Biocat Net

Amine biocat 3.0

NID2 Rabbit Polyclonal Antibody

NID2 Polyclonal Antibody

ABP59465-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human NID2 protein at amino acid sequence of 700-780
  • Applications tips:
Description: A polyclonal antibody for detection of NID2 from Human. This NID2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human NID2 protein at amino acid sequence of 700-780

Human Nidogen 2 (NID2) ELISA Kit

DLR-NID2-Hu-48T 48T
EUR 517
  • Should the Human Nidogen 2 (NID2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Nidogen 2 (NID2) in samples from serum, plasma or other biological fluids.

Human Nidogen 2 (NID2) ELISA Kit

DLR-NID2-Hu-96T 96T
EUR 673
  • Should the Human Nidogen 2 (NID2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Nidogen 2 (NID2) in samples from serum, plasma or other biological fluids.

Rat Nidogen 2 (NID2) ELISA Kit

DLR-NID2-Ra-48T 48T
EUR 549
  • Should the Rat Nidogen 2 (NID2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Nidogen 2 (NID2) in samples from serum, plasma or other biological fluids.

Rat Nidogen 2 (NID2) ELISA Kit

DLR-NID2-Ra-96T 96T
EUR 718
  • Should the Rat Nidogen 2 (NID2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Nidogen 2 (NID2) in samples from serum, plasma or other biological fluids.

Human Nidogen 2 (NID2) ELISA Kit

RD-NID2-Hu-48Tests 48 Tests
EUR 521

Human Nidogen 2 (NID2) ELISA Kit

RD-NID2-Hu-96Tests 96 Tests
EUR 723

Rat Nidogen 2 (NID2) ELISA Kit

RD-NID2-Ra-48Tests 48 Tests
EUR 557

Rat Nidogen 2 (NID2) ELISA Kit

RD-NID2-Ra-96Tests 96 Tests
EUR 775

Human Nidogen 2 (NID2) ELISA Kit

RDR-NID2-Hu-48Tests 48 Tests
EUR 544

Human Nidogen 2 (NID2) ELISA Kit

RDR-NID2-Hu-96Tests 96 Tests
EUR 756

Rat Nidogen 2 (NID2) ELISA Kit

RDR-NID2-Ra-48Tests 48 Tests
EUR 583

Rat Nidogen 2 (NID2) ELISA Kit

RDR-NID2-Ra-96Tests 96 Tests
EUR 811

NID2 Antibody

ABD9704 100 ug
EUR 438

NID2 antibody

70R-6064 50 ug
EUR 467
Description: Rabbit polyclonal NID2 antibody

NID2 Antibody

46097-100ul 100ul
EUR 252

NID2 Antibody

46097-50ul 50ul
EUR 187

NID2 antibody

70R-18878 50 ul
EUR 435
Description: Rabbit polyclonal NID2 antibody

NID2 Antibody

DF9704 200ul
EUR 304
Description: NID2 Antibody detects endogenous levels of total NID2.

NID2 Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against NID2. Recognizes NID2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

Nidogen 2 (NID2) Polyclonal Antibody (Human)

  • EUR 247.00
  • EUR 2510.00
  • EUR 625.00
  • EUR 310.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: NID2 (Leu31~Ala289)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Nidogen 2 (NID2)

NID2 Conjugated Antibody

C46097 100ul
EUR 397

Anti-NID2 antibody

STJ191085 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to NID2

Nidogen 2 (NID2) Polyclonal Antibody (Human), APC

  • EUR 345.00
  • EUR 3275.00
  • EUR 912.00
  • EUR 440.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: NID2 (Leu31~Ala289)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Nidogen 2 (NID2). This antibody is labeled with APC.

Nidogen 2 (NID2) Polyclonal Antibody (Human), Biotinylated

  • EUR 311.00
  • EUR 2460.00
  • EUR 727.00
  • EUR 381.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: NID2 (Leu31~Ala289)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Nidogen 2 (NID2). This antibody is labeled with Biotin.

