NOL4 Rabbit Polyclonal Antibody

NOL4 antibody

70R-4720 50 ug
EUR 467
Description: Rabbit polyclonal NOL4 antibody raised against the N terminal of NOL4

NOL4 Antibody

ABD9719 100 ug
EUR 438

NOL4 Conjugated Antibody

C46109 100ul
EUR 397

anti- NOL4 antibody

FNab05785 100µg
EUR 505.25
  • Immunogen: nucleolar protein 4
  • Uniprot ID: O94818
  • Gene ID: 8715
  • Research Area: Neuroscience, Metabolism
Description: Antibody raised against NOL4

Anti-NOL4 antibody

PAab05785 100 ug
EUR 355

Anti-NOL4 antibody

STJ191114 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to NOL4


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


PVT18438 2 ug
EUR 231


YF-PA15817 50 ul
EUR 363
Description: Mouse polyclonal to NOL4


YF-PA25164 50 ul
EUR 334
Description: Mouse polyclonal to NOL4

NOL4 Blocking Peptide

33R-8832 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of NOL4 antibody, catalog no. 70R-4720

NOL4 Blocking Peptide

DF9719-BP 1mg
EUR 195

NOL4 cloning plasmid

CSB-CL015922HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1269
  • Sequence: atgcatgtggaaacggggccaaatggagaacaaattcggaaacacgctggacaaaagagaacttacaaagcaatttcagagagctatgccttcctaccaagagaagcggtgacacgatttctaatgagctgctcagagtgccagaaaagaatgcatttaaacccagatggaacag
  • Show more
Description: A cloning plasmid for the NOL4 gene.

pENTR223-NOL4 vector

PVT12100 2 ug
EUR 308

Anti-NOL4 (2A10)

YF-MA11095 100 ug
EUR 363
Description: Mouse monoclonal to NOL4

Nucleolar Protein 4 (NOL4) Antibody

  • EUR 425.00
  • EUR 342.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Nucleolar Protein 4 (NOL4) Antibody

abx029414-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Nucleolar Protein 4 (NOL4) Antibody

abx029414-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Nucleolar Protein 4 (NOL4) Antibody

abx235785-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.


EF001276 96 Tests
EUR 689

Human NOL4 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse NOL4 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

NOL4 Recombinant Protein (Human)

RP021433 100 ug Ask for price

NOL4 Recombinant Protein (Mouse)

RP154517 100 ug Ask for price

NOL4 Recombinant Protein (Mouse)

RP154520 100 ug Ask for price

NOL4 Recombinant Protein (Rat)

RP214199 100 ug Ask for price

Nol4 ORF Vector (Rat) (pORF)

ORF071401 1.0 ug DNA
EUR 506

NOL4 ORF Vector (Human) (pORF)

ORF007145 1.0 ug DNA
EUR 95

Nol4 ORF Vector (Mouse) (pORF)

ORF051507 1.0 ug DNA
EUR 506

Nol4 ORF Vector (Mouse) (pORF)

ORF051508 1.0 ug DNA
EUR 506

Nol4 sgRNA CRISPR Lentivector set (Rat)

K6412201 3 x 1.0 ug
EUR 339

Nol4 sgRNA CRISPR Lentivector set (Mouse)

K3634501 3 x 1.0 ug
EUR 339

NOL4 sgRNA CRISPR Lentivector set (Human)

K1439001 3 x 1.0 ug
EUR 339

Human Nucleolar protein 4, NOL4 ELISA KIT

ELI-16700h 96 Tests
EUR 824

Mouse Nucleolar protein 4, Nol4 ELISA KIT

ELI-22275m 96 Tests
EUR 865

Human Nucleolar Protein 4 (NOL4) ELISA Kit

abx381840-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Nol4 sgRNA CRISPR Lentivector (Rat) (Target 1)

K6412202 1.0 ug DNA
EUR 154

Nol4 sgRNA CRISPR Lentivector (Rat) (Target 2)

K6412203 1.0 ug DNA
EUR 154

Nol4 sgRNA CRISPR Lentivector (Rat) (Target 3)

K6412204 1.0 ug DNA
EUR 154

Nol4 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3634502 1.0 ug DNA
EUR 154

Nol4 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3634503 1.0 ug DNA
EUR 154

Nol4 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3634504 1.0 ug DNA
EUR 154

NOL4 sgRNA CRISPR Lentivector (Human) (Target 1)

