

anti-NEK6

YF-PA25669 50 ul
EUR 334
Description: Mouse polyclonal to NEK6

NEK6 Blocking Peptide

33R-3041 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of NEK6 antibody, catalog no. 70R-5777

NEK6 Blocking Peptide

DF8259-BP 1mg
EUR 195

NEK6 cloning plasmid

CSB-CL872543HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 942
  • Sequence: atggcaggacagcccggccacatgccccatggagggagttccaacaacctctgccacaccctggggcctgtgcatcctcctgacccacagaggcatcccaacacgctgtcttttcgctgctcgctggcggacttccagatcgaaaagaagataggccgaggacagttcagcgaggt
  • Show more
Description: A cloning plasmid for the NEK6 gene.

Anti-NEK6 (3B5)

YF-MA17486 100 ug
EUR 363
Description: Mouse monoclonal to NEK6

Anti-NEK6 (2A7)

YF-MA17487 50 ug
EUR 363
Description: Mouse monoclonal to NEK6

Anti-NEK6 (4B10)

YF-MA17488 200 ul
EUR 363
Description: Mouse monoclonal to NEK6

Porcine Serine/threonine- protein kinase Nek6, NEK6 ELISA KIT

ELI-16455p 96 Tests
EUR 928

Human Serine/threonine- protein kinase Nek6, NEK6 ELISA KIT

ELI-23244h 96 Tests
EUR 824

Mouse Serine/threonine- protein kinase Nek6, Nek6 ELISA KIT

ELI-39577m 96 Tests
EUR 865

Rat NEK6 shRNA Plasmid

20-abx990026
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse NEK6 shRNA Plasmid

20-abx975188
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human NEK6 shRNA Plasmid

20-abx957348
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

h NEK6 Expression Lentivirus

LVP1182 1x107 IFU/ml x 200ul
EUR 451
Description: Pre-made over-expression lentivirus for human target: NEK6, containing a RFP-Blasticidin dual selection marker.

Nek6 ORF Vector (Rat) (pORF)

ORF071225 1.0 ug DNA
EUR 506

h NEK6 inducible lentiviral particles

LVP230 1x107 IFU/ml x 200ul
EUR 451
Description: Pre-made tet-inducible lentiviral particles expressing a human gene with a Blasticidin-RFP fusion marker (Dual selection). The expressed human gene, NEK6, is fully sequence verified and matched to NCBI accession ID: NM_014397.4

NEK6 ORF Vector (Human) (pORF)

ORF007023 1.0 ug DNA
EUR 95

Nek6 ORF Vector (Mouse) (pORF)

ORF051222 1.0 ug DNA
EUR 506

Nek6 ORF Vector (Mouse) (pORF)

ORF051223 1.0 ug DNA
EUR 506

Nek6 sgRNA CRISPR Lentivector set (Mouse)

K4956201 3 x 1.0 ug
EUR 339

Nek6 sgRNA CRISPR Lentivector set (Rat)

K7399701 3 x 1.0 ug
EUR 339

NEK6 sgRNA CRISPR Lentivector set (Human)

K1416801 3 x 1.0 ug
EUR 339

Nek6 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4956202 1.0 ug DNA
EUR 154

Nek6 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4956203 1.0 ug DNA
EUR 154

Nek6 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4956204 1.0 ug DNA
EUR 154

Nek6 sgRNA CRISPR Lentivector (Rat) (Target 1)

K7399702 1.0 ug DNA
EUR 154

Nek6 sgRNA CRISPR Lentivector (Rat) (Target 2)

K7399703 1.0 ug DNA
EUR 154

Nek6 sgRNA CRISPR Lentivector (Rat) (Target 3)

K7399704 1.0 ug DNA
EUR 154

NEK6 sgRNA CRISPR Lentivector (Human) (Target 1)

K1416802 1.0 ug DNA
EUR 154

NEK6 sgRNA CRISPR Lentivector (Human) (Target 2)

K1416803 1.0 ug DNA
EUR 154

NEK6 sgRNA CRISPR Lentivector (Human) (Target 3)

K1416804 1.0 ug DNA
EUR 154

NEK6 Protein Vector (Mouse) (pPB-C-His)

PV204886 500 ng
EUR 603

NEK6 Protein Vector (Mouse) (pPB-N-His)

PV204887 500 ng
EUR 603

NEK6 Protein Vector (Mouse) (pPM-C-HA)

PV204888 500 ng
EUR 603

NEK6 Protein Vector (Mouse) (pPM-C-His)

PV204889 500 ng
EUR 603

NEK6 Protein Vector (Mouse) (pPB-C-His)

