NID2 Polyclonal Antibody |
ABP59465-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human NID2 protein at amino acid sequence of 700-780
- Applications tips:
|
Description: A polyclonal antibody for detection of NID2 from Human. This NID2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human NID2 protein at amino acid sequence of 700-780 |
Human Nidogen 2 (NID2) ELISA Kit |
DLR-NID2-Hu-48T |
DL Develop |
48T |
EUR 517 |
- Should the Human Nidogen 2 (NID2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Nidogen 2 (NID2) in samples from serum, plasma or other biological fluids. |
Human Nidogen 2 (NID2) ELISA Kit |
DLR-NID2-Hu-96T |
DL Develop |
96T |
EUR 673 |
- Should the Human Nidogen 2 (NID2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Nidogen 2 (NID2) in samples from serum, plasma or other biological fluids. |
Rat Nidogen 2 (NID2) ELISA Kit |
DLR-NID2-Ra-48T |
DL Develop |
48T |
EUR 549 |
- Should the Rat Nidogen 2 (NID2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Rat Nidogen 2 (NID2) in samples from serum, plasma or other biological fluids. |
Rat Nidogen 2 (NID2) ELISA Kit |
DLR-NID2-Ra-96T |
DL Develop |
96T |
EUR 718 |
- Should the Rat Nidogen 2 (NID2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Rat Nidogen 2 (NID2) in samples from serum, plasma or other biological fluids. |
Human Nidogen 2 (NID2) ELISA Kit |
RD-NID2-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 521 |
Human Nidogen 2 (NID2) ELISA Kit |
RD-NID2-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 723 |
Rat Nidogen 2 (NID2) ELISA Kit |
RD-NID2-Ra-48Tests |
Reddot Biotech |
48 Tests |
EUR 557 |
Rat Nidogen 2 (NID2) ELISA Kit |
RD-NID2-Ra-96Tests |
Reddot Biotech |
96 Tests |
EUR 775 |
Human Nidogen 2 (NID2) ELISA Kit |
RDR-NID2-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 544 |
Human Nidogen 2 (NID2) ELISA Kit |
RDR-NID2-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 756 |
Rat Nidogen 2 (NID2) ELISA Kit |
RDR-NID2-Ra-48Tests |
Reddot Biotech |
48 Tests |
EUR 583 |
Rat Nidogen 2 (NID2) ELISA Kit |
RDR-NID2-Ra-96Tests |
Reddot Biotech |
96 Tests |
EUR 811 |
NID2 antibody |
70R-6064 |
Fitzgerald |
50 ug |
EUR 467 |
Description: Rabbit polyclonal NID2 antibody |
NID2 Antibody |
46097-100ul |
SAB |
100ul |
EUR 252 |
NID2 Antibody |
46097-50ul |
SAB |
50ul |
EUR 187 |
NID2 antibody |
70R-18878 |
Fitzgerald |
50 ul |
EUR 435 |
Description: Rabbit polyclonal NID2 antibody |
NID2 Antibody |
DF9704 |
Affbiotech |
200ul |
EUR 304 |
Description: NID2 Antibody detects endogenous levels of total NID2. |
NID2 Antibody |
1-CSB-PA015803GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
|
Description: A polyclonal antibody against NID2. Recognizes NID2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC |
Nidogen 2 (NID2) Polyclonal Antibody (Human) |
4-PAF416Hu01 |
Cloud-Clone |
-
EUR 247.00
-
EUR 2510.00
-
EUR 625.00
-
EUR 310.00
-
EUR 214.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: NID2 (Leu31~Ala289)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Nidogen 2 (NID2) |
NID2 Conjugated Antibody |
C46097 |
SAB |
100ul |
EUR 397 |
Anti-NID2 antibody |
STJ191085 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to NID2 |
Nidogen 2 (NID2) Polyclonal Antibody (Human), APC |
4-PAF416Hu01-APC |
Cloud-Clone |
-
EUR 345.00
-
EUR 3275.00
-
EUR 912.00
-
EUR 440.00
-
EUR 219.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: NID2 (Leu31~Ala289)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Nidogen 2 (NID2). This antibody is labeled with APC. |
Nidogen 2 (NID2) Polyclonal Antibody (Human), Biotinylated |
4-PAF416Hu01-Biotin |
Cloud-Clone |
-
EUR 311.00
-
EUR 2460.00
-
EUR 727.00
-
EUR 381.00
-
EUR 219.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: NID2 (Leu31~Ala289)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Nidogen 2 (NID2). This antibody is labeled with Biotin. |
Nidogen 2 (NID2) Polyclonal Antibody (Human), Cy3 |
4-PAF416Hu01-Cy3 |
Cloud-Clone |
-
EUR 419.00
-
EUR 4325.00
-
EUR 1175.00
-
EUR 545.00
-
EUR 251.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: NID2 (Leu31~Ala289)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Nidogen 2 (NID2). This antibody is labeled with Cy3. |
Nidogen 2 (NID2) Polyclonal Antibody (Human), FITC |
4-PAF416Hu01-FITC |
Cloud-Clone |
-
EUR 296.00
-
EUR 2640.00
-
EUR 750.00
-
EUR 372.00
-
EUR 195.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: NID2 (Leu31~Ala289)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Nidogen 2 (NID2). This antibody is labeled with FITC. |
Nidogen 2 (NID2) Polyclonal Antibody (Human), HRP |
4-PAF416Hu01-HRP |
Cloud-Clone |
-
EUR 316.00
-
EUR 2855.00
-
EUR 807.00
-
EUR 398.00
-
EUR 206.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: NID2 (Leu31~Ala289)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Nidogen 2 (NID2). This antibody is labeled with HRP. |
Nidogen 2 (NID2) Polyclonal Antibody (Human), PE |
4-PAF416Hu01-PE |
Cloud-Clone |
-
EUR 296.00
-
EUR 2640.00
-
EUR 750.00
-
EUR 372.00
-
EUR 195.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: NID2 (Leu31~Ala289)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Nidogen 2 (NID2). This antibody is labeled with PE. |
NID2 siRNA |
20-abx903561 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
NID2 siRNA |
20-abx925899 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
NID2 siRNA |
20-abx925900 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Nidogen 2 (NID2) Antibody |
20-abx128335 |
Abbexa |
-
EUR 425.00
-
EUR 133.00
-
EUR 1205.00
-
EUR 578.00
-
EUR 328.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Nidogen 2 (NID2) Antibody |
20-abx121180 |
Abbexa |
-
EUR 300.00
-
EUR 439.00
-
EUR 189.00
|
|
- Shipped within 5-10 working days.
