Biocat Net

NOC4L Polyclonal Antibody
ABP59486-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Synthesized peptide derived from part region of human NOC4L protein at amino acid sequence of 370-450 Applications tips:
Description: A polyclonal antibody for detection of NOC4L from Human. This NOC4L antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human NOC4L protein at amino acid sequence of 370-450

NOC4L Polyclonal Antibody
ABP59486-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Synthesized peptide derived from part region of human NOC4L protein at amino acid sequence of 370-450 Applications tips:
Description: A polyclonal antibody for detection of NOC4L from Human. This NOC4L antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human NOC4L protein at amino acid sequence of 370-450

NOC4L Rabbit pAb
A15509-100ul	Abclonal	100 ul	EUR 308

NOC4L Rabbit pAb
A15509-200ul	Abclonal	200 ul	EUR 459

NOC4L Rabbit pAb
A15509-20ul	Abclonal	20 ul	EUR 183

NOC4L Rabbit pAb
A15509-50ul	Abclonal	50 ul	EUR 223

NOC4L antibody
70R-4965	Fitzgerald	50 ug	EUR 467
Description: Rabbit polyclonal NOC4L antibody

NOC4L Antibody
ABD2218	Lifescience Market	100 ug	EUR 438

NOC4L Antibody
44674-100ul	SAB	100ul	EUR 252

NOC4L Antibody
44674-50ul	SAB	50ul	EUR 187

NOC4L antibody
70R-18912	Fitzgerald	50 ul	EUR 435
Description: Rabbit polyclonal NOC4L antibody

NOC4L Antibody
DF2218	Affbiotech	200ul	EUR 304
Description: NOC4L antibody detects endogenous levels of total NOC4L.

NOC4L Antibody
1-CSB-PA015913GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against NOC4L. Recognizes NOC4L from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

Noc4l/ Rat Noc4l ELISA Kit
ELI-23134r	Lifescience Market	96 Tests	EUR 886

NOC4L Conjugated Antibody
C44674	SAB	100ul	EUR 397

anti- NOC4L antibody
FNab05780	FN Test	100µg	EUR 505.25
Immunogen: nucleolar complex associated 4 homolog(S. cerevisiae) Uniprot ID: Q9BVI4 Gene ID: 79050 Research Area: Metabolism, Developmental biology
Description: Antibody raised against NOC4L

Anti-NOC4L antibody
PAab05780	Lifescience Market	100 ug	EUR 355

Anti-NOC4L antibody
STJ117704	St John's Laboratory	100 µl	EUR 277

Anti-NOC4L antibody
STJ191108	St John's Laboratory	200 µl	EUR 197
Description: Unconjugated Rabbit polyclonal to NOC4L

NOC4L siRNA
20-abx903593	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

NOC4L siRNA
20-abx926107	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

NOC4L siRNA
20-abx926108	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

anti-NOC4L
YF-PA20740	Abfrontier	50 ul	EUR 363
Description: Mouse polyclonal to NOC4L

NOC4L Blocking Peptide
33R-1802	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of NOC4L antibody, catalog no. 70R-4965

NOC4L cloning plasmid
CSB-CL863131HU1-10ug	Cusabio	10ug	EUR 376
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1551 Sequence: atggagcgggagccgggcgccgcgggagttcgccgggctctgggccgccggctggaggcggtgctggcgagccgcagtgaggccaacgccgtgttcgacatcctggccgtgctgcagtctgaggaccaggaggagatccaggaagcagtccgcacgtgcagccgtcttttcgggg Show more
Description: A cloning plasmid for the NOC4L gene.

NOC4L cloning plasmid
CSB-CL863131HU2-10ug	Cusabio	10ug	EUR 544
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1551 Sequence: atggagcgggagccgggcgccgcgggagttcgccgggctctgggccgccggctggaggcggtgctggcgagccgcagtgaggccaacgccgtgttcgacatcctggccgtgctgcagtctgaggaccaggaggagatccaggaagcagtccgcacgtgcagccgtcttttcgggg Show more
Description: A cloning plasmid for the NOC4L gene.

NOC4L Blocking Peptide
DF2218-BP	Affbiotech	1mg	EUR 195

Mouse NOC4L shRNA Plasmid
20-abx979453	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Rat NOC4L shRNA Plasmid
20-abx990103	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

NOC4L ELISA KIT|Human
EF001271	Lifescience Market	96 Tests	EUR 689

Human NOC4L shRNA Plasmid
20-abx962278	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

NOC4L Recombinant Protein (Human)
RP021412	ABM	100 ug	Ask for price

NOC4L Recombinant Protein (Human)
RP021415	ABM	100 ug	Ask for price

NOC4L Recombinant Protein (Rat)
RP214175	ABM	100 ug	Ask for price

NOC4L Recombinant Protein (Mouse)
RP154484	ABM	100 ug	Ask for price

Nucleolar Complex Associated 4 Homolog (NOC4L) Antibody
20-abx114216	Abbexa	EUR 732.00 EUR 398.00	150 ul 50 ul
Shipped within 5-10 working days.

Nucleolar Complex Associated 4 Homolog (NOC4L) Antibody
abx146256-100ug	Abbexa	100 ug	EUR 391
Shipped within 5-10 working days.

