NEK6 Rabbit pAb |
A8481-100ul |
Abclonal |
100 ul |
EUR 308 |
NEK6 Rabbit pAb |
A8481-200ul |
Abclonal |
200 ul |
EUR 459 |
NEK6 Rabbit pAb |
A8481-20ul |
Abclonal |
20 ul |
EUR 183 |
NEK6 Rabbit pAb |
A8481-50ul |
Abclonal |
50 ul |
EUR 223 |
NEK6 antibody |
70R-18840 |
Fitzgerald |
50 ul |
EUR 435 |
Description: Rabbit polyclonal NEK6 antibody |
NEK6 antibody |
10R-4953 |
Fitzgerald |
100 ul |
EUR 726 |
Description: Mouse monoclonal NEK6 antibody |
NEK6 antibody |
10R-4954 |
Fitzgerald |
100 ul |
EUR 691 |
Description: Mouse monoclonal NEK6 antibody |
NEK6 antibody |
10R-4956 |
Fitzgerald |
100 ul |
EUR 691 |
Description: Mouse monoclonal NEK6 antibody |
NEK6 Antibody |
45255-100ul |
SAB |
100ul |
EUR 252 |
NEK6 Antibody |
45255-50ul |
SAB |
50ul |
EUR 187 |
NEK6 Antibody |
DF8259 |
Affbiotech |
200ul |
EUR 304 |
Description: NEK6 Antibody detects endogenous levels of total NEK6. |
NEK6 Antibody |
1-CSB-PA015704GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20oC, Avoid freeze / thaw cycles. Antigen Affinity Purified
|
Description: A polyclonal antibody against NEK6. Recognizes NEK6 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA |
NEK6 antibody |
70R-5777 |
Fitzgerald |
50 ug |
EUR 467 |
Description: Rabbit polyclonal NEK6 antibody |
NEK6 Antibody |
abx122675-100ug |
Abbexa |
100 ug |
EUR 391 |
- Shipped within 5-10 working days.
|
Polyclonal NEK6 Antibody (C-Terminus) |
APR02058G |
Leading Biology |
0.05mg |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human NEK6 (C-Terminus). This antibody is tested and proven to work in the following applications: |
Serine/threonine-Protein Kinase Nek6 (NEK6) Antibody |
20-abx005847 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
Serine/threonine-Protein Kinase Nek6 (NEK6) Antibody |
20-abx217109 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Serine/threonine-Protein Kinase Nek6 (NEK6) Antibody |
abx033855-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
Serine/threonine-Protein Kinase Nek6 (NEK6) Antibody |
abx033855-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
NEK6 Conjugated Antibody |
C45255 |
SAB |
100ul |
EUR 397 |
Anti-NEK6 antibody |
STJ110779 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: The protein encoded by this gene is a kinase required for progression through the metaphase portion of mitosis. Inhibition of the encoded protein can lead to apoptosis. This protein also can enhance tumorigenesis by suppressing tumor cell senescence. Several transcript variants encoding a few different isoforms have been found for this gene. |
Anti-NEK6 antibody |
STJ191367 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to NEK6 |
NEK6 protein |
30R-2831 |
Fitzgerald |
5 ug |
EUR 503 |
Description: Purified recombinant Human NEK6 protein |
NEK6 siRNA |
20-abx903526 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
NEK6 siRNA |
20-abx925722 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
NEK6 siRNA |
20-abx925723 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
anti-NEK6 |
YF-PA25669 |
Abfrontier |
50 ul |
EUR 334 |
Description: Mouse polyclonal to NEK6 |
NEK6 Blocking Peptide |
33R-3041 |
Fitzgerald |
100 ug |
EUR 180 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of NEK6 antibody, catalog no. 70R-5777 |
NEK6 Blocking Peptide |
DF8259-BP |
Affbiotech |
1mg |
EUR 195 |
NEK6 cloning plasmid |
CSB-CL872543HU-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 942
- Sequence: atggcaggacagcccggccacatgccccatggagggagttccaacaacctctgccacaccctggggcctgtgcatcctcctgacccacagaggcatcccaacacgctgtcttttcgctgctcgctggcggacttccagatcgaaaagaagataggccgaggacagttcagcgaggt
- Show more
|
