NLGN3 Rabbit Polyclonal Antibody

NLGN3 Polyclonal Antibody

ABP59479-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human NLGN3 protein at amino acid sequence of 610-690
  • Applications tips:
Description: A polyclonal antibody for detection of NLGN3 from Human, Mouse, Rat. This NLGN3 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human NLGN3 protein at amino acid sequence of 610-690

NLGN3 Polyclonal Antibody

ABP59479-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human NLGN3 protein at amino acid sequence of 610-690
  • Applications tips:
Description: A polyclonal antibody for detection of NLGN3 from Human, Mouse, Rat. This NLGN3 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human NLGN3 protein at amino acid sequence of 610-690

NLGN3 Polyclonal Antibody

ABP59479-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human NLGN3 protein at amino acid sequence of 610-690
  • Applications tips:
Description: A polyclonal antibody for detection of NLGN3 from Human, Mouse, Rat. This NLGN3 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human NLGN3 protein at amino acid sequence of 610-690

NLGN3 Rabbit pAb

A10310-100ul 100 ul
EUR 308

NLGN3 Rabbit pAb

A10310-200ul 200 ul
EUR 459

NLGN3 Rabbit pAb

A10310-20ul 20 ul
EUR 183

NLGN3 Rabbit pAb

A10310-50ul 50 ul
EUR 223

NLGN3 Antibody

ABD9692 100 ug
EUR 438

NLGN3 Antibody

46087-100ul 100ul
EUR 252

NLGN3 Antibody

46087-50ul 50ul
EUR 187

NLGN3 Antibody

DF9692 200ul
EUR 304
Description: NLGN3 Antibody detects endogenous levels of total NLGN3.

NLGN3 Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against NLGN3. Recognizes NLGN3 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IF; Recommended dilution: IF:1:200-1:500

Polyclonal Nlgn3 Antibody - N-terminal region

AMM06712G 0.05mg
EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human Nlgn3 - N-terminal region. This antibody is tested and proven to work in the following applications:

NLGN3 Conjugated Antibody

C46087 100ul
EUR 397

Anti-NLGN3 antibody

STJ112348 100 µl
EUR 277
Description: This gene encodes a member of a family of neuronal cell surface proteins. Members of this family may act as splice site-specific ligands for beta-neurexins and may be involved in the formation and remodeling of central nervous system synapses. Mutations in this gene may be associated with autism and Asperger syndrome. Multiple transcript variants encoding distinct isoforms have been identified for this gene.

Anti-NLGN3 antibody

STJ191071 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to NLGN3


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

Neuroligin-3 (NLGN3) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Neuroligin 3 (Nlgn3) Antibody

  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

Neuroligin-3 (NLGN3) Antibody

  • EUR 425.00
  • EUR 342.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Neuroligin-3 (NLGN3) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Neuroligin 3 (Nlgn3) Antibody

abx433027-200ul 200 ul
EUR 384
  • Shipped within 1-3 working days.

Neuroligin 3 (Nlgn3) Antibody

abx445080-100ug 100 ug
EUR 523
  • Shipped within 5-12 working days.

NLGN3 Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against NLGN3. Recognizes NLGN3 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

NLGN3 Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against NLGN3. Recognizes NLGN3 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

NLGN3 Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against NLGN3. Recognizes NLGN3 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

NLGN3 cloning plasmid

CSB-CL873703HU-10ug 10ug
EUR 805
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2487
  • Sequence: atgtggctgcggcttggcccgccctcgctgtccctgagccccaagcccacggttggcaggagcctgtgcctcaccctgtggttcctcagtttggcgctgagggccagtacccaggccccagcacccacagtcaacactcactttgggaagctaaggggtgcccgagtaccactgc
  • Show more
Description: A cloning plasmid for the NLGN3 gene.

NLGN3 Blocking Peptide

DF9692-BP 1mg
EUR 195

Neuroligin-3 (NLGN3) Antibody (HRP)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Neuroligin-3 (NLGN3) Antibody (FITC)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Neuroligin-3 (NLGN3) Antibody (Biotin)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Neuroligin 3 (Nlgn3) Antibody (ALP)

abx442477-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.

Neuroligin 3 (Nlgn3) Antibody (APC)

abx442758-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.

Neuroligin 3 (Nlgn3) Antibody (Biotin)

abx443038-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.

Neuroligin 3 (Nlgn3) Antibody (FITC)

abx443318-100ug 100 ug
EUR 565
  • Shipped within 5-12 working days.

Neuroligin 3 (Nlgn3) Antibody (HRP)

abx443599-100ug 100 ug
EUR 565
  • Shipped within 5-12 working days.

Neuroligin 3 (Nlgn3) Antibody (PerCP)

abx444161-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.

Neuroligin 3 (Nlgn3) Antibody (RPE)

abx444442-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.

Neuroligin 3 (Nlgn3) Antibody (Streptavidin)

abx444723-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.

Rat NLGN3 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

NLGN3 Rabbit Polyclonal Antibody