NOC4L Polyclonal Antibody |
ABP59486-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from part region of human NOC4L protein at amino acid sequence of 370-450
- Applications tips:
|
Description: A polyclonal antibody for detection of NOC4L from Human. This NOC4L antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human NOC4L protein at amino acid sequence of 370-450 |
NOC4L Polyclonal Antibody |
ABP59486-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human NOC4L protein at amino acid sequence of 370-450
- Applications tips:
|
Description: A polyclonal antibody for detection of NOC4L from Human. This NOC4L antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human NOC4L protein at amino acid sequence of 370-450 |
NOC4L Rabbit pAb |
A15509-100ul |
Abclonal |
100 ul |
EUR 308 |
NOC4L Rabbit pAb |
A15509-200ul |
Abclonal |
200 ul |
EUR 459 |
NOC4L Rabbit pAb |
A15509-20ul |
Abclonal |
20 ul |
EUR 183 |
NOC4L Rabbit pAb |
A15509-50ul |
Abclonal |
50 ul |
EUR 223 |
NOC4L antibody |
70R-4965 |
Fitzgerald |
50 ug |
EUR 467 |
Description: Rabbit polyclonal NOC4L antibody |
NOC4L Antibody |
44674-100ul |
SAB |
100ul |
EUR 252 |
NOC4L Antibody |
44674-50ul |
SAB |
50ul |
EUR 187 |
NOC4L antibody |
70R-18912 |
Fitzgerald |
50 ul |
EUR 435 |
Description: Rabbit polyclonal NOC4L antibody |
NOC4L Antibody |
DF2218 |
Affbiotech |
200ul |
EUR 304 |
Description: NOC4L antibody detects endogenous levels of total NOC4L. |
NOC4L Antibody |
1-CSB-PA015913GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
|
Description: A polyclonal antibody against NOC4L. Recognizes NOC4L from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB |
NOC4L Conjugated Antibody |
C44674 |
SAB |
100ul |
EUR 397 |
anti- NOC4L antibody |
FNab05780 |
FN Test |
100µg |
EUR 505.25 |
- Immunogen: nucleolar complex associated 4 homolog(S. cerevisiae)
- Uniprot ID: Q9BVI4
- Gene ID: 79050
- Research Area: Metabolism, Developmental biology
|
Description: Antibody raised against NOC4L |
Anti-NOC4L antibody |
STJ191108 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to NOC4L |
NOC4L siRNA |
20-abx903593 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
NOC4L siRNA |
20-abx926107 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
NOC4L siRNA |
20-abx926108 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
anti-NOC4L |
YF-PA20740 |
Abfrontier |
50 ul |
EUR 363 |
Description: Mouse polyclonal to NOC4L |
NOC4L Blocking Peptide |
33R-1802 |
Fitzgerald |
100 ug |
EUR 180 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of NOC4L antibody, catalog no. 70R-4965 |
NOC4L cloning plasmid |
CSB-CL863131HU1-10ug |
Cusabio |
10ug |
EUR 376 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1551
- Sequence: atggagcgggagccgggcgccgcgggagttcgccgggctctgggccgccggctggaggcggtgctggcgagccgcagtgaggccaacgccgtgttcgacatcctggccgtgctgcagtctgaggaccaggaggagatccaggaagcagtccgcacgtgcagccgtcttttcgggg
- Show more
|
Description: A cloning plasmid for the NOC4L gene. |
NOC4L cloning plasmid |
CSB-CL863131HU2-10ug |
Cusabio |
10ug |
EUR 544 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1551
- Sequence: atggagcgggagccgggcgccgcgggagttcgccgggctctgggccgccggctggaggcggtgctggcgagccgcagtgaggccaacgccgtgttcgacatcctggccgtgctgcagtctgaggaccaggaggagatccaggaagcagtccgcacgtgcagccgtcttttcgggg
- Show more
|
Description: A cloning plasmid for the NOC4L gene. |
NOC4L Blocking Peptide |
DF2218-BP |
Affbiotech |
1mg |
EUR 195 |
Mouse NOC4L shRNA Plasmid |
20-abx979453 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Rat NOC4L shRNA Plasmid |
20-abx990103 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Human NOC4L shRNA Plasmid |
20-abx962278 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
NOC4L Recombinant Protein (Human) |
RP021412 |
ABM |
100 ug |
Ask for price |
NOC4L Recombinant Protein (Human) |
RP021415 |
ABM |
100 ug |
Ask for price |
NOC4L Recombinant Protein (Rat) |
RP214175 |
ABM |
100 ug |
Ask for price |
NOC4L Recombinant Protein (Mouse) |
RP154484 |
ABM |
100 ug |
Ask for price |
Nucleolar Complex Associated 4 Homolog (NOC4L) Antibody |
20-abx114216 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Nucleolar Complex Associated 4 Homolog (NOC4L) Antibody |
abx146256-100ug |
Abbexa |
100 ug |
EUR 391 |
- Shipped within 5-10 working days.
|
Nucleolar Complex Associated 4 Homolog (NOC4L) Antibody |
20-abx148072 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Nucleolar Complex Associated 4 Homolog (NOC4L) Antibody |
abx235780-100ug |
Abbexa |
100 ug |
EUR 481 |
- Shipped within 5-12 working days.
