Biocat Net

NLK Polyclonal Antibody
ABP59480-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Synthesized peptide derived from part region of human NLK protein at amino acid sequence of 230-310 Applications tips:
Description: A polyclonal antibody for detection of NLK from Human, Mouse, Rat. This NLK antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human NLK protein at amino acid sequence of 230-310

NLK Polyclonal Antibody
ABP59480-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Synthesized peptide derived from part region of human NLK protein at amino acid sequence of 230-310 Applications tips:
Description: A polyclonal antibody for detection of NLK from Human, Mouse, Rat. This NLK antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human NLK protein at amino acid sequence of 230-310

NLK Rabbit pAb
A3190-100ul	Abclonal	100 ul	EUR 308

NLK Rabbit pAb
A3190-200ul	Abclonal	200 ul	EUR 459

NLK Rabbit pAb
A3190-20ul	Abclonal	20 ul	EUR 183

NLK Rabbit pAb
A3190-50ul	Abclonal	50 ul	EUR 223

NLK antibody
70R-9450	Fitzgerald	50 ug	EUR 467
Description: Affinity purified rabbit polyclonal NLK antibody

NLK Antibody
ABD7243	Lifescience Market	100 ug	EUR 438

NLK Antibody
ABD7575	Lifescience Market	100 ug	EUR 438

NLK antibody
38629-100ul	SAB	100ul	EUR 252

NLK antibody
23128-100ul	SAB	100ul	EUR 390

NLK antibody
70R-13123	Fitzgerald	100 ul	EUR 457
Description: Affinity purified Rabbit polyclonal NLK antibody

NLK Antibody
DF7243	Affbiotech	200ul	EUR 304
Description: NLK Antibody detects endogenous levels of total NLK.

NLK Antibody
DF7575	Affbiotech	200ul	EUR 304
Description: NLK Antibody detects endogenous levels of total NLK.

NLK Antibody
1-CSB-PA890657ESR1HU	Cusabio	EUR 222.00 EUR 335.00	100ul 50ul
Form: Liquid Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against NLK. Recognizes NLK from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

NLK Antibody
1-CSB-PA890657ESR2HU	Cusabio	EUR 222.00 EUR 335.00	100ul 50ul
Form: Liquid Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against NLK. Recognizes NLK from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200

Polyclonal NLK Antibody (C-term)
APR17584G	Leading Biology	0.1ml	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human NLK (C-term). This antibody is tested and proven to work in the following applications:

Serine/threonine-Protein Kinase NLK (NLK) Antibody
20-abx125032	Abbexa	EUR 411.00 EUR 592.00	100 ul 200 ul
Shipped within 5-10 working days.

Serine/threonine-Protein Kinase NLK (NLK) Antibody
20-abx002290	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

Serine/threonine-Protein Kinase NLK (NLK) Antibody
abx034924-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

Serine/threonine-Protein Kinase NLK (NLK) Antibody
abx034924-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

Serine/threonine-Protein Kinase NLK (NLK) Antibody
abx033464-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

Serine/threonine-Protein Kinase NLK (NLK) Antibody
abx033464-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

Serine/threonine-Protein Kinase NLK (NLK) Antibody
20-abx320761	Abbexa	EUR 439.00 EUR 328.00	100 ul 50 ul
Shipped within 5-10 working days.

Serine/threonine-Protein Kinase NLK (NLK) Antibody
20-abx321819	Abbexa	EUR 439.00 EUR 328.00	100 ul 50 ul
Shipped within 5-10 working days.