Nidogen 2 (NID2) Polyclonal Antibody (Human), Cy3

  • EUR 419.00
  • EUR 4325.00
  • EUR 1175.00
  • EUR 545.00
  • EUR 251.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: NID2 (Leu31~Ala289)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Nidogen 2 (NID2). This antibody is labeled with Cy3.

Nidogen 2 (NID2) Polyclonal Antibody (Human), FITC

  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: NID2 (Leu31~Ala289)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Nidogen 2 (NID2). This antibody is labeled with FITC.

Nidogen 2 (NID2) Polyclonal Antibody (Human), HRP

  • EUR 316.00
  • EUR 2855.00
  • EUR 807.00
  • EUR 398.00
  • EUR 206.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: NID2 (Leu31~Ala289)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Nidogen 2 (NID2). This antibody is labeled with HRP.

Nidogen 2 (NID2) Polyclonal Antibody (Human), PE

  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: NID2 (Leu31~Ala289)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Nidogen 2 (NID2). This antibody is labeled with PE.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

Nidogen 2 (NID2) Antibody

  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Nidogen 2 (NID2) Antibody

  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

Nidogen 2 (NID2) Antibody

abx022770-20ul 20 ul
EUR 398
  • Shipped within 5-10 working days.

Nidogen 2 (NID2) Antibody

  • EUR 857.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.

Nidogen 2 (NID2) Antibody

  • EUR 913.00
  • EUR 467.00
  • 1 mg
  • 200 ug
  • Please enquire.

Nidogen 2 (NID2) Antibody

  • EUR 1302.00
  • EUR 620.00
  • 1 mg
  • 200 ug
  • Please enquire.

Nidogen 2 (NID2) Antibody

abx235730-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

Nidogen 2 (NID2) Antibody

abx235731-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

Nidogen 2 (NID2) Polyclonal Antibody (Human), APC-Cy7

  • EUR 571.00
  • EUR 6430.00
  • EUR 1705.00
  • EUR 760.00
  • EUR 319.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: NID2 (Leu31~Ala289)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Nidogen 2 (NID2). This antibody is labeled with APC-Cy7.

NID2 cloning plasmid

CSB-CL614513HU-10ug 10ug
EUR 558
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2910
  • Sequence: atggagggggaccgggtggccgggcggccggtgctgtcgtcgttaccagtgctactgctgctgcagttgctaatgttgcgggccgcggcgctgcacccagacgagctcttcccacacggggagtcgtggggggaccagctcctgcaggaaggcgacgacgaaagctcagccgtgg
  • Show more
Description: A cloning plasmid for the NID2 gene.

NID2 Blocking Peptide

33R-1881 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of NID2 antibody, catalog no. 70R-6064

NID2 Blocking Peptide

DF9704-BP 1mg
EUR 195

Nidogen 2/Osteonidogen (NID2) Antibody

abx146312-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Nidogen 2 / Osteonidogen (NID2) Antibody

  • EUR 425.00
  • EUR 342.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Rat NID2 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human NID2 ELISA Kit

ELA-E0383h 96 Tests
EUR 824

Human NID2 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse NID2 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Recombinant Nidogen 2 (NID2)

  • EUR 458.40
  • EUR 226.00
  • EUR 1444.00
  • EUR 548.00
  • EUR 996.00
  • EUR 370.00
  • EUR 3460.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q14112
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 32.1kDa
  • Isoelectric Point: Inquire
Description: Recombinant Human Nidogen 2 expressed in: E.coli

Rat Nidogen 2 (NID2) Protein

  • EUR 578.00
  • EUR 258.00
  • EUR 1720.00
  • EUR 690.00
  • EUR 425.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Human Nidogen 2 (NID2) Protein

  • EUR 648.00
  • EUR 272.00
  • EUR 1943.00
  • EUR 759.00
  • EUR 467.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

NID2 ORF Vector (Human) (pORF)

ORF007075 1.0 ug DNA
EUR 95

Nid2 ORF Vector (Rat) (pORF)

ORF071309 1.0 ug DNA
EUR 2080

Nid2 ORF Vector (Mouse) (pORF)

ORF051368 1.0 ug DNA
EUR 1572

NID2 Rabbit Polyclonal Antibody