Description: A cloning plasmid for the NEK6 gene. |
Anti-NEK6 (3B5) |
YF-MA17486 |
Abfrontier |
100 ug |
EUR 363 |
Description: Mouse monoclonal to NEK6 |
Anti-NEK6 (2A7) |
YF-MA17487 |
Abfrontier |
50 ug |
EUR 363 |
Description: Mouse monoclonal to NEK6 |
Anti-NEK6 (4B10) |
YF-MA17488 |
Abfrontier |
200 ul |
EUR 363 |
Description: Mouse monoclonal to NEK6 |
Porcine Serine/threonine- protein kinase Nek6, NEK6 ELISA KIT |
ELI-16455p |
Lifescience Market |
96 Tests |
EUR 928 |
Human Serine/threonine- protein kinase Nek6, NEK6 ELISA KIT |
ELI-23244h |
Lifescience Market |
96 Tests |
EUR 824 |
Mouse Serine/threonine- protein kinase Nek6, Nek6 ELISA KIT |
ELI-39577m |
Lifescience Market |
96 Tests |
EUR 865 |
Rat NEK6 shRNA Plasmid |
20-abx990026 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Mouse NEK6 shRNA Plasmid |
20-abx975188 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Human NEK6 shRNA Plasmid |
20-abx957348 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
h NEK6 Expression Lentivirus |
LVP1182 |
GenTarget |
1x107 IFU/ml x 200ul |
EUR 451 |
Description: Pre-made over-expression lentivirus for human target: NEK6, containing a RFP-Blasticidin dual selection marker. |
Nek6 ORF Vector (Rat) (pORF) |
ORF071225 |
ABM |
1.0 ug DNA |
EUR 506 |
h NEK6 inducible lentiviral particles |
LVP230 |
GenTarget |
1x107 IFU/ml x 200ul |
EUR 451 |
Description: Pre-made tet-inducible lentiviral particles expressing a human gene with a Blasticidin-RFP fusion marker (Dual selection). The expressed human gene, NEK6, is fully sequence verified and matched to NCBI accession ID: NM_014397.4 |
NEK6 ORF Vector (Human) (pORF) |
ORF007023 |
ABM |
1.0 ug DNA |
EUR 95 |
Nek6 ORF Vector (Mouse) (pORF) |
ORF051222 |
ABM |
1.0 ug DNA |
EUR 506 |
Nek6 ORF Vector (Mouse) (pORF) |
ORF051223 |
ABM |
1.0 ug DNA |
EUR 506 |
Nek6 sgRNA CRISPR Lentivector set (Mouse) |
K4956201 |
ABM |
3 x 1.0 ug |
EUR 339 |
Nek6 sgRNA CRISPR Lentivector set (Rat) |
K7399701 |
ABM |
3 x 1.0 ug |
EUR 339 |
NEK6 sgRNA CRISPR Lentivector set (Human) |
K1416801 |
ABM |
3 x 1.0 ug |
EUR 339 |
Nek6 sgRNA CRISPR Lentivector (Mouse) (Target 1) |
K4956202 |
ABM |
1.0 ug DNA |
EUR 154 |
Nek6 sgRNA CRISPR Lentivector (Mouse) (Target 2) |
K4956203 |
ABM |
1.0 ug DNA |
EUR 154 |
Nek6 sgRNA CRISPR Lentivector (Mouse) (Target 3) |
K4956204 |
ABM |
1.0 ug DNA |
EUR 154 |
Nek6 sgRNA CRISPR Lentivector (Rat) (Target 1) |
K7399702 |
ABM |
1.0 ug DNA |
EUR 154 |
Nek6 sgRNA CRISPR Lentivector (Rat) (Target 2) |
K7399703 |
ABM |
1.0 ug DNA |
EUR 154 |
Nek6 sgRNA CRISPR Lentivector (Rat) (Target 3) |
K7399704 |
ABM |
1.0 ug DNA |
EUR 154 |
NEK6 sgRNA CRISPR Lentivector (Human) (Target 1) |
K1416802 |
ABM |
1.0 ug DNA |
EUR 154 |
NEK6 sgRNA CRISPR Lentivector (Human) (Target 2) |
K1416803 |
ABM |
1.0 ug DNA |
EUR 154 |
NEK6 sgRNA CRISPR Lentivector (Human) (Target 3) |
K1416804 |
ABM |
1.0 ug DNA |
EUR 154 |
NEK6 Protein Vector (Mouse) (pPB-C-His) |
PV204886 |
ABM |
500 ng |
EUR 603 |
NEK6 Protein Vector (Mouse) (pPB-N-His) |
PV204887 |
ABM |
500 ng |
EUR 603 |
NEK6 Protein Vector (Mouse) (pPM-C-HA) |
PV204888 |
ABM |
500 ng |
EUR 603 |
NEK6 Protein Vector (Mouse) (pPM-C-His) |
PV204889 |
ABM |
500 ng |
EUR 603 |
NEK6 Protein Vector (Mouse) (pPB-C-His) |
PV204890 |
ABM |
500 ng |
EUR 603 |
NEK6 Protein Vector (Mouse) (pPB-N-His) |
PV204891 |
ABM |
500 ng |
EUR 603 |
NEK6 Protein Vector (Mouse) (pPM-C-HA) |
PV204892 |
ABM |
500 ng |
EUR 603 |
NEK6 Protein Vector (Mouse) (pPM-C-His) |
PV204893 |
ABM |
500 ng |
EUR 603 |
NEK6 Protein Vector (Rat) (pPB-C-His) |
PV284898 |
ABM |
500 ng |
EUR 603 |
NEK6 Protein Vector (Rat) (pPB-N-His) |
PV284899 |
ABM |
