NGDN Rabbit Polyclonal Antibody

NGDN Polyclonal Antibody
28614-50ul	SAB	50ul	EUR 187

NGDN Polyclonal Antibody
ABP59460-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Synthesized peptide derived from part region of human NGDN protein at amino acid sequence of 240-320 Applications tips:
Description: A polyclonal antibody for detection of NGDN from Human, Mouse. This NGDN antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human NGDN protein at amino acid sequence of 240-320

NGDN Polyclonal Antibody
ABP59460-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Synthesized peptide derived from part region of human NGDN protein at amino acid sequence of 240-320 Applications tips:
Description: A polyclonal antibody for detection of NGDN from Human, Mouse. This NGDN antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human NGDN protein at amino acid sequence of 240-320

NGDN Polyclonal Antibody
ABP59460-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Synthesized peptide derived from part region of human NGDN protein at amino acid sequence of 240-320 Applications tips:
Description: A polyclonal antibody for detection of NGDN from Human, Mouse. This NGDN antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human NGDN protein at amino acid sequence of 240-320

NGDN Polyclonal Antibody
ES9910-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against NGDN from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

NGDN Polyclonal Antibody
ES9910-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against NGDN from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

NGDN Rabbit pAb
A14509-100ul	Abclonal	100 ul	EUR 308

NGDN Rabbit pAb
A14509-200ul	Abclonal	200 ul	EUR 459

NGDN Rabbit pAb
A14509-20ul	Abclonal	20 ul	EUR 183

NGDN Rabbit pAb
A14509-50ul	Abclonal	50 ul	EUR 223

NGDN Rabbit pAb
A14546-100ul	Abclonal	100 ul	EUR 308

NGDN Rabbit pAb
A14546-200ul	Abclonal	200 ul	EUR 459

NGDN Rabbit pAb
A14546-20ul	Abclonal	20 ul	EUR 183

NGDN Rabbit pAb
A14546-50ul	Abclonal	50 ul	EUR 223

NGDN Polyclonal Conjugated Antibody
C28607	SAB	100ul	EUR 397

NGDN Polyclonal Conjugated Antibody
C28614	SAB	100ul	EUR 397

NGDN antibody
70R-18869	Fitzgerald	50 ul	EUR 435
Description: Rabbit polyclonal NGDN antibody

NGDN Antibody
1-CSB-PA015777GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against NGDN. Recognizes NGDN from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF

Neuroguidin (NGDN) Antibody
abx028395-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

Neuroguidin (NGDN) Antibody
abx028395-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

Neuroguidin (NGDN) Antibody
abx235719-100ug	Abbexa	100 ug	EUR 481
Shipped within 5-12 working days.

anti- NGDN antibody
FNab05719	FN Test	100µg	EUR 505.25
Immunogen: neuroguidin, EIF4E binding protein Uniprot ID: Q8NEJ9 Gene ID: 25983 Research Area: Epigenetics
Description: Antibody raised against NGDN

Anti-NGDN antibody
PAab05719	Lifescience Market	100 ug	EUR 355

Anti-NGDN antibody
STJ116720	St John's Laboratory	100 µl	EUR 277

Anti-NGDN antibody
STJ116757	St John's Laboratory	100 µl	EUR 277

Anti-NGDN antibody
STJ191068	St John's Laboratory	200 µl	EUR 197
Description: Unconjugated Rabbit polyclonal to NGDN

NGDN siRNA
20-abx925858	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

NGDN siRNA
20-abx925859	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

NGDN cloning plasmid
CSB-CL822772HU-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 948 Sequence: atggcggcgctgggggtgctggagtccgacctgccaagtgccgtgacacttctgaaaaatctccaggagcaagtgatggctgtaactgcacaagtgaaatcactgacacaaaaagttcaagctggtgcctatcctacagaaaagggtctcagcttcttggaagtgaaagaccagct Show more
Description: A cloning plasmid for the NGDN gene.

NGDN ELISA KIT|Human
EF001218	Lifescience Market	96 Tests	EUR 689

Mouse NGDN shRNA Plasmid
20-abx976801	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Human NGDN shRNA Plasmid
20-abx958633	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

NGDN Recombinant Protein (Human)
RP021184	ABM	100 ug	Ask for price

NGDN Recombinant Protein (Mouse)
RP154010	ABM	100 ug	Ask for price

NGDN Recombinant Protein (Rat)
RP213872	ABM	100 ug	Ask for price

Bovine Neuroguidin, NGDN ELISA KIT
ELI-13243b	Lifescience Market	96 Tests	EUR 928

Mouse Neuroguidin (NGDN) ELISA Kit
abx390020-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Human Neuroguidin, NGDN ELISA KIT
ELI-35339h	Lifescience Market	96 Tests	EUR 824

Mouse Neuroguidin, Ngdn ELISA KIT
ELI-36514m	Lifescience Market	96 Tests	EUR 865

NGDN Rabbit Polyclonal Antibody