Nlk/ Rat Nlk ELISA Kit
ELI-15097r	Lifescience Market	96 Tests	EUR 886

NLK Conjugated Antibody
C38629	SAB	100ul	EUR 397

Monoclonal NLK Antibody
APR17825G	Leading Biology	0.1ml	EUR 484
Description: A Monoclonal antibody against Human NLK. The antibodies are raised in Mouse. This antibody is applicable in WB

NLK-T286 Antibody
abx033465-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

NLK-T286 Antibody
abx033465-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

Anti-NLK antibody
STJ24772	St John's Laboratory	100 µl	EUR 277

Anti-NLK antibody
STJ191357	St John's Laboratory	200 µl	EUR 197
Description: Unconjugated Rabbit polyclonal to NLK

NLK siRNA
20-abx903574	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

NLK siRNA
20-abx926002	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

NLK siRNA
20-abx926003	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

anti-NLK
YF-PA19168	Abfrontier	50 ug	EUR 363
Description: Mouse polyclonal to NLK

anti-NLK
YF-PA26210	Abfrontier	50 ul	EUR 334
Description: Mouse polyclonal to NLK

NLK Blocking Peptide
33R-8051	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of NLK antibody, catalog no. 70R-9450

NLK Blocking Peptide
DF7243-BP	Affbiotech	1mg	EUR 195

NLK Blocking Peptide
DF7575-BP	Affbiotech	1mg	EUR 195

NLK cloning plasmid
CSB-CL890657HU-10ug	Cusabio	10ug	EUR 544
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1548 Sequence: atggcggcttacaatggcggtacatctgcagcagcaacaggtcaccaccaccaccatcaccaccaccttccacacctccctcctcctcacctgcaccaccaccaccaccctcaacaccatcttcatccggggtcggctgccgctgtacaccctgtacagcagcacacctcttcgg Show more
Description: A cloning plasmid for the NLK gene.

Anti-NLK (1C1)
YF-MA18555	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to NLK

Anti-NLK (2B11)
YF-MA18556	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to NLK

Monoclonal NLK Antibody, Clone: 1146CT24.2.1
APR17583G	Leading Biology	0.1ml	EUR 484
Description: A Monoclonal antibody against Human NLK. The antibodies are raised in Mouse and are from clone 1146CT24.2.1. This antibody is applicable in WB, E

Mouse Serine/threonine- protein kinase NLK, Nlk ELISA KIT
ELI-15096m	Lifescience Market	96 Tests	EUR 865

Human Serine/threonine- protein kinase NLK, NLK ELISA KIT
ELI-44037h	Lifescience Market	96 Tests	EUR 824

Bovine Serine/threonine- protein kinase NLK, NLK ELISA KIT
ELI-38287b	Lifescience Market	96 Tests	EUR 928

Human Serine/threonine-protein kinase NLK (NLK) ELISA Kit
abx385203-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Mouse Serine/threonine-protein kinase NLK (NLK) ELISA Kit
abx390000-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Rat Serine/threonine-protein kinase NLK (NLK) ELISA Kit
abx391676-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Nlk ELISA Kit| Mouse Serine/threonine-protein kinase NLK ELISA
EF015639	Lifescience Market	96 Tests	EUR 689

NLK ELISA Kit| Bovine Serine/threonine-protein kinase NLK ELISA
EF011651	Lifescience Market	96 Tests	EUR 689

NLK ELISA KIT|Human
EF005330	Lifescience Market	96 Tests	EUR 689

Canine NLK ELISA KIT
ELI-39621d	Lifescience Market	96 Tests	EUR 928

Human NLK shRNA Plasmid
20-abx959907	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Mouse NLK shRNA Plasmid
20-abx971760	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Rat NLK shRNA Plasmid
20-abx990833	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Nlk ELISA Kit| Rat Serine/threonine-protein kinase NLK ELISA Ki
EF019036	Lifescience Market	96 Tests	EUR 689

