NOP14 Rabbit Polyclonal Antibody

NOP14 Polyclonal Antibody

ABP59496-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human NOP14 protein at amino acid sequence of 780-860
  • Applications tips:
Description: A polyclonal antibody for detection of NOP14 from Human, Mouse. This NOP14 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human NOP14 protein at amino acid sequence of 780-860

NOP14 Polyclonal Antibody

ES9955-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NOP14 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

NOP14 Polyclonal Antibody

ES9955-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NOP14 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

NOP14 Rabbit pAb

A10361-100ul 100 ul
EUR 308

NOP14 Rabbit pAb

A10361-200ul 200 ul
EUR 459

NOP14 Rabbit pAb

A10361-20ul 20 ul
EUR 183

NOP14 Rabbit pAb

A10361-50ul 50 ul
EUR 223

NOP14 Polyclonal Conjugated Antibody

C27397 100ul
EUR 397

NOP14 Antibody

20-abx126263
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Anti-NOP14 antibody

STJ112398 100 µl
EUR 277
Description: This gene encodes a protein that plays a role in pre-18s rRNA processing and small ribosomal subunit assembly. The encoded protein may be involved in the regulation of pancreatic cancer cell proliferation and migration. Alternative splicing results in multiple transcript variants.

Anti-NOP14 antibody

STJ191113 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to NOP14

NOP14 siRNA

20-abx926146
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

NOP14 siRNA

20-abx926147
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

NOP14 cloning plasmid

CSB-CL015936HU-10ug 10ug
EUR 474
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2421
  • Sequence: atggcgaaggcgaagaaggtcggggcgcgaaggaaggcctccggggcgccggcgggagcgcgagggggcccggcgaaggccaactccaatccgttcgaggtgaaagttaacaggcagaagttccagatcctgggccggaagacgcgccacgacgtgggactgcccggggtgtctc
  • Show more
Description: A cloning plasmid for the NOP14 gene.

pDONR223-NOP14 Plasmid

PVTB00924 2 ug
EUR 356

Mouse NOP14 shRNA Plasmid

20-abx978393
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human NOP14 shRNA Plasmid

20-abx955650
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

pCD513B-1-NOP14 Plasmid

PVTB00924-4a 2 ug
EUR 356

Nop14 ORF Vector (Rat) (pORF)

ORF071407 1.0 ug DNA
EUR 506

NOP14 ORF Vector (Human) (pORF)

ORF007154 1.0 ug DNA
EUR 95

Nop14 ORF Vector (Mouse) (pORF)

ORF051523 1.0 ug DNA
EUR 506

Nop14 sgRNA CRISPR Lentivector set (Rat)

K6634701 3 x 1.0 ug
EUR 339

Nop14 sgRNA CRISPR Lentivector set (Mouse)

K3839701 3 x 1.0 ug
EUR 339

NOP14 sgRNA CRISPR Lentivector set (Human)

K1440601 3 x 1.0 ug
EUR 339

NOP14-AS1 ORF Vector (Human) (pORF)

ORF026175 1.0 ug DNA Ask for price

Human Nucleolar protein 14, NOP14 ELISA KIT

ELI-16701h 96 Tests
EUR 824

Mouse Nucleolar protein 14, Nop14 ELISA KIT

ELI-44673m 96 Tests
EUR 865

Nop14 sgRNA CRISPR Lentivector (Rat) (Target 1)

K6634702 1.0 ug DNA
EUR 154

Nop14 sgRNA CRISPR Lentivector (Rat) (Target 2)

K6634703 1.0 ug DNA
EUR 154

Nop14 sgRNA CRISPR Lentivector (Rat) (Target 3)

K6634704 1.0 ug DNA
EUR 154

Nop14 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3839702 1.0 ug DNA
EUR 154

Nop14 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3839703 1.0 ug DNA
EUR 154

Nop14 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3839704 1.0 ug DNA
EUR 154

NOP14 sgRNA CRISPR Lentivector (Human) (Target 1)

K1440602 1.0 ug DNA
EUR 154

NOP14 sgRNA CRISPR Lentivector (Human) (Target 2)

K1440603 1.0 ug DNA
EUR 154

NOP14 sgRNA CRISPR Lentivector (Human) (Target 3)

K1440604 1.0 ug DNA
EUR 154

NOP14 Protein Vector (Mouse) (pPB-C-His)

PV206090 500 ng
EUR 1065

NOP14 Protein Vector (Mouse) (pPB-N-His)

