 NOL7 Polyclonal Antibody |
|
ABP59494-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Synthesized peptide derived from part region of human NOL7 protein at amino acid sequence of 190-270
- Applications tips:
|
|
Description: A polyclonal antibody for detection of NOL7 from Human, Mouse. This NOL7 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human NOL7 protein at amino acid sequence of 190-270 |
NOL7 Polyclonal Antibody |
|
ABP59494-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from part region of human NOL7 protein at amino acid sequence of 190-270
- Applications tips:
|
|
Description: A polyclonal antibody for detection of NOL7 from Human, Mouse. This NOL7 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human NOL7 protein at amino acid sequence of 190-270 |
NOL7 Polyclonal Antibody |
|
ABP59494-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human NOL7 protein at amino acid sequence of 190-270
- Applications tips:
|
|
Description: A polyclonal antibody for detection of NOL7 from Human, Mouse. This NOL7 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human NOL7 protein at amino acid sequence of 190-270 |
 NOL7 Antibody |
|
46110-100ul |
SAB |
100ul |
EUR 252 |
NOL7 Antibody |
|
46110-50ul |
SAB |
50ul |
EUR 187 |
NOL7 Antibody |
|
DF9720 |
Affbiotech |
200ul |
EUR 304 |
|
Description: NOL7 Antibody detects endogenous levels of total NOL7. |
 NOL7 Conjugated Antibody |
|
C46110 |
SAB |
100ul |
EUR 397 |
 Anti-NOL7 antibody |
|
STJ191115 |
St John's Laboratory |
200 µl |
EUR 197 |
|
Description: Unconjugated Rabbit polyclonal to NOL7 |
 NOL7 siRNA |
|
20-abx926128 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
NOL7 siRNA |
|
20-abx926129 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
 anti-NOL7 |
|
YF-PA19034 |
Abfrontier |
50 ug |
EUR 363 |
|
Description: Mouse polyclonal to NOL7 |
 NOL7 Blocking Peptide |
|
DF9720-BP |
Affbiotech |
1mg |
EUR 195 |
 NOL7 cloning plasmid |
|
CSB-CL891973HU-10ug |
Cusabio |
10ug |
EUR 327 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 774
- Sequence: atggtgcagctccgaccgcgagcgtctcgcgccccggcgtcggcggaggcgatggtggacgagggccagctggcctcggaggaggaggaggcggagcacgggctgttgctcgggcagcccagcagcggcgcggccgccgagcccctggaggaagacgaggaaggggacgatgagtt
- Show more
|
|
Description: A cloning plasmid for the NOL7 gene. |
 Antibody) Nucleolar Protein 7 (NOL7) Antibody |
|
20-abx217284 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
 Mouse NOL7 shRNA Plasmid |
|
20-abx977122 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
 Human NOL7 shRNA Plasmid |
|
20-abx959749 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
) NOL7 Recombinant Protein (Human) |
|
RP021442 |
ABM |
100 ug |
Ask for price |
) NOL7 Recombinant Protein (Mouse) |
|
RP154526 |
ABM |
100 ug |
Ask for price |
 (pORF)) NOL7 ORF Vector (Human) (pORF) |
|
ORF007148 |
ABM |
1.0 ug DNA |
EUR 95 |
 (pORF)) Nol7 ORF Vector (Mouse) (pORF) |
|
ORF051510 |
ABM |
1.0 ug DNA |
EUR 506 |
) NOL7 sgRNA CRISPR Lentivector set (Human) |
|
K1439201 |
ABM |
3 x 1.0 ug |
EUR 339 |
) Nol7 sgRNA CRISPR Lentivector set (Mouse) |
|
K3535801 |
ABM |
3 x 1.0 ug |
EUR 339 |
 (Target 1)) NOL7 sgRNA CRISPR Lentivector (Human) (Target 1) |
|
K1439202 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 2)) NOL7 sgRNA CRISPR Lentivector (Human) (Target 2) |
|
K1439203 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 3)) NOL7 sgRNA CRISPR Lentivector (Human) (Target 3) |
|
K1439204 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 1)) Nol7 sgRNA CRISPR Lentivector (Mouse) (Target 1) |
|
K3535802 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 2)) Nol7 sgRNA CRISPR Lentivector (Mouse) (Target 2) |
|
K3535803 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 3)) Nol7 sgRNA CRISPR Lentivector (Mouse) (Target 3) |
|
K3535804 |
ABM |
1.0 ug DNA |
EUR 154 |
 (pPB-C-His)) NOL7 Protein Vector (Human) (pPB-C-His) |
|
PV028589 |
ABM |
500 ng |
EUR 329 |
 (pPB-N-His)) NOL7 Protein Vector (Human) (pPB-N-His) |
|
PV028590 |
ABM |
500 ng |
EUR 329 |
 (pPM-C-HA)) NOL7 Protein Vector (Human) (pPM-C-HA) |
|
PV028591 |
ABM |
500 ng |
EUR 329 |
 (pPM-C-His)) NOL7 Protein Vector (Human) (pPM-C-His) |
|
PV028592 |
ABM |
500 ng |
EUR 329 |
 (pPB-C-His)) NOL7 Protein Vector (Mouse) (pPB-C-His) |
|
PV206038 |
ABM |
500 ng |
EUR 603 |
 (pPB-N-His)) NOL7 Protein Vector (Mouse) (pPB-N-His) |
|
PV206039 |
ABM |
500 ng |
EUR 603 |
 (pPM-C-HA)) NOL7 Protein Vector (Mouse) (pPM-C-HA) |
|
