NGDN Rabbit Polyclonal Antibody

NGDN Polyclonal Antibody

28614-50ul 50ul
EUR 187

NGDN Polyclonal Antibody

ABP59460-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human NGDN protein at amino acid sequence of 240-320
  • Applications tips:
Description: A polyclonal antibody for detection of NGDN from Human, Mouse. This NGDN antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human NGDN protein at amino acid sequence of 240-320

NGDN Polyclonal Antibody

ABP59460-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human NGDN protein at amino acid sequence of 240-320
  • Applications tips:
Description: A polyclonal antibody for detection of NGDN from Human, Mouse. This NGDN antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human NGDN protein at amino acid sequence of 240-320

NGDN Polyclonal Antibody

ABP59460-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human NGDN protein at amino acid sequence of 240-320
  • Applications tips:
Description: A polyclonal antibody for detection of NGDN from Human, Mouse. This NGDN antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human NGDN protein at amino acid sequence of 240-320

NGDN Polyclonal Antibody

ES9910-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NGDN from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

NGDN Polyclonal Antibody

ES9910-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NGDN from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

NGDN Rabbit pAb

A14509-100ul 100 ul
EUR 308

NGDN Rabbit pAb

A14509-200ul 200 ul
EUR 459

NGDN Rabbit pAb

A14509-20ul 20 ul
EUR 183

NGDN Rabbit pAb

A14509-50ul 50 ul
EUR 223

NGDN Rabbit pAb

A14546-100ul 100 ul
EUR 308

NGDN Rabbit pAb

A14546-200ul 200 ul
EUR 459

NGDN Rabbit pAb

A14546-20ul 20 ul
EUR 183

NGDN Rabbit pAb

A14546-50ul 50 ul
EUR 223

NGDN Polyclonal Conjugated Antibody

C28607 100ul
EUR 397

NGDN Polyclonal Conjugated Antibody

C28614 100ul
EUR 397

NGDN antibody

70R-18869 50 ul
EUR 435
Description: Rabbit polyclonal NGDN antibody

NGDN Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against NGDN. Recognizes NGDN from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF

Neuroguidin (NGDN) Antibody

abx028395-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Neuroguidin (NGDN) Antibody

abx028395-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Neuroguidin (NGDN) Antibody

abx235719-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

anti- NGDN antibody

FNab05719 100µg
EUR 505.25
  • Immunogen: neuroguidin, EIF4E binding protein
  • Uniprot ID: Q8NEJ9
  • Gene ID: 25983
  • Research Area: Epigenetics
Description: Antibody raised against NGDN

Anti-NGDN antibody

PAab05719 100 ug
EUR 355

Anti-NGDN antibody

STJ116720 100 µl
EUR 277

Anti-NGDN antibody

STJ116757 100 µl
EUR 277

Anti-NGDN antibody

STJ191068 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to NGDN


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

NGDN cloning plasmid

CSB-CL822772HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 948
  • Sequence: atggcggcgctgggggtgctggagtccgacctgccaagtgccgtgacacttctgaaaaatctccaggagcaagtgatggctgtaactgcacaagtgaaatcactgacacaaaaagttcaagctggtgcctatcctacagaaaagggtctcagcttcttggaagtgaaagaccagct
  • Show more
Description: A cloning plasmid for the NGDN gene.


EF001218 96 Tests
EUR 689

Mouse NGDN shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human NGDN shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

NGDN Recombinant Protein (Human)

RP021184 100 ug Ask for price

NGDN Recombinant Protein (Mouse)

RP154010 100 ug Ask for price

NGDN Recombinant Protein (Rat)

RP213872 100 ug Ask for price

Bovine Neuroguidin, NGDN ELISA KIT

ELI-13243b 96 Tests
EUR 928

Mouse Neuroguidin (NGDN) ELISA Kit

abx390020-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Human Neuroguidin, NGDN ELISA KIT

ELI-35339h 96 Tests
EUR 824

Mouse Neuroguidin, Ngdn ELISA KIT

ELI-36514m 96 Tests
EUR 865

NGDN Rabbit Polyclonal Antibody