|
Nidogen 2 (NID2) Antibody |
abx022770-20ul |
Abbexa |
20 ul |
EUR 398 |
- Shipped within 5-10 working days.
|
Nidogen 2 (NID2) Antibody |
20-abx173827 |
Abbexa |
|
|
|
Nidogen 2 (NID2) Antibody |
20-abx173828 |
Abbexa |
|
|
|
Nidogen 2 (NID2) Antibody |
20-abx177809 |
Abbexa |
|
|
|
Nidogen 2 (NID2) Antibody |
abx235730-100ug |
Abbexa |
100 ug |
EUR 481 |
- Shipped within 5-12 working days.
|
Nidogen 2 (NID2) Antibody |
abx235731-100ug |
Abbexa |
100 ug |
EUR 481 |
- Shipped within 5-12 working days.
|
Nidogen 2 (NID2) Polyclonal Antibody (Human), APC-Cy7 |
4-PAF416Hu01-APC-Cy7 |
Cloud-Clone |
-
EUR 571.00
-
EUR 6430.00
-
EUR 1705.00
-
EUR 760.00
-
EUR 319.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: NID2 (Leu31~Ala289)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Nidogen 2 (NID2). This antibody is labeled with APC-Cy7. |
NID2 cloning plasmid |
CSB-CL614513HU-10ug |
Cusabio |
10ug |
EUR 558 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 2910
- Sequence: atggagggggaccgggtggccgggcggccggtgctgtcgtcgttaccagtgctactgctgctgcagttgctaatgttgcgggccgcggcgctgcacccagacgagctcttcccacacggggagtcgtggggggaccagctcctgcaggaaggcgacgacgaaagctcagccgtgg
- Show more
|
Description: A cloning plasmid for the NID2 gene. |
NID2 Blocking Peptide |
33R-1881 |
Fitzgerald |
100 ug |
EUR 180 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of NID2 antibody, catalog no. 70R-6064 |
NID2 Blocking Peptide |
DF9704-BP |
Affbiotech |
1mg |
EUR 195 |
Nidogen 2/Osteonidogen (NID2) Antibody |
abx146312-100ug |
Abbexa |
100 ug |
EUR 391 |
- Shipped within 5-10 working days.
|
Nidogen 2 / Osteonidogen (NID2) Antibody |
20-abx217171 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Rat NID2 shRNA Plasmid |
20-abx989144 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Human NID2 shRNA Plasmid |
20-abx957775 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Mouse NID2 shRNA Plasmid |
20-abx971748 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Recombinant Nidogen 2 (NID2) |
4-RPF416Hu01 |
Cloud-Clone |
-
EUR 458.40
-
EUR 226.00
-
EUR 1444.00
-
EUR 548.00
-
EUR 996.00
-
EUR 370.00
-
EUR 3460.00
|
-
100 ug
-
10ug
-
1 mg
-
200 ug
-
500 ug
-
50ug
-
5 mg
|
- Uniprot ID: Q14112
- Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 32.1kDa
- Isoelectric Point: Inquire
|
Description: Recombinant Human Nidogen 2 expressed in: E.coli |
Rat Nidogen 2 (NID2) Protein |
20-abx654562 |
Abbexa |
-
EUR 578.00
-
EUR 258.00
-
EUR 1720.00
-
EUR 690.00
-
EUR 425.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-15 working days.
|
Human Nidogen 2 (NID2) Protein |
20-abx166530 |
Abbexa |
-
EUR 648.00
-
EUR 272.00
-
EUR 1943.00
-
EUR 759.00
-
EUR 467.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
NID2 ORF Vector (Human) (pORF) |
ORF007075 |
ABM |
1.0 ug DNA |
EUR 95 |
Nid2 ORF Vector (Rat) (pORF) |
ORF071309 |
ABM |
1.0 ug DNA |
EUR 2080 |
Nid2 ORF Vector (Mouse) (pORF) |
ORF051368 |
ABM |
1.0 ug DNA |
EUR 1572 |
NID2 Rabbit Polyclonal Antibody