Biocat Net

NOL4 antibody
70R-4720	Fitzgerald	50 ug	EUR 467
Description: Rabbit polyclonal NOL4 antibody raised against the N terminal of NOL4

NOL4 Antibody
ABD9719	Lifescience Market	100 ug	EUR 438

NOL4 Conjugated Antibody
C46109	SAB	100ul	EUR 397

anti- NOL4 antibody
FNab05785	FN Test	100µg	EUR 505.25
Immunogen: nucleolar protein 4 Uniprot ID: O94818 Gene ID: 8715 Research Area: Neuroscience, Metabolism
Description: Antibody raised against NOL4

Anti-NOL4 antibody
PAab05785	Lifescience Market	100 ug	EUR 355

Anti-NOL4 antibody
STJ191114	St John's Laboratory	200 µl	EUR 197
Description: Unconjugated Rabbit polyclonal to NOL4

NOL4 siRNA
20-abx926124	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

NOL4 siRNA
20-abx926125	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

pOTB7-NOL4
PVT18438	Lifescience Market	2 ug	EUR 231

anti-NOL4
YF-PA15817	Abfrontier	50 ul	EUR 363
Description: Mouse polyclonal to NOL4

anti-NOL4
YF-PA25164	Abfrontier	50 ul	EUR 334
Description: Mouse polyclonal to NOL4

NOL4 Blocking Peptide
33R-8832	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of NOL4 antibody, catalog no. 70R-4720

NOL4 Blocking Peptide
DF9719-BP	Affbiotech	1mg	EUR 195

NOL4 cloning plasmid
CSB-CL015922HU-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1269 Sequence: atgcatgtggaaacggggccaaatggagaacaaattcggaaacacgctggacaaaagagaacttacaaagcaatttcagagagctatgccttcctaccaagagaagcggtgacacgatttctaatgagctgctcagagtgccagaaaagaatgcatttaaacccagatggaacag Show more
Description: A cloning plasmid for the NOL4 gene.

pENTR223-NOL4 vector
PVT12100	Lifescience Market	2 ug	EUR 308

Anti-NOL4 (2A10)
YF-MA11095	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to NOL4

Nucleolar Protein 4 (NOL4) Antibody
20-abx217203	Abbexa	EUR 425.00 EUR 342.00	100 ug 50 ug
Shipped within 5-10 working days.

Nucleolar Protein 4 (NOL4) Antibody
abx029414-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

Nucleolar Protein 4 (NOL4) Antibody
abx029414-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

Nucleolar Protein 4 (NOL4) Antibody
abx235785-100ug	Abbexa	100 ug	EUR 481
Shipped within 5-12 working days.

NOL4 ELISA KIT|Human
EF001276	Lifescience Market	96 Tests	EUR 689

Human NOL4 shRNA Plasmid
20-abx955737	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Mouse NOL4 shRNA Plasmid
20-abx983257	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

NOL4 Recombinant Protein (Human)
RP021433	ABM	100 ug	Ask for price

NOL4 Recombinant Protein (Mouse)
RP154517	ABM	100 ug	Ask for price

NOL4 Recombinant Protein (Mouse)
RP154520	ABM	100 ug	Ask for price

NOL4 Recombinant Protein (Rat)
RP214199	ABM	100 ug	Ask for price

Nol4 ORF Vector (Rat) (pORF)
ORF071401	ABM	1.0 ug DNA	EUR 506

NOL4 ORF Vector (Human) (pORF)
ORF007145	ABM	1.0 ug DNA	EUR 95

Nol4 ORF Vector (Mouse) (pORF)
ORF051507	ABM	1.0 ug DNA	EUR 506

Nol4 ORF Vector (Mouse) (pORF)
ORF051508	ABM	1.0 ug DNA	EUR 506

Nol4 sgRNA CRISPR Lentivector set (Rat)
K6412201	ABM	3 x 1.0 ug	EUR 339

Nol4 sgRNA CRISPR Lentivector set (Mouse)
K3634501	ABM	3 x 1.0 ug	EUR 339

NOL4 sgRNA CRISPR Lentivector set (Human)
K1439001	ABM	3 x 1.0 ug	EUR 339

Human Nucleolar protein 4, NOL4 ELISA KIT
ELI-16700h	Lifescience Market	96 Tests	EUR 824

Mouse Nucleolar protein 4, Nol4 ELISA KIT
ELI-22275m	Lifescience Market	96 Tests	EUR 865

Human Nucleolar Protein 4 (NOL4) ELISA Kit
abx381840-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Nol4 sgRNA CRISPR Lentivector (Rat) (Target 1)
K6412202	ABM	1.0 ug DNA	EUR 154

Nol4 sgRNA CRISPR Lentivector (Rat) (Target 2)
K6412203	ABM	1.0 ug DNA	EUR 154

Nol4 sgRNA CRISPR Lentivector (Rat) (Target 3)
K6412204	ABM	1.0 ug DNA	EUR 154

Nol4 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K3634502	ABM	1.0 ug DNA	EUR 154

