NIPBL Rabbit Polyclonal Antibody

NIPBL Polyclonal Conjugated Antibody

C31986 100ul
EUR 397

NIPBL antibody

31986-100ul 100ul
EUR 252

NIPBL antibody

31986-50ul 50ul
EUR 187

NIPBL antibody

70R-18882 50 ul
EUR 435
Description: Rabbit polyclonal NIPBL antibody

NIPBL Antibody

1-CSB-PA750379LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against NIPBL. Recognizes NIPBL from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:500-1:5000, IHC:1:20-1:200

NIPBL Antibody

1-CSB-PA015817GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against NIPBL. Recognizes NIPBL from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

NIPBL, Cohesin Loading Factor (NIPBL) Antibody

abx432139-200ul 200 ul
EUR 384
  • Shipped within 1-3 working days.

NIPBL, Cohesin Loading Factor (NIPBL) Antibody

abx235737-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

NIPBL, Cohesin Loading Factor (NIPBL) Antibody

20-abx302537
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

NIPBL, Cohesin Loading Factor (NIPBL) Antibody (HRP)

20-abx316309
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

NIPBL, Cohesin Loading Factor (NIPBL) Antibody (FITC)

20-abx316310
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

NIPBL, Cohesin Loading Factor (NIPBL) Antibody (Biotin)

20-abx316311
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

anti- NIPBL antibody

FNab05737 100µg
EUR 548.75
  • Immunogen: Nipped-B homolog(Drosophila)
  • Uniprot ID: Q6KC79
  • Gene ID: 25836
  • Research Area: Metabolism
Description: Antibody raised against NIPBL

Anti-NIPBL antibody

PAab05737 100 ug
EUR 386

Anti-NIPBL antibody

STJ191086 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to NIPBL

NIPBL siRNA

20-abx925929
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

NIPBL siRNA

20-abx925930
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

NIPBL Antibody, HRP conjugated

1-CSB-PA750379LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against NIPBL. Recognizes NIPBL from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

NIPBL Antibody, FITC conjugated

1-CSB-PA750379LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against NIPBL. Recognizes NIPBL from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

NIPBL Antibody, Biotin conjugated

1-CSB-PA750379LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against NIPBL. Recognizes NIPBL from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Human NIPBL, Cohesin Loading Factor (NIPBL) ELISA Kit

abx381806-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

NIPBL cloning plasmid

CSB-CL750379HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 528
  • Sequence: atgaaatgtttgccagaaaattcagctcctttaatcgaatttgcaaatgtgtcccagggtattttattacttctcatgttaaaacaacatttgaagaatctttgtggattttctgatagtaaaattcagaagtactctccatctgaatctgcaaaagtatatgataaagcgataaa
  • Show more
Description: A cloning plasmid for the NIPBL gene.

Anti-NIPBL (aa889-902) antibody

STJ72250 100 µg
EUR 359

Mouse NIPBL shRNA Plasmid

20-abx977367
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

NIPBL ELISA KIT|Human

EF001234 96 Tests
EUR 689

Human NIPBL shRNA Plasmid

20-abx958532
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

NIPBL ORF Vector (Human) (pORF)

ORF007085 1.0 ug DNA
EUR 95

Nipbl ORF Vector (Mouse) (pORF)

ORF051387 1.0 ug DNA
EUR 3033

Nipbl ORF Vector (Mouse) (pORF)

ORF051388 1.0 ug DNA
EUR 2918

NIPBL sgRNA CRISPR Lentivector set (Human)

K1428601 3 x 1.0 ug
EUR 339

Nipbl sgRNA CRISPR Lentivector set (Mouse)

K4529901 3 x 1.0 ug
EUR 339

NIPBL sgRNA CRISPR Lentivector (Human) (Target 1)

K1428602 1.0 ug DNA
EUR 154

NIPBL sgRNA CRISPR Lentivector (Human) (Target 2)

K1428603 1.0 ug DNA
EUR 154

NIPBL sgRNA CRISPR Lentivector (Human) (Target 3)

K1428604 1.0 ug DNA
EUR 154

Nipbl sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4529902 1.0 ug DNA
EUR 154

Nipbl sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4529903 1.0 ug DNA
EUR 154

Nipbl sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4529904 1.0 ug DNA
EUR 154

NIPBL Protein Vector (Human) (pPB-C-His)

PV028337 500 ng
EUR 329

NIPBL Protein Vector (Human) (pPB-N-His)

PV028338 500 ng
EUR 329

NIPBL Protein Vector (Human) (pPM-C-HA)

PV028339 500 ng
EUR 329

NIPBL Protein Vector (Human) (pPM-C-His)

PV028340 500 ng
EUR 329

NIPBL Protein Vector (Mouse) (pPB-C-His)

PV205546 500 ng
EUR 4514

NIPBL Protein Vector (Mouse) (pPB-N-His)

PV205547 500 ng
EUR 4514

NIPBL Protein Vector (Mouse) (pPM-C-HA)

PV205548 500 ng
EUR 4514

NIPBL Protein Vector (Mouse) (pPM-C-His)

PV205549 500 ng
EUR 4514

NIPBL Protein Vector (Mouse) (pPB-C-His)

PV205550 500 ng
EUR 4351

NIPBL Protein Vector (Mouse) (pPB-N-His)

PV205551 500 ng
EUR 4351

NIPBL Protein Vector (Mouse) (pPM-C-HA)

PV205552 500 ng
EUR 4351

NIPBL Protein Vector (Mouse) (pPM-C-His)

PV205553 500 ng
EUR 4351

Nipbl 3'UTR GFP Stable Cell Line

TU164097 1.0 ml Ask for price

NIPBL 3'UTR Luciferase Stable Cell Line

TU015697 1.0 ml
EUR 1521

Nipbl 3'UTR Luciferase Stable Cell Line

TU114097 1.0 ml Ask for price

NIPBL 3'UTR GFP Stable Cell Line

TU065697 1.0 ml
EUR 1521

Mouse Nipped- B- like protein, Nipbl ELISA KIT

ELI-44031m 96 Tests
EUR 865

Human Nipped- B- like protein, NIPBL ELISA KIT

ELI-45717h 96 Tests
EUR 824

VEGF Rabbit Polyclonal Antibody

ES8453-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

VEGF Rabbit Polyclonal Antibody

ES8453-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NIPBL Rabbit Polyclonal Antibody