PV206091 500 ng
EUR 1065

NOP14 Protein Vector (Mouse) (pPM-C-HA)

PV206092 500 ng
EUR 1065

NOP14 Protein Vector (Mouse) (pPM-C-His)

PV206093 500 ng
EUR 1065

NOP14 Protein Vector (Rat) (pPB-C-His)

PV285626 500 ng
EUR 603

NOP14 Protein Vector (Rat) (pPB-N-His)

PV285627 500 ng
EUR 603

NOP14 Protein Vector (Rat) (pPM-C-HA)

PV285628 500 ng
EUR 603

NOP14 Protein Vector (Rat) (pPM-C-His)

PV285629 500 ng
EUR 603

NOP14 Protein Vector (Human) (pPB-C-His)

PV028613 500 ng
EUR 329

NOP14 Protein Vector (Human) (pPB-N-His)

PV028614 500 ng
EUR 329

NOP14 Protein Vector (Human) (pPM-C-HA)

PV028615 500 ng
EUR 329

NOP14 Protein Vector (Human) (pPM-C-His)

PV028616 500 ng
EUR 329

Nop14 3'UTR Luciferase Stable Cell Line

TU114208 1.0 ml Ask for price

Nop14 3'UTR GFP Stable Cell Line

TU164208 1.0 ml Ask for price

Nop14 3'UTR Luciferase Stable Cell Line

TU214081 1.0 ml Ask for price

Nop14 3'UTR GFP Stable Cell Line

TU264081 1.0 ml Ask for price

NOP14 3'UTR GFP Stable Cell Line

TU065821 1.0 ml
EUR 1394

NOP14 3'UTR Luciferase Stable Cell Line

TU015821 1.0 ml
EUR 1394

NOP14 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)

LV621619 1.0 ug DNA
EUR 682

NOP14 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)

LV621623 1.0 ug DNA
EUR 682

NOP14 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)

LV621624 1.0 ug DNA
EUR 682

NOP14-AS1 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV)

LV771959 1.0 ug DNA Ask for price

NOP14-AS1 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV771963 1.0 ug DNA Ask for price

NOP14-AS1 Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a)

LV771964 1.0 ug DNA Ask for price

GAPDH Rabbit Polyclonal Antibody

37985-100ul 100ul
EUR 252

GAPDH Rabbit Polyclonal Antibody

37985-50ul 50ul
EUR 187

EFHD1 Rabbit Polyclonal Antibody

38001-100ul 100ul
EUR 252

EFHD1 Rabbit Polyclonal Antibody

38001-50ul 50ul
EUR 187

Alliinase Rabbit Polyclonal Antibody

38042-100ul 100ul
EUR 252

Alliinase Rabbit Polyclonal Antibody

38042-50ul 50ul
EUR 187

ECFP Rabbit Polyclonal Antibody

38077-100ul 100ul
EUR 252

ECFP Rabbit Polyclonal Antibody

38077-50ul 50ul
EUR 187

EYFP Rabbit Polyclonal Antibody

38078-100ul 100ul
EUR 252

EYFP Rabbit Polyclonal Antibody

38078-50ul 50ul
EUR 187

mOrange Rabbit Polyclonal Antibody

38079-100ul 100ul
EUR 252

mOrange Rabbit Polyclonal Antibody

38079-50ul 50ul
EUR 187

mStrawberry Rabbit Polyclonal Antibody

38083-100ul 100ul
EUR 252

mStrawberry Rabbit Polyclonal Antibody

38083-50ul 50ul
EUR 187

AmCyan Rabbit Polyclonal Antibody

38086-100ul 100ul
EUR 252

AmCyan Rabbit Polyclonal Antibody

38086-50ul 50ul
EUR 187

EBFP Rabbit Polyclonal Antibody

38087-100ul 100ul
EUR 252

EBFP Rabbit Polyclonal Antibody

38087-50ul 50ul
EUR 187

Vimentin Rabbit Polyclonal Antibody

38104-100ul 100ul
EUR 252

Vimentin Rabbit Polyclonal Antibody

38104-50ul 50ul
EUR 187

LDHD Rabbit Polyclonal Antibody

38105-100ul 100ul
EUR 252

LDHD Rabbit Polyclonal Antibody

38105-50ul 50ul
EUR 187

GAPDH Rabbit Polyclonal Antibody

A01021-005ml 0.05ml
EUR 147
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

GAPDH Rabbit Polyclonal Antibody

A01021-02ml 0.2ml
EUR 332
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

NOP14 Rabbit Polyclonal Antibody