|
NOC4L ORF Vector (Human) (pORF) |
ORF007138 |
ABM |
1.0 ug DNA |
EUR 95 |
NOC4L ORF Vector (Human) (pORF) |
ORF007139 |
ABM |
1.0 ug DNA |
EUR 95 |
Noc4l ORF Vector (Rat) (pORF) |
ORF071393 |
ABM |
1.0 ug DNA |
EUR 506 |
Noc4l ORF Vector (Mouse) (pORF) |
ORF051496 |
ABM |
1.0 ug DNA |
EUR 506 |
NOC4L sgRNA CRISPR Lentivector set (Human) |
K1438401 |
ABM |
3 x 1.0 ug |
EUR 339 |
Noc4l sgRNA CRISPR Lentivector set (Mouse) |
K4115001 |
ABM |
3 x 1.0 ug |
EUR 339 |
Noc4l sgRNA CRISPR Lentivector set (Rat) |
K6263201 |
ABM |
3 x 1.0 ug |
EUR 339 |
NOC4L sgRNA CRISPR Lentivector (Human) (Target 1) |
K1438402 |
ABM |
1.0 ug DNA |
EUR 154 |
NOC4L sgRNA CRISPR Lentivector (Human) (Target 2) |
K1438403 |
ABM |
1.0 ug DNA |
EUR 154 |
NOC4L sgRNA CRISPR Lentivector (Human) (Target 3) |
K1438404 |
ABM |
1.0 ug DNA |
EUR 154 |
Noc4l sgRNA CRISPR Lentivector (Mouse) (Target 1) |
K4115002 |
ABM |
1.0 ug DNA |
EUR 154 |
Noc4l sgRNA CRISPR Lentivector (Mouse) (Target 2) |
K4115003 |
ABM |
1.0 ug DNA |
EUR 154 |
Noc4l sgRNA CRISPR Lentivector (Mouse) (Target 3) |
K4115004 |
ABM |
1.0 ug DNA |
EUR 154 |
Noc4l sgRNA CRISPR Lentivector (Rat) (Target 1) |
K6263202 |
ABM |
1.0 ug DNA |
EUR 154 |
Noc4l sgRNA CRISPR Lentivector (Rat) (Target 2) |
K6263203 |
ABM |
1.0 ug DNA |
EUR 154 |
Noc4l sgRNA CRISPR Lentivector (Rat) (Target 3) |
K6263204 |
ABM |
1.0 ug DNA |
EUR 154 |
NOC4L Protein Vector (Human) (pPB-C-His) |
PV028549 |
ABM |
500 ng |
EUR 329 |
NOC4L Protein Vector (Human) (pPB-N-His) |
PV028550 |
ABM |
500 ng |
EUR 329 |
NOC4L Protein Vector (Human) (pPM-C-HA) |
PV028551 |
ABM |
500 ng |
EUR 329 |
NOC4L Protein Vector (Human) (pPM-C-His) |
PV028552 |
ABM |
500 ng |
EUR 329 |
NOC4L Protein Vector (Human) (pPB-C-His) |
PV028553 |
ABM |
500 ng |
EUR 329 |
NOC4L Protein Vector (Human) (pPB-N-His) |
PV028554 |
ABM |
500 ng |
EUR 329 |
NOC4L Protein Vector (Human) (pPM-C-HA) |
PV028555 |
ABM |
500 ng |
EUR 329 |
NOC4L Protein Vector (Human) (pPM-C-His) |
PV028556 |
ABM |
500 ng |
EUR 329 |
NOC4L Protein Vector (Mouse) (pPB-C-His) |
PV205982 |
ABM |
500 ng |
EUR 603 |
NOC4L Protein Vector (Mouse) (pPB-N-His) |
PV205983 |
ABM |
500 ng |
EUR 603 |
NOC4L Protein Vector (Mouse) (pPM-C-HA) |
PV205984 |
ABM |
500 ng |
EUR 603 |
NOC4L Protein Vector (Mouse) (pPM-C-His) |
PV205985 |
ABM |
500 ng |
EUR 603 |
NOC4L Protein Vector (Rat) (pPB-C-His) |
PV285570 |
ABM |
500 ng |
EUR 603 |
NOC4L Protein Vector (Rat) (pPB-N-His) |
PV285571 |
ABM |
500 ng |
EUR 603 |
NOC4L Protein Vector (Rat) (pPM-C-HA) |
PV285572 |
ABM |
500 ng |
EUR 603 |
NOC4L Protein Vector (Rat) (pPM-C-His) |
PV285573 |
ABM |
500 ng |
EUR 603 |
Noc4l 3'UTR GFP Stable Cell Line |
TU164189 |
ABM |
1.0 ml |
Ask for price |
NOC4L 3'UTR Luciferase Stable Cell Line |
TU015799 |
ABM |
1.0 ml |
EUR 1394 |
Noc4l 3'UTR Luciferase Stable Cell Line |
TU114189 |
ABM |
1.0 ml |
Ask for price |
NOC4L 3'UTR GFP Stable Cell Line |
TU065799 |
ABM |
1.0 ml |
EUR 1394 |
Noc4l 3'UTR GFP Stable Cell Line |
TU264063 |
ABM |
1.0 ml |
Ask for price |
Noc4l 3'UTR Luciferase Stable Cell Line |
TU214063 |
ABM |
1.0 ml |
Ask for price |
NOC4L Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV) |
LV689905 |
ABM |
1.0 ug DNA |
EUR 682 |
NOC4L Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC) |
LV689909 |
ABM |
1.0 ug DNA |
EUR 682 |
NOC4L Rabbit Polyclonal Antibody