Nucleolar Complex Associated 4 Homolog (NOC4L) Antibody
20-abx148072	Abbexa	EUR 425.00 EUR 342.00	100 ug 50 ug
Shipped within 5-10 working days.

Nucleolar Complex Associated 4 Homolog (NOC4L) Antibody
abx235780-100ug	Abbexa	100 ug	EUR 481
Shipped within 5-12 working days.

NOC4L ORF Vector (Human) (pORF)
ORF007138	ABM	1.0 ug DNA	EUR 95

NOC4L ORF Vector (Human) (pORF)
ORF007139	ABM	1.0 ug DNA	EUR 95

Noc4l ORF Vector (Rat) (pORF)
ORF071393	ABM	1.0 ug DNA	EUR 506

Noc4l ORF Vector (Mouse) (pORF)
ORF051496	ABM	1.0 ug DNA	EUR 506

NOC4L sgRNA CRISPR Lentivector set (Human)
K1438401	ABM	3 x 1.0 ug	EUR 339

Noc4l sgRNA CRISPR Lentivector set (Mouse)
K4115001	ABM	3 x 1.0 ug	EUR 339

Noc4l sgRNA CRISPR Lentivector set (Rat)
K6263201	ABM	3 x 1.0 ug	EUR 339

NOC4L sgRNA CRISPR Lentivector (Human) (Target 1)
K1438402	ABM	1.0 ug DNA	EUR 154

NOC4L sgRNA CRISPR Lentivector (Human) (Target 2)
K1438403	ABM	1.0 ug DNA	EUR 154

NOC4L sgRNA CRISPR Lentivector (Human) (Target 3)
K1438404	ABM	1.0 ug DNA	EUR 154

Noc4l sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4115002	ABM	1.0 ug DNA	EUR 154

Noc4l sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4115003	ABM	1.0 ug DNA	EUR 154

Noc4l sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4115004	ABM	1.0 ug DNA	EUR 154

Noc4l sgRNA CRISPR Lentivector (Rat) (Target 1)
K6263202	ABM	1.0 ug DNA	EUR 154

Noc4l sgRNA CRISPR Lentivector (Rat) (Target 2)
K6263203	ABM	1.0 ug DNA	EUR 154

Noc4l sgRNA CRISPR Lentivector (Rat) (Target 3)
K6263204	ABM	1.0 ug DNA	EUR 154

NOC4L Protein Vector (Human) (pPB-C-His)
PV028549	ABM	500 ng	EUR 329

NOC4L Protein Vector (Human) (pPB-N-His)
PV028550	ABM	500 ng	EUR 329

NOC4L Protein Vector (Human) (pPM-C-HA)
PV028551	ABM	500 ng	EUR 329

NOC4L Protein Vector (Human) (pPM-C-His)
PV028552	ABM	500 ng	EUR 329

NOC4L Protein Vector (Human) (pPB-C-His)
PV028553	ABM	500 ng	EUR 329

NOC4L Protein Vector (Human) (pPB-N-His)
PV028554	ABM	500 ng	EUR 329

NOC4L Protein Vector (Human) (pPM-C-HA)
PV028555	ABM	500 ng	EUR 329

NOC4L Protein Vector (Human) (pPM-C-His)
PV028556	ABM	500 ng	EUR 329

NOC4L Protein Vector (Mouse) (pPB-C-His)
PV205982	ABM	500 ng	EUR 603

NOC4L Protein Vector (Mouse) (pPB-N-His)
PV205983	ABM	500 ng	EUR 603

NOC4L Protein Vector (Mouse) (pPM-C-HA)
PV205984	ABM	500 ng	EUR 603

NOC4L Protein Vector (Mouse) (pPM-C-His)
PV205985	ABM	500 ng	EUR 603

NOC4L Protein Vector (Rat) (pPB-C-His)
PV285570	ABM	500 ng	EUR 603

NOC4L Protein Vector (Rat) (pPB-N-His)
PV285571	ABM	500 ng	EUR 603

NOC4L Protein Vector (Rat) (pPM-C-HA)
PV285572	ABM	500 ng	EUR 603

NOC4L Protein Vector (Rat) (pPM-C-His)
PV285573	ABM	500 ng	EUR 603

Noc4l 3'UTR GFP Stable Cell Line
TU164189	ABM	1.0 ml	Ask for price

NOC4L 3'UTR Luciferase Stable Cell Line
TU015799	ABM	1.0 ml	EUR 1394

Noc4l 3'UTR Luciferase Stable Cell Line
TU114189	ABM	1.0 ml	Ask for price

NOC4L 3'UTR GFP Stable Cell Line
TU065799	ABM	1.0 ml	EUR 1394

Noc4l 3'UTR GFP Stable Cell Line
TU264063	ABM	1.0 ml	Ask for price

Noc4l 3'UTR Luciferase Stable Cell Line
TU214063	ABM	1.0 ml	Ask for price

NOC4L Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)
LV689905	ABM	1.0 ug DNA	EUR 682

NOC4L Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)
LV689909	ABM	1.0 ug DNA	EUR 682

NOC4L Rabbit Polyclonal Antibody