500 ng |
EUR 603 |
NEK6 Protein Vector (Rat) (pPM-C-HA) |
PV284900 |
ABM |
500 ng |
EUR 603 |
NEK6 Protein Vector (Rat) (pPM-C-His) |
PV284901 |
ABM |
500 ng |
EUR 603 |
NEK6 Protein Vector (Human) (pPB-C-His) |
PV028089 |
ABM |
500 ng |
EUR 329 |
NEK6 Protein Vector (Human) (pPB-N-His) |
PV028090 |
ABM |
500 ng |
EUR 329 |
NEK6 Protein Vector (Human) (pPM-C-HA) |
PV028091 |
ABM |
500 ng |
EUR 329 |
NEK6 Protein Vector (Human) (pPM-C-His) |
PV028092 |
ABM |
500 ng |
EUR 329 |
Nek6 3'UTR Luciferase Stable Cell Line |
TU113990 |
ABM |
1.0 ml |
Ask for price |
Nek6 3'UTR GFP Stable Cell Line |
TU163990 |
ABM |
1.0 ml |
Ask for price |
Nek6 3'UTR Luciferase Stable Cell Line |
TU213886 |
ABM |
1.0 ml |
Ask for price |
Nek6 3'UTR GFP Stable Cell Line |
TU263886 |
ABM |
1.0 ml |
Ask for price |
NEK6 3'UTR GFP Stable Cell Line |
TU065574 |
ABM |
1.0 ml |
EUR 1521 |
NEK6 3'UTR Luciferase Stable Cell Line |
TU015574 |
ABM |
1.0 ml |
EUR 1521 |
NEK6 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV) |
LV663463 |
ABM |
1.0 ug DNA |
EUR 514 |
NEK6 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC) |
LV663467 |
ABM |
1.0 ug DNA |
EUR 514 |
NEK6 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a) |
LV663468 |
ABM |
1.0 ug DNA |
EUR 514 |
GAPDH Rabbit Polyclonal Antibody |
37985-100ul |
SAB |
100ul |
EUR 252 |
GAPDH Rabbit Polyclonal Antibody |
37985-50ul |
SAB |
50ul |
EUR 187 |
EFHD1 Rabbit Polyclonal Antibody |
38001-100ul |
SAB |
100ul |
EUR 252 |
EFHD1 Rabbit Polyclonal Antibody |
38001-50ul |
SAB |
50ul |
EUR 187 |
Alliinase Rabbit Polyclonal Antibody |
38042-100ul |
SAB |
100ul |
EUR 252 |
Alliinase Rabbit Polyclonal Antibody |
38042-50ul |
SAB |
50ul |
EUR 187 |
ECFP Rabbit Polyclonal Antibody |
38077-100ul |
SAB |
100ul |
EUR 252 |
ECFP Rabbit Polyclonal Antibody |
38077-50ul |
SAB |
50ul |
EUR 187 |
EYFP Rabbit Polyclonal Antibody |
38078-100ul |
SAB |
100ul |
EUR 252 |
EYFP Rabbit Polyclonal Antibody |
38078-50ul |
SAB |
50ul |
EUR 187 |
mOrange Rabbit Polyclonal Antibody |
38079-100ul |
SAB |
100ul |
EUR 252 |
mOrange Rabbit Polyclonal Antibody |
38079-50ul |
SAB |
50ul |
EUR 187 |
mStrawberry Rabbit Polyclonal Antibody |
38083-100ul |
SAB |
100ul |
EUR 252 |
mStrawberry Rabbit Polyclonal Antibody |
38083-50ul |
SAB |
50ul |
EUR 187 |
AmCyan Rabbit Polyclonal Antibody |
38086-100ul |
SAB |
100ul |
EUR 252 |
AmCyan Rabbit Polyclonal Antibody |
38086-50ul |
SAB |
50ul |
EUR 187 |
EBFP Rabbit Polyclonal Antibody |
38087-100ul |
SAB |
100ul |
EUR 252 |
EBFP Rabbit Polyclonal Antibody |
38087-50ul |
SAB |
50ul |
EUR 187 |
Vimentin Rabbit Polyclonal Antibody |
38104-100ul |
SAB |
100ul |
EUR 252 |
Vimentin Rabbit Polyclonal Antibody |
38104-50ul |
SAB |
50ul |
EUR 187 |
LDHD Rabbit Polyclonal Antibody |
38105-100ul |
SAB |
100ul |
EUR 252 |
LDHD Rabbit Polyclonal Antibody |
38105-50ul |
SAB |
50ul |
EUR 187 |
GAPDH Rabbit Polyclonal Antibody |
A01021-005ml |
Abbkine |
0.05ml |
EUR 147 |
- Immunogen information: Recombinant Protein
- Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
- Show more
|
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein |
GAPDH Rabbit Polyclonal Antibody |
A01021-02ml |
Abbkine |
0.2ml |
EUR 332 |
- Immunogen information: Recombinant Protein
- Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
- Show more
|
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein |
GAPDH Rabbit Polyclonal Antibody |
A01021-02ml5 |
Abbkine |
0.2ml×5 |
EUR 920 |
- Immunogen information: Recombinant Protein
- Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
- Show more
|
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein |
NEK6 Rabbit Polyclonal Antibody