NOL9 Rabbit Polyclonal Antibody

NOL9 Polyclonal Antibody
ES9958-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NOL9 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

NOL9 Polyclonal Antibody
ES9958-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NOL9 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

NOL9 Rabbit pAb
A9160-100ul 100 ul
EUR 308

NOL9 Rabbit pAb
A9160-200ul 200 ul
EUR 459

NOL9 Rabbit pAb
A9160-20ul 20 ul Ask for price

NOL9 Rabbit pAb
A9160-50ul 50 ul Ask for price

NOL9 Antibody
36222-100ul 100ul
EUR 252

NOL9 Antibody
DF9721 200ul
EUR 304
Description: NOL9 Antibody detects endogenous levels of total NOL9.

NOL9 Antibody
1-CSB-PA150875
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against NOL9. Recognizes NOL9 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB;ELISA:1:2000-1:5000, WB:1:500-1:2000

NOL9 Antibody
ABD9721 100 ug
EUR 438

Polyclonal NOL9 Antibody (C-term)
APR06213G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human NOL9 (C-term). This antibody is tested and proven to work in the following applications:

NOL9 Conjugated Antibody
C36222 100ul
EUR 397

anti- NOL9 antibody
FNab05789 100µg
EUR 585
  • Immunogen: nucleolar protein 9
  • Uniprot ID: Q5SY16
  • Gene ID: 79707
  • Research Area: Metabolism
Description: Antibody raised against NOL9

Anti-NOL9 antibody
PAab05789 100 ug
EUR 412

Anti-NOL9 antibody
STJ111591 100 µl
EUR 277

Anti-NOL9 antibody
STJ191116 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to NOL9

NOL9 siRNA
20-abx926132
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

NOL9 siRNA
20-abx926133
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

NOL9 Blocking Peptide
DF9721-BP 1mg
EUR 195

NOL9 cloning plasmid
CSB-CL725557HU-10ug 10ug
EUR 474
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2109
  • Sequence: ATGGCGGACTCGGGACTGCTGCTAAAGTGGGGTTCCTGCCGTTCCACTTGGCTGCGGGTCCGCAAGGCCCGGCCCCAGCTCATCCTCAGCCGCCGGCCCCGCCGCCGGCTCGGGAGCCTGCGCTGGTGCGGTCGGCGGCGCCTACGGCGGCGGTTACTGCAAGCCCAGGCGGCCG
  • Show more
Description: A cloning plasmid for the NOL9 gene.

Nucleolar Protein 9 (NOL9) Antibody
20-abx211330
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Nucleolar Protein 9 (NOL9) Antibody
20-abx124786
  • EUR 411.00
  • EUR 592.00
  • 100 ul
  • 200 ul
  • Shipped within 5-10 working days.

Nucleolar Protein 9 (NOL9) Antibody
abx122121-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Nucleolar Protein 9 (NOL9) Antibody
abx034569-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Nucleolar Protein 9 (NOL9) Antibody
abx034569-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Nucleolar Protein 9 (NOL9) Antibody
abx235789-100ug 100 ug
EUR 551
  • Shipped within 5-12 working days.

Human Polynucleotide 5'- hydroxyl- kinase NOL9, NOL9 ELISA KIT
ELI-15001h 96 Tests
EUR 824

Mouse Polynucleotide 5'- hydroxyl- kinase NOL9, Nol9 ELISA KIT
ELI-44124m 96 Tests
EUR 865

Bovine Polynucleotide 5'- hydroxyl- kinase NOL9, NOL9 ELISA KIT
ELI-44672b 96 Tests
EUR 928

NOL9 ELISA KIT|Human
EF001279 96 Tests
EUR 689

Mouse NOL9 shRNA Plasmid
20-abx978066
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human NOL9 shRNA Plasmid
20-abx962501
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

NOL9 Recombinant Protein (Human)
RP041680 100 ug Ask for price

NOL9 Recombinant Protein (Mouse)
RP154532 100 ug Ask for price

NOL9 Recombinant Protein (Mouse)
RP154535 100 ug Ask for price

NOL9 ORF Vector (Human) (pORF)
ORF013894 1.0 ug DNA
EUR 354

Nol9 ORF Vector (Mouse) (pORF)
ORF051512 1.0 ug DNA
EUR 506

Nol9 ORF Vector (Mouse) (pORF)
ORF051513 1.0 ug DNA
EUR 506

Nol9 sgRNA CRISPR Lentivector set (Mouse)
K4769401 3 x 1.0 ug
EUR 339

NOL9 sgRNA CRISPR Lentivector set (Human)
K1439401 3 x 1.0 ug
EUR 339

Human Nucleolar Protein 9 (NOL9) ELISA Kit
abx381843-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Nol9 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4769402 1.0 ug DNA
EUR 154