NLK ORF Vector (Human) (pORF)
ORF007104	ABM	1.0 ug DNA	EUR 95

Nlk ORF Vector (Rat) (pORF)
ORF071352	ABM	1.0 ug DNA	EUR 506

Nlk ORF Vector (Mouse) (pORF)
ORF051433	ABM	1.0 ug DNA	EUR 506

NLK sgRNA CRISPR Lentivector set (Human)
K1432801	ABM	3 x 1.0 ug	EUR 339

Nlk sgRNA CRISPR Lentivector set (Mouse)
K4852401	ABM	3 x 1.0 ug	EUR 339

Nlk sgRNA CRISPR Lentivector set (Rat)
K6643801	ABM	3 x 1.0 ug	EUR 339

NLK sgRNA CRISPR Lentivector (Human) (Target 1)
K1432802	ABM	1.0 ug DNA	EUR 154

NLK sgRNA CRISPR Lentivector (Human) (Target 2)
K1432803	ABM	1.0 ug DNA	EUR 154

NLK sgRNA CRISPR Lentivector (Human) (Target 3)
K1432804	ABM	1.0 ug DNA	EUR 154

Nlk sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4852402	ABM	1.0 ug DNA	EUR 154

Nlk sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4852403	ABM	1.0 ug DNA	EUR 154

Nlk sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4852404	ABM	1.0 ug DNA	EUR 154

Nlk sgRNA CRISPR Lentivector (Rat) (Target 1)
K6643802	ABM	1.0 ug DNA	EUR 154

Nlk sgRNA CRISPR Lentivector (Rat) (Target 2)
K6643803	ABM	1.0 ug DNA	EUR 154

Nlk sgRNA CRISPR Lentivector (Rat) (Target 3)
K6643804	ABM	1.0 ug DNA	EUR 154

NLK Protein Vector (Rat) (pPB-C-His)
PV285406	ABM	500 ng	EUR 603

NLK Protein Vector (Rat) (pPB-N-His)
PV285407	ABM	500 ng	EUR 603

NLK Protein Vector (Rat) (pPM-C-HA)
PV285408	ABM	500 ng	EUR 603

NLK Protein Vector (Rat) (pPM-C-His)
PV285409	ABM	500 ng	EUR 603

NLK Protein Vector (Human) (pPB-C-His)
PV028413	ABM	500 ng	EUR 329

NLK Protein Vector (Human) (pPB-N-His)
PV028414	ABM	500 ng	EUR 329

NLK Protein Vector (Human) (pPM-C-HA)
PV028415	ABM	500 ng	EUR 329

NLK Protein Vector (Human) (pPM-C-His)
PV028416	ABM	500 ng	EUR 329

NLK Protein Vector (Mouse) (pPB-C-His)
PV205730	ABM	500 ng	EUR 603

NLK Protein Vector (Mouse) (pPB-N-His)
PV205731	ABM	500 ng	EUR 603

NLK Protein Vector (Mouse) (pPM-C-HA)
PV205732	ABM	500 ng	EUR 603

NLK Protein Vector (Mouse) (pPM-C-His)
PV205733	ABM	500 ng	EUR 603

Nlk 3'UTR GFP Stable Cell Line
TU164136	ABM	1.0 ml	Ask for price

NLK 3'UTR Luciferase Stable Cell Line
TU015741	ABM	1.0 ml	EUR 1521

Nlk 3'UTR Luciferase Stable Cell Line
TU114136	ABM	1.0 ml	Ask for price

NLK 3'UTR GFP Stable Cell Line
TU065741	ABM	1.0 ml	EUR 1521

Nlk 3'UTR GFP Stable Cell Line
TU264021	ABM	1.0 ml	Ask for price

Nlk 3'UTR Luciferase Stable Cell Line
TU214021	ABM	1.0 ml	Ask for price

NLK Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)
LV668677	ABM	1.0 ug DNA	EUR 682

NLK Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)
LV668681	ABM	1.0 ug DNA	EUR 682

NLK Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)
LV668682	ABM	1.0 ug DNA	EUR 682

NLK Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)
LV792181	ABM	1.0 ug DNA	EUR 316

NLK Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a)
LV792182	ABM	1.0 ug DNA	EUR 316

VEGF Rabbit Polyclonal Antibody
ES8453-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

VEGF Rabbit Polyclonal Antibody
ES8453-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody
ES8454-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody
ES8454-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody
ES8455-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody
ES8455-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NLK Rabbit Polyclonal Antibody