Nol4 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K3634503	ABM	1.0 ug DNA	EUR 154

Nol4 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K3634504	ABM	1.0 ug DNA	EUR 154

NOL4 sgRNA CRISPR Lentivector (Human) (Target 1)
K1439002	ABM	1.0 ug DNA	EUR 154

NOL4 sgRNA CRISPR Lentivector (Human) (Target 2)
K1439003	ABM	1.0 ug DNA	EUR 154

NOL4 sgRNA CRISPR Lentivector (Human) (Target 3)
K1439004	ABM	1.0 ug DNA	EUR 154

NOL4 Protein Vector (Mouse) (pPB-C-His)
PV206026	ABM	500 ng	EUR 603

NOL4 Protein Vector (Mouse) (pPB-N-His)
PV206027	ABM	500 ng	EUR 603

NOL4 Protein Vector (Mouse) (pPM-C-HA)
PV206028	ABM	500 ng	EUR 603

NOL4 Protein Vector (Mouse) (pPM-C-His)
PV206029	ABM	500 ng	EUR 603

NOL4 Protein Vector (Mouse) (pPB-C-His)
PV206030	ABM	500 ng	EUR 603

NOL4 Protein Vector (Mouse) (pPB-N-His)
PV206031	ABM	500 ng	EUR 603

NOL4 Protein Vector (Mouse) (pPM-C-HA)
PV206032	ABM	500 ng	EUR 603

NOL4 Protein Vector (Mouse) (pPM-C-His)
PV206033	ABM	500 ng	EUR 603

NOL4 Protein Vector (Rat) (pPB-C-His)
PV285602	ABM	500 ng	EUR 603

NOL4 Protein Vector (Rat) (pPB-N-His)
PV285603	ABM	500 ng	EUR 603

NOL4 Protein Vector (Rat) (pPM-C-HA)
PV285604	ABM	500 ng	EUR 603

NOL4 Protein Vector (Rat) (pPM-C-His)
PV285605	ABM	500 ng	EUR 603

NOL4 Protein Vector (Human) (pPB-C-His)
PV028577	ABM	500 ng	EUR 329

NOL4 Protein Vector (Human) (pPB-N-His)
PV028578	ABM	500 ng	EUR 329

NOL4 Protein Vector (Human) (pPM-C-HA)
PV028579	ABM	500 ng	EUR 329

NOL4 Protein Vector (Human) (pPM-C-His)
PV028580	ABM	500 ng	EUR 329

Human Nucleolar Protein 4(NOL4)ELISA Kit
QY-E03191	Qayee Biotechnology	96T	EUR 394

Nol4 3'UTR Luciferase Stable Cell Line
TU114198	ABM	1.0 ml	Ask for price

Nol4 3'UTR GFP Stable Cell Line
TU164198	ABM	1.0 ml	Ask for price

Nol4 3'UTR Luciferase Stable Cell Line
TU214073	ABM	1.0 ml	Ask for price

Nol4 3'UTR GFP Stable Cell Line
TU264073	ABM	1.0 ml	Ask for price

NOL4 3'UTR GFP Stable Cell Line
TU065805	ABM	1.0 ml	EUR 1521

NOL4 3'UTR Luciferase Stable Cell Line
TU015805	ABM	1.0 ml	EUR 1521

GAPDH Rabbit Polyclonal Antibody
37985-100ul	SAB	100ul	EUR 252

GAPDH Rabbit Polyclonal Antibody
37985-50ul	SAB	50ul	EUR 187

EFHD1 Rabbit Polyclonal Antibody
38001-100ul	SAB	100ul	EUR 252

EFHD1 Rabbit Polyclonal Antibody
38001-50ul	SAB	50ul	EUR 187

Alliinase Rabbit Polyclonal Antibody
38042-100ul	SAB	100ul	EUR 252

Alliinase Rabbit Polyclonal Antibody
38042-50ul	SAB	50ul	EUR 187

ECFP Rabbit Polyclonal Antibody
38077-100ul	SAB	100ul	EUR 252

ECFP Rabbit Polyclonal Antibody
38077-50ul	SAB	50ul	EUR 187

EYFP Rabbit Polyclonal Antibody
38078-100ul	SAB	100ul	EUR 252

EYFP Rabbit Polyclonal Antibody
38078-50ul	SAB	50ul	EUR 187

mOrange Rabbit Polyclonal Antibody
38079-100ul	SAB	100ul	EUR 252

mOrange Rabbit Polyclonal Antibody
38079-50ul	SAB	50ul	EUR 187

mStrawberry Rabbit Polyclonal Antibody
38083-100ul	SAB	100ul	EUR 252

mStrawberry Rabbit Polyclonal Antibody
38083-50ul	SAB	50ul	EUR 187

AmCyan Rabbit Polyclonal Antibody
38086-100ul	SAB	100ul	EUR 252

AmCyan Rabbit Polyclonal Antibody
38086-50ul	SAB	50ul	EUR 187

NOL4 Rabbit Polyclonal Antibody