Nol9 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4769403 1.0 ug DNA
EUR 154

Nol9 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4769404 1.0 ug DNA
EUR 154

NOL9 sgRNA CRISPR Lentivector (Human) (Target 1)
K1439402 1.0 ug DNA
EUR 154

NOL9 sgRNA CRISPR Lentivector (Human) (Target 2)
K1439403 1.0 ug DNA
EUR 154

NOL9 sgRNA CRISPR Lentivector (Human) (Target 3)
K1439404 1.0 ug DNA
EUR 154

NOL9 Protein Vector (Mouse) (pPB-C-His)
PV206046 500 ng
EUR 1065

NOL9 Protein Vector (Mouse) (pPB-N-His)
PV206047 500 ng
EUR 1065

NOL9 Protein Vector (Mouse) (pPM-C-HA)
PV206048 500 ng
EUR 1065

NOL9 Protein Vector (Mouse) (pPM-C-His)
PV206049 500 ng
EUR 1065

NOL9 Protein Vector (Mouse) (pPB-C-His)
PV206050 500 ng
EUR 1065

NOL9 Protein Vector (Mouse) (pPB-N-His)
PV206051 500 ng
EUR 1065

NOL9 Protein Vector (Mouse) (pPM-C-HA)
PV206052 500 ng
EUR 1065

NOL9 Protein Vector (Mouse) (pPM-C-His)
PV206053 500 ng
EUR 1065

Human Nucleolar Protein 9(NOL9)ELISA Kit
QY-E03186 96T
EUR 361

NOL9 Protein Vector (Human) (pPB-C-His)
PV055573 500 ng
EUR 481

NOL9 Protein Vector (Human) (pPB-N-His)
PV055574 500 ng
EUR 481

NOL9 Protein Vector (Human) (pPM-C-HA)
PV055575 500 ng
EUR 481

NOL9 Protein Vector (Human) (pPM-C-His)
PV055576 500 ng
EUR 481

Nol9 3'UTR Luciferase Stable Cell Line
TU214075 1.0 ml Ask for price

Nol9 3'UTR GFP Stable Cell Line
TU264075 1.0 ml Ask for price

NOL9 3'UTR GFP Stable Cell Line
TU065809 1.0 ml
EUR 2333

NOL9 3'UTR Luciferase Stable Cell Line
TU015809 1.0 ml
EUR 2333

GAPDH Rabbit Polyclonal Antibody
37985-100ul 100ul
EUR 252

GAPDH Rabbit Polyclonal Antibody
37985-50ul 50ul
EUR 187

EFHD1 Rabbit Polyclonal Antibody
38001-100ul 100ul
EUR 252

EFHD1 Rabbit Polyclonal Antibody
38001-50ul 50ul
EUR 187

Alliinase Rabbit Polyclonal Antibody
38042-100ul 100ul
EUR 252

Alliinase Rabbit Polyclonal Antibody
38042-50ul 50ul
EUR 187

ECFP Rabbit Polyclonal Antibody
38077-100ul 100ul
EUR 252

ECFP Rabbit Polyclonal Antibody
38077-50ul 50ul
EUR 187

EYFP Rabbit Polyclonal Antibody
38078-100ul 100ul
EUR 252

EYFP Rabbit Polyclonal Antibody
38078-50ul 50ul
EUR 187

mOrange Rabbit Polyclonal Antibody
38079-100ul 100ul
EUR 252

mOrange Rabbit Polyclonal Antibody
38079-50ul 50ul
EUR 187

mStrawberry Rabbit Polyclonal Antibody
38083-100ul 100ul
EUR 252

mStrawberry Rabbit Polyclonal Antibody
38083-50ul 50ul
EUR 187

AmCyan Rabbit Polyclonal Antibody
38086-100ul 100ul
EUR 252

AmCyan Rabbit Polyclonal Antibody
38086-50ul 50ul
EUR 187

EBFP Rabbit Polyclonal Antibody
38087-100ul 100ul
EUR 252

EBFP Rabbit Polyclonal Antibody
38087-50ul 50ul
EUR 187

Vimentin Rabbit Polyclonal Antibody
38104-100ul 100ul
EUR 252

Vimentin Rabbit Polyclonal Antibody
38104-50ul 50ul
EUR 187

LDHD Rabbit Polyclonal Antibody
38105-100ul 100ul
EUR 252

LDHD Rabbit Polyclonal Antibody
38105-50ul 50ul
EUR 187

GAPDH Rabbit Polyclonal Antibody
A01021-005ml 0.05ml
EUR 147
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

NOL9 Rabbit Polyclonal Antibody