K1439002 1.0 ug DNA
EUR 154

NOL4 sgRNA CRISPR Lentivector (Human) (Target 2)

K1439003 1.0 ug DNA
EUR 154

NOL4 sgRNA CRISPR Lentivector (Human) (Target 3)

K1439004 1.0 ug DNA
EUR 154

NOL4 Protein Vector (Mouse) (pPB-C-His)

PV206026 500 ng
EUR 603

NOL4 Protein Vector (Mouse) (pPB-N-His)

PV206027 500 ng
EUR 603

NOL4 Protein Vector (Mouse) (pPM-C-HA)

PV206028 500 ng
EUR 603

NOL4 Protein Vector (Mouse) (pPM-C-His)

PV206029 500 ng
EUR 603

NOL4 Protein Vector (Mouse) (pPB-C-His)

PV206030 500 ng
EUR 603

NOL4 Protein Vector (Mouse) (pPB-N-His)

PV206031 500 ng
EUR 603

NOL4 Protein Vector (Mouse) (pPM-C-HA)

PV206032 500 ng
EUR 603

NOL4 Protein Vector (Mouse) (pPM-C-His)

PV206033 500 ng
EUR 603

NOL4 Protein Vector (Rat) (pPB-C-His)

PV285602 500 ng
EUR 603

NOL4 Protein Vector (Rat) (pPB-N-His)

PV285603 500 ng
EUR 603

NOL4 Protein Vector (Rat) (pPM-C-HA)

PV285604 500 ng
EUR 603

NOL4 Protein Vector (Rat) (pPM-C-His)

PV285605 500 ng
EUR 603

NOL4 Protein Vector (Human) (pPB-C-His)

PV028577 500 ng
EUR 329

NOL4 Protein Vector (Human) (pPB-N-His)

PV028578 500 ng
EUR 329

NOL4 Protein Vector (Human) (pPM-C-HA)

PV028579 500 ng
EUR 329

NOL4 Protein Vector (Human) (pPM-C-His)

PV028580 500 ng
EUR 329

Human Nucleolar Protein 4(NOL4)ELISA Kit  

QY-E03191 96T
EUR 394

Nol4 3'UTR Luciferase Stable Cell Line

TU114198 1.0 ml Ask for price

Nol4 3'UTR GFP Stable Cell Line

TU164198 1.0 ml Ask for price

Nol4 3'UTR Luciferase Stable Cell Line

TU214073 1.0 ml Ask for price

Nol4 3'UTR GFP Stable Cell Line

TU264073 1.0 ml Ask for price

NOL4 3'UTR GFP Stable Cell Line

TU065805 1.0 ml
EUR 1521

NOL4 3'UTR Luciferase Stable Cell Line

TU015805 1.0 ml
EUR 1521

GAPDH Rabbit Polyclonal Antibody

37985-100ul 100ul
EUR 252

GAPDH Rabbit Polyclonal Antibody

37985-50ul 50ul
EUR 187

EFHD1 Rabbit Polyclonal Antibody

38001-100ul 100ul
EUR 252

EFHD1 Rabbit Polyclonal Antibody

38001-50ul 50ul
EUR 187

Alliinase Rabbit Polyclonal Antibody

38042-100ul 100ul
EUR 252

Alliinase Rabbit Polyclonal Antibody

38042-50ul 50ul
EUR 187

ECFP Rabbit Polyclonal Antibody

38077-100ul 100ul
EUR 252

ECFP Rabbit Polyclonal Antibody

38077-50ul 50ul
EUR 187

EYFP Rabbit Polyclonal Antibody

38078-100ul 100ul
EUR 252

EYFP Rabbit Polyclonal Antibody

38078-50ul 50ul
EUR 187

mOrange Rabbit Polyclonal Antibody

38079-100ul 100ul
EUR 252

mOrange Rabbit Polyclonal Antibody

38079-50ul 50ul
EUR 187

mStrawberry Rabbit Polyclonal Antibody

38083-100ul 100ul
EUR 252

mStrawberry Rabbit Polyclonal Antibody

38083-50ul 50ul
EUR 187

AmCyan Rabbit Polyclonal Antibody

38086-100ul 100ul
EUR 252

AmCyan Rabbit Polyclonal Antibody

38086-50ul 50ul
EUR 187

NOL4 Rabbit Polyclonal Antibody