NIPBL Rabbit Polyclonal Antibody

NIPBL Polyclonal Conjugated Antibody
C31986	SAB	100ul	EUR 397

NIPBL antibody
70R-18882	Fitzgerald	50 ul	EUR 435
Description: Rabbit polyclonal NIPBL antibody

NIPBL antibody
31986-100ul	SAB	100ul	EUR 252

NIPBL antibody
31986-50ul	SAB	50ul	EUR 187

NIPBL Antibody
1-CSB-PA750379LA01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against NIPBL. Recognizes NIPBL from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:500-1:5000, IHC:1:20-1:200

NIPBL Antibody
1-CSB-PA015817GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against NIPBL. Recognizes NIPBL from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

NIPBL, Cohesin Loading Factor (NIPBL) Antibody
abx235737-100ug	Abbexa	100 ug	EUR 509
Shipped within 5-12 working days.

NIPBL, Cohesin Loading Factor (NIPBL) Antibody
abx432139-200ul	Abbexa	200 ul	EUR 384
Shipped within 1-3 working days.

NIPBL, Cohesin Loading Factor (NIPBL) Antibody
20-abx302537	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

NIPBL, Cohesin Loading Factor (NIPBL) Antibody (HRP)
20-abx316309	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

NIPBL, Cohesin Loading Factor (NIPBL) Antibody (FITC)
20-abx316310	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

NIPBL, Cohesin Loading Factor (NIPBL) Antibody (Biotin)
20-abx316311	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

anti- NIPBL antibody
FNab05737	FN Test	100µg	EUR 548.75
Immunogen: Nipped-B homolog(Drosophila) Uniprot ID: Q6KC79 Gene ID: 25836 Research Area: Metabolism
Description: Antibody raised against NIPBL

Anti-NIPBL antibody
PAab05737	Lifescience Market	100 ug	EUR 386

Anti-NIPBL antibody
STJ191086	St John's Laboratory	200 µl	EUR 197
Description: Unconjugated Rabbit polyclonal to NIPBL

NIPBL siRNA
20-abx925929	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

NIPBL siRNA
20-abx925930	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

NIPBL Antibody, HRP conjugated
1-CSB-PA750379LB01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against NIPBL. Recognizes NIPBL from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

NIPBL Antibody, FITC conjugated
1-CSB-PA750379LC01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against NIPBL. Recognizes NIPBL from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

NIPBL Antibody, Biotin conjugated
1-CSB-PA750379LD01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against NIPBL. Recognizes NIPBL from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Human NIPBL, Cohesin Loading Factor (NIPBL) ELISA Kit
abx381806-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

NIPBL cloning plasmid
CSB-CL750379HU-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 528 Sequence: atgaaatgtttgccagaaaattcagctcctttaatcgaatttgcaaatgtgtcccagggtattttattacttctcatgttaaaacaacatttgaagaatctttgtggattttctgatagtaaaattcagaagtactctccatctgaatctgcaaaagtatatgataaagcgataaa Show more
Description: A cloning plasmid for the NIPBL gene.

Anti-NIPBL (aa889-902) antibody
STJ72250	St John's Laboratory	100 µg	EUR 359

NIPBL ELISA KIT|Human
EF001234	Lifescience Market	96 Tests	EUR 689

Mouse NIPBL shRNA Plasmid
20-abx977367	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Human NIPBL shRNA Plasmid
20-abx958532	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

NIPBL ORF Vector (Human) (pORF)
ORF007085	ABM	1.0 ug DNA	EUR 95

Nipbl ORF Vector (Mouse) (pORF)
ORF051387	ABM	1.0 ug DNA	EUR 3033

Nipbl ORF Vector (Mouse) (pORF)
ORF051388	ABM	1.0 ug DNA	EUR 2918

Nipbl sgRNA CRISPR Lentivector set (Mouse)
K4529901	ABM	3 x 1.0 ug	EUR 339

NIPBL sgRNA CRISPR Lentivector set (Human)
K1428601	ABM	3 x 1.0 ug	EUR 339

Nipbl sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4529902	ABM	1.0 ug DNA	EUR 154

Nipbl sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4529903	ABM	1.0 ug DNA	EUR 154

Nipbl sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4529904	ABM	1.0 ug DNA	EUR 154

NIPBL sgRNA CRISPR Lentivector (Human) (Target 1)
K1428602	ABM	1.0 ug DNA	EUR 154

NIPBL sgRNA CRISPR Lentivector (Human) (Target 2)
K1428603	ABM	1.0 ug DNA	EUR 154

NIPBL sgRNA CRISPR Lentivector (Human) (Target 3)
K1428604	ABM	1.0 ug DNA	EUR 154

NIPBL Protein Vector (Mouse) (pPB-C-His)
PV205546	ABM	500 ng	EUR 4514

NIPBL Protein Vector (Mouse) (pPB-N-His)
PV205547	ABM	500 ng	EUR 4514

NIPBL Protein Vector (Mouse) (pPM-C-HA)
PV205548	ABM	500 ng	EUR 4514

NIPBL Protein Vector (Mouse) (pPM-C-His)
PV205549	ABM	500 ng	EUR 4514

NIPBL Protein Vector (Mouse) (pPB-C-His)
PV205550	ABM	500 ng	EUR 4351

NIPBL Protein Vector (Mouse) (pPB-N-His)
PV205551	ABM	500 ng	EUR 4351

NIPBL Protein Vector (Mouse) (pPM-C-HA)
PV205552	ABM	500 ng	EUR 4351

NIPBL Protein Vector (Mouse) (pPM-C-His)
PV205553	ABM	500 ng	EUR 4351

NIPBL Protein Vector (Human) (pPB-C-His)
PV028337	ABM	500 ng	EUR 329

NIPBL Protein Vector (Human) (pPB-N-His)
PV028338	ABM	500 ng	EUR 329

NIPBL Protein Vector (Human) (pPM-C-HA)
PV028339	ABM	500 ng	EUR 329

NIPBL Protein Vector (Human) (pPM-C-His)
PV028340	ABM	500 ng	EUR 329

Nipbl 3'UTR Luciferase Stable Cell Line
TU114097	ABM	1.0 ml	Ask for price

Nipbl 3'UTR GFP Stable Cell Line
TU164097	ABM	1.0 ml	Ask for price

NIPBL 3'UTR GFP Stable Cell Line
TU065697	ABM	1.0 ml	EUR 1521

NIPBL 3'UTR Luciferase Stable Cell Line
TU015697	ABM	1.0 ml	EUR 1521

Mouse Nipped- B- like protein, Nipbl ELISA KIT
ELI-44031m	Lifescience Market	96 Tests	EUR 865

Human Nipped- B- like protein, NIPBL ELISA KIT
ELI-45717h	Lifescience Market	96 Tests	EUR 824

GAPDH Rabbit Polyclonal Antibody
37985-100ul	SAB	100ul	EUR 252

GAPDH Rabbit Polyclonal Antibody
37985-50ul	SAB	50ul	EUR 187

NIPBL Rabbit Polyclonal Antibody