PV206040 |
ABM |
500 ng |
EUR 603 |
 (pPM-C-His)) NOL7 Protein Vector (Mouse) (pPM-C-His) |
|
PV206041 |
ABM |
500 ng |
EUR 603 |
 Nol7 3'UTR GFP Stable Cell Line |
|
TU164200 |
ABM |
1.0 ml |
Ask for price |
 NOL7 3'UTR Luciferase Stable Cell Line |
|
TU015807 |
ABM |
1.0 ml |
EUR 1394 |
 Nol7 3'UTR Luciferase Stable Cell Line |
|
TU114200 |
ABM |
1.0 ml |
Ask for price |
 NOL7 3'UTR GFP Stable Cell Line |
|
TU065807 |
ABM |
1.0 ml |
EUR 1394 |
 VEGF Rabbit Polyclonal Antibody |
|
ES8453-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
VEGF Rabbit Polyclonal Antibody |
|
ES8453-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 CD10 Rabbit Polyclonal Antibody |
|
ES8454-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
CD10 Rabbit Polyclonal Antibody |
|
ES8454-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 NM23A Rabbit Polyclonal Antibody |
|
ES8455-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NM23A Rabbit Polyclonal Antibody |
|
ES8455-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 ATM Rabbit Polyclonal Antibody |
|
ES8456-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
|
ES8456-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
|
ES8457-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
|
ES8457-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 HSC70 Rabbit Polyclonal Antibody |
|
ES8558-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSC70 Rabbit Polyclonal Antibody |
|
ES8558-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
 HSP40 Rabbit Polyclonal Antibody |
|
ES8559-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSP40 Rabbit Polyclonal Antibody |
|
ES8559-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
 HSP90? Rabbit Polyclonal Antibody |
|
ES8560-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
HSP90? Rabbit Polyclonal Antibody |
|
ES8560-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 IkB ? Rabbit Polyclonal Antibody |
|
ES8561-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
IkB ? Rabbit Polyclonal Antibody |
|
ES8561-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
 JAK1 Rabbit Polyclonal Antibody |
|
ES8562-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JAK1 Rabbit Polyclonal Antibody |
|
ES8562-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 JAK2 Rabbit Polyclonal Antibody |
|
ES8563-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JAK2 Rabbit Polyclonal Antibody |
|
ES8563-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 JNK2 Rabbit Polyclonal Antibody |
|
ES8564-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
JNK2 Rabbit Polyclonal Antibody |
|
ES8564-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
 JNK3 Rabbit Polyclonal Antibody |
|
ES8565-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JNK3 Rabbit Polyclonal Antibody |
|
ES8565-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 MEK2 Rabbit Polyclonal Antibody |
|
ES8566-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC |
MEK2 Rabbit Polyclonal Antibody |
|
ES8566-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC |
 MEK3 Rabbit Polyclonal Antibody |
|
ES8567-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
MEK3 Rabbit Polyclonal Antibody |
|
ES8567-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 Nrf2 Rabbit Polyclonal Antibody |
|
ES8568-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
Nrf2 Rabbit Polyclonal Antibody |
|
ES8568-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 ATG4a Rabbit Polyclonal Antibody |
|
ES8569-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4a Rabbit Polyclonal Antibody |
|
ES8569-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 ATG4b Rabbit Polyclonal Antibody |
|
ES8570-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4b Rabbit Polyclonal Antibody |
|
ES8570-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 ATG4c Rabbit Polyclonal Antibody |
|
ES8571-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4c Rabbit Polyclonal Antibody |
|
ES8571-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 ATG5 Rabbit Polyclonal Antibody |
|
ES8572-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG5 Rabbit Polyclonal Antibody |
|
ES8572-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 ATG7 Rabbit Polyclonal Antibody |
|
ES8573-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG7 Rabbit Polyclonal Antibody |
|
ES8573-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NOL7 Rabbit Polyclonal Antibody
ELISA Kit )