PV204890 500 ng
EUR 603

NEK6 Protein Vector (Mouse) (pPB-N-His)

PV204891 500 ng
EUR 603

NEK6 Protein Vector (Mouse) (pPM-C-HA)

PV204892 500 ng
EUR 603

NEK6 Protein Vector (Mouse) (pPM-C-His)

PV204893 500 ng
EUR 603

NEK6 Protein Vector (Rat) (pPB-C-His)

PV284898 500 ng
EUR 603

NEK6 Protein Vector (Rat) (pPB-N-His)

PV284899 500 ng
EUR 603

NEK6 Protein Vector (Rat) (pPM-C-HA)

PV284900 500 ng
EUR 603

NEK6 Protein Vector (Rat) (pPM-C-His)

PV284901 500 ng
EUR 603

NEK6 Protein Vector (Human) (pPB-C-His)

PV028089 500 ng
EUR 329

NEK6 Protein Vector (Human) (pPB-N-His)

PV028090 500 ng
EUR 329

NEK6 Protein Vector (Human) (pPM-C-HA)

PV028091 500 ng
EUR 329

NEK6 Protein Vector (Human) (pPM-C-His)

PV028092 500 ng
EUR 329

Nek6 3'UTR Luciferase Stable Cell Line

TU113990 1.0 ml Ask for price

Nek6 3'UTR GFP Stable Cell Line

TU163990 1.0 ml Ask for price

Nek6 3'UTR Luciferase Stable Cell Line

TU213886 1.0 ml Ask for price

Nek6 3'UTR GFP Stable Cell Line

TU263886 1.0 ml Ask for price

NEK6 3'UTR GFP Stable Cell Line

TU065574 1.0 ml
EUR 1521

NEK6 3'UTR Luciferase Stable Cell Line

TU015574 1.0 ml
EUR 1521

NEK6 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)

LV663463 1.0 ug DNA
EUR 514

NEK6 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)

LV663467 1.0 ug DNA
EUR 514

NEK6 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)

LV663468 1.0 ug DNA
EUR 514

GAPDH Rabbit Polyclonal Antibody

37985-100ul 100ul
EUR 252

GAPDH Rabbit Polyclonal Antibody

37985-50ul 50ul
EUR 187

EFHD1 Rabbit Polyclonal Antibody

38001-100ul 100ul
EUR 252

EFHD1 Rabbit Polyclonal Antibody

38001-50ul 50ul
EUR 187

Alliinase Rabbit Polyclonal Antibody

38042-100ul 100ul
EUR 252

Alliinase Rabbit Polyclonal Antibody

38042-50ul 50ul
EUR 187

ECFP Rabbit Polyclonal Antibody

38077-100ul 100ul
EUR 252

ECFP Rabbit Polyclonal Antibody

38077-50ul 50ul
EUR 187

EYFP Rabbit Polyclonal Antibody

38078-100ul 100ul
EUR 252

EYFP Rabbit Polyclonal Antibody

38078-50ul 50ul
EUR 187

mOrange Rabbit Polyclonal Antibody

38079-100ul 100ul
EUR 252

mOrange Rabbit Polyclonal Antibody

38079-50ul 50ul
EUR 187

mStrawberry Rabbit Polyclonal Antibody

38083-100ul 100ul
EUR 252

mStrawberry Rabbit Polyclonal Antibody

38083-50ul 50ul
EUR 187

AmCyan Rabbit Polyclonal Antibody

38086-100ul 100ul
EUR 252

AmCyan Rabbit Polyclonal Antibody

38086-50ul 50ul
EUR 187

EBFP Rabbit Polyclonal Antibody

38087-100ul 100ul
EUR 252

EBFP Rabbit Polyclonal Antibody

38087-50ul 50ul
EUR 187

Vimentin Rabbit Polyclonal Antibody

38104-100ul 100ul
EUR 252

Vimentin Rabbit Polyclonal Antibody

38104-50ul 50ul
EUR 187

LDHD Rabbit Polyclonal Antibody

38105-100ul 100ul
EUR 252

LDHD Rabbit Polyclonal Antibody

38105-50ul 50ul
EUR 187

GAPDH Rabbit Polyclonal Antibody

A01021-005ml 0.05ml
EUR 147
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

GAPDH Rabbit Polyclonal Antibody

A01021-02ml 0.2ml
EUR 332
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

GAPDH Rabbit Polyclonal Antibody

A01021-02ml5 0.2ml×5
EUR 920
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

NEK6 Rabbit Polyclonal Antibody