NOP14 Rabbit Polyclonal Antibody

NOP14 Polyclonal Antibody

ABP59496-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human NOP14 protein at amino acid sequence of 780-860
  • Applications tips:
Description: A polyclonal antibody for detection of NOP14 from Human, Mouse. This NOP14 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human NOP14 protein at amino acid sequence of 780-860

NOP14 Polyclonal Antibody

27397-100ul 100ul
EUR 252

NOP14 Polyclonal Antibody

27397-50ul 50ul
EUR 187

NOP14 Rabbit pAb

A10361-100ul 100 ul
EUR 308

NOP14 Rabbit pAb

A10361-200ul 200 ul
EUR 459

NOP14 Rabbit pAb

A10361-20ul 20 ul
EUR 183

NOP14 Rabbit pAb

A10361-50ul 50 ul
EUR 223

NOP14 Polyclonal Conjugated Antibody

C27397 100ul
EUR 397

NOP14 Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Anti-NOP14 antibody

STJ112398 100 µl
EUR 277
Description: This gene encodes a protein that plays a role in pre-18s rRNA processing and small ribosomal subunit assembly. The encoded protein may be involved in the regulation of pancreatic cancer cell proliferation and migration. Alternative splicing results in multiple transcript variants.

Anti-NOP14 antibody

STJ191113 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to NOP14


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

NOP14 cloning plasmid

CSB-CL015936HU-10ug 10ug
EUR 474
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2421
  • Sequence: atggcgaaggcgaagaaggtcggggcgcgaaggaaggcctccggggcgccggcgggagcgcgagggggcccggcgaaggccaactccaatccgttcgaggtgaaagttaacaggcagaagttccagatcctgggccggaagacgcgccacgacgtgggactgcccggggtgtctc
  • Show more
Description: A cloning plasmid for the NOP14 gene.

pDONR223-NOP14 Plasmid

PVTB00924 2 ug
EUR 356

Mouse NOP14 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human NOP14 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

pCD513B-1-NOP14 Plasmid

PVTB00924-4a 2 ug
EUR 356

NOP14 ORF Vector (Human) (pORF)

ORF007154 1.0 ug DNA
EUR 95

Nop14 ORF Vector (Rat) (pORF)

ORF071407 1.0 ug DNA
EUR 506

Nop14 ORF Vector (Mouse) (pORF)

ORF051523 1.0 ug DNA
EUR 506

NOP14 sgRNA CRISPR Lentivector set (Human)

K1440601 3 x 1.0 ug
EUR 339

Nop14 sgRNA CRISPR Lentivector set (Mouse)

K3839701 3 x 1.0 ug
EUR 339

Nop14 sgRNA CRISPR Lentivector set (Rat)

K6634701 3 x 1.0 ug
EUR 339

NOP14-AS1 ORF Vector (Human) (pORF)

ORF026175 1.0 ug DNA Ask for price

Human Nucleolar protein 14, NOP14 ELISA KIT

ELI-16701h 96 Tests
EUR 824

Mouse Nucleolar protein 14, Nop14 ELISA KIT

ELI-44673m 96 Tests
EUR 865

NOP14 sgRNA CRISPR Lentivector (Human) (Target 1)

K1440602 1.0 ug DNA
EUR 154

NOP14 sgRNA CRISPR Lentivector (Human) (Target 2)

K1440603 1.0 ug DNA
EUR 154

NOP14 sgRNA CRISPR Lentivector (Human) (Target 3)

K1440604 1.0 ug DNA
EUR 154

Nop14 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3839702 1.0 ug DNA
EUR 154

Nop14 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3839703 1.0 ug DNA
EUR 154

Nop14 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3839704 1.0 ug DNA
EUR 154

Nop14 sgRNA CRISPR Lentivector (Rat) (Target 1)

K6634702 1.0 ug DNA
EUR 154

Nop14 sgRNA CRISPR Lentivector (Rat) (Target 2)

K6634703 1.0 ug DNA
EUR 154

Nop14 sgRNA CRISPR Lentivector (Rat) (Target 3)

K6634704 1.0 ug DNA
EUR 154

NOP14 Protein Vector (Human) (pPB-C-His)

PV028613 500 ng
EUR 329

NOP14 Protein Vector (Human) (pPB-N-His)

PV028614 500 ng
EUR 329

NOP14 Protein Vector (Human) (pPM-C-HA)

PV028615 500 ng
EUR 329

NOP14 Protein Vector (Human) (pPM-C-His)

PV028616 500 ng
EUR 329

NOP14 Protein Vector (Mouse) (pPB-C-His)

PV206090 500 ng
EUR 1065

NOP14 Protein Vector (Mouse) (pPB-N-His)

PV206091 500 ng
EUR 1065

NOP14 Protein Vector (Mouse) (pPM-C-HA)

PV206092 500 ng
EUR 1065

NOP14 Protein Vector (Mouse) (pPM-C-His)

PV206093 500 ng
EUR 1065

NOP14 Protein Vector (Rat) (pPB-C-His)

PV285626 500 ng
EUR 603

NOP14 Protein Vector (Rat) (pPB-N-His)

PV285627 500 ng
EUR 603

NOP14 Protein Vector (Rat) (pPM-C-HA)

PV285628 500 ng
EUR 603

NOP14 Protein Vector (Rat) (pPM-C-His)

PV285629 500 ng
EUR 603

Nop14 3'UTR GFP Stable Cell Line

TU164208 1.0 ml Ask for price

NOP14 3'UTR Luciferase Stable Cell Line

TU015821 1.0 ml
EUR 1394

Nop14 3'UTR Luciferase Stable Cell Line

TU114208 1.0 ml Ask for price

NOP14 3'UTR GFP Stable Cell Line

TU065821 1.0 ml
EUR 1394

Nop14 3'UTR GFP Stable Cell Line

TU264081 1.0 ml Ask for price

Nop14 3'UTR Luciferase Stable Cell Line

TU214081 1.0 ml Ask for price

NOP14 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)

LV621619 1.0 ug DNA
EUR 682

NOP14 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)

LV621623 1.0 ug DNA
EUR 682

NOP14 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)

LV621624 1.0 ug DNA
EUR 682

VEGF Rabbit Polyclonal Antibody

ES8453-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

VEGF Rabbit Polyclonal Antibody

ES8453-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody

ES8454-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody

ES8454-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody

ES8455-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody

ES8455-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8456-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8456-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8457-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8457-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSC70 Rabbit Polyclonal Antibody

ES8558-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSC70 Rabbit Polyclonal Antibody

ES8558-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody

ES8559-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody

ES8559-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP90? Rabbit Polyclonal Antibody

ES8560-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSP90? Rabbit Polyclonal Antibody

ES8560-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

IkB ? Rabbit Polyclonal Antibody

ES8561-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

IkB ? Rabbit Polyclonal Antibody

ES8561-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JAK1 Rabbit Polyclonal Antibody

ES8562-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK1 Rabbit Polyclonal Antibody

ES8562-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK2 Rabbit Polyclonal Antibody

ES8563-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK2 Rabbit Polyclonal Antibody

ES8563-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JNK2 Rabbit Polyclonal Antibody

ES8564-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JNK2 Rabbit Polyclonal Antibody

ES8564-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JNK3 Rabbit Polyclonal Antibody

ES8565-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JNK3 Rabbit Polyclonal Antibody

ES8565-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

MEK2 Rabbit Polyclonal Antibody

ES8566-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC

NOP14 Rabbit Polyclonal Antibody