NOSIP Polyclonal Antibody |
ABP59497-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Synthesized peptide derived from part region of human NOSIP protein at amino acid sequence of 220-300
- Applications tips:
|
Description: A polyclonal antibody for detection of NOSIP from Human, Mouse. This NOSIP antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human NOSIP protein at amino acid sequence of 220-300 |
NOSIP Polyclonal Antibody |
ABP59497-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from part region of human NOSIP protein at amino acid sequence of 220-300
- Applications tips:
|
Description: A polyclonal antibody for detection of NOSIP from Human, Mouse. This NOSIP antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human NOSIP protein at amino acid sequence of 220-300 |
NOSIP Polyclonal Antibody |
ABP59497-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human NOSIP protein at amino acid sequence of 220-300
- Applications tips:
|
Description: A polyclonal antibody for detection of NOSIP from Human, Mouse. This NOSIP antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human NOSIP protein at amino acid sequence of 220-300 |
NOSIP Rabbit pAb |
A10024-100ul |
Abclonal |
100 ul |
EUR 308 |
NOSIP Rabbit pAb |
A10024-200ul |
Abclonal |
200 ul |
EUR 459 |
NOSIP Rabbit pAb |
A10024-20ul |
Abclonal |
20 ul |
EUR 183 |
NOSIP Rabbit pAb |
A10024-50ul |
Abclonal |
50 ul |
EUR 223 |
Human Nitric Oxide Synthase Interacting Protein (NOSIP) ELISA Kit |
DLR-NOSIP-Hu-48T |
DL Develop |
48T |
EUR 479 |
- Should the Human Nitric Oxide Synthase Interacting Protein (NOSIP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Nitric Oxide Synthase Interacting Protein (NOSIP) in samples from tissue homogenates or other biological fluids. |
Human Nitric Oxide Synthase Interacting Protein (NOSIP) ELISA Kit |
DLR-NOSIP-Hu-96T |
DL Develop |
96T |
EUR 621 |
- Should the Human Nitric Oxide Synthase Interacting Protein (NOSIP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Nitric Oxide Synthase Interacting Protein (NOSIP) in samples from tissue homogenates or other biological fluids. |
Human Nitric Oxide Synthase Interacting Protein (NOSIP) ELISA Kit |
RD-NOSIP-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 478 |
Human Nitric Oxide Synthase Interacting Protein (NOSIP) ELISA Kit |
RD-NOSIP-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 662 |
Human Nitric Oxide Synthase Interacting Protein (NOSIP) ELISA Kit |
RDR-NOSIP-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 500 |
Human Nitric Oxide Synthase Interacting Protein (NOSIP) ELISA Kit |
RDR-NOSIP-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 692 |
NOSIP antibody |
70R-2310 |
Fitzgerald |
50 ug |
EUR 467 |
Description: Rabbit polyclonal NOSIP antibody raised against the N terminal of NOSIP |
NOSIP antibody |
70R-9442 |
Fitzgerald |
50 ug |
EUR 467 |
Description: Affinity purified rabbit polyclonal NOSIP antibody |
NOSIP Antibody |
47168-100ul |
SAB |
100ul |
EUR 252 |
NOSIP antibody |
22497-100ul |
SAB |
100ul |
EUR 390 |
NOSIP antibody |
70R-13464 |
Fitzgerald |
100 ul |
EUR 457 |
Description: Affinity purified Rabbit polyclonal NOSIP antibody |
Polyclonal NOSIP Antibody (N-term) |
APR17599G |
Leading Biology |
0.1ml |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human NOSIP (N-term). This antibody is tested and proven to work in the following applications: |
NOSIP Conjugated Antibody |
C47168 |
SAB |
100ul |
EUR 397 |
anti- NOSIP antibody |
FNab09881 |
FN Test |
100µg |
EUR 548.75 |
- Recommended dilution: WB: 1:500 - 1:2000
- Immunogen: NOSIP
- Uniprot ID: Q9Y314
- Gene ID: 51070
- Research Area: Signal Transduction
|
Description: Antibody raised against NOSIP |
Anti-NOSIP antibody |
STJ112064 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: The protein encoded by this gene may modulate the activity and localization of nitric oxide synthase (endothelial and neuronal) and thus nitric oxide production. Alternative splicing results in multiple transcript variants that encode the same protein. |
Anti-NOSIP antibody |
STJ191087 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to NOSIP |
NOSIP siRNA |
20-abx926165 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
NOSIP siRNA |
20-abx926166 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
anti-NOSIP |
YF-PA18824 |
Abfrontier |
50 ul |
EUR 363 |
Description: Mouse polyclonal to NOSIP |
anti-NOSIP |
YF-PA18825 |
Abfrontier |
50 ug |
EUR 363 |
Description: Mouse polyclonal to NOSIP |
NOSIP Blocking Peptide |
33R-5448 |
Fitzgerald |
100 ug |
EUR 180 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of NOSIP antibody, catalog no. 70R-2310 |
NOSIP Blocking Peptide |
33R-9499 |
Fitzgerald |
100 ug |
EUR 180 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of NOSIP antibody, catalog no. 70R-9442 |
NOSIP cloning plasmid |
CSB-CL897477HU1-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 906
- Sequence: atgacgcggcatggcaagaactgcaccgcaggggccgtctacacctaccacgagaagaagaaggacacagcggcctcgggctatgggacccagaacattcgactgagccgggatgccgtgaaggacttcgactgctgttgtctctccctgcagccttgccacgatcctgttgtcac
- Show more
|
Description: A cloning plasmid for the NOSIP gene. |
NOSIP cloning plasmid |
CSB-CL897477HU2-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 906
- Sequence: atgacgcggcatggcaagaactgcaccgcaggggccgtctacacctaccacgagaagaagaaggacacagcggcctcgggctatgggacccagaacattcgactgagccgggatgccgtgaaggacttcgactgctgttgtctctccctgcagccttgccacgatcctgttgtcac
- Show more
|
Description: A cloning plasmid for the NOSIP gene. |
Nitric Oxide Synthase Interacting Protein (NOSIP) Polyclonal Antibody (Human) |
4-PAA330Hu01 |
Cloud-Clone |
-
EUR 232.00
-
EUR 2272.00
-
EUR 571.00
-
EUR 288.00
-
EUR 207.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: NOSIP (Gly62~Ser295)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human Nitric Oxide Synthase Interacting Protein (NOSIP) |
Mouse NOSIP shRNA Plasmid |
20-abx975581 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Human NOSIP shRNA Plasmid |
20-abx959493 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
NOSIP Recombinant Protein (Human) |
RP021478 |
ABM |
100 ug |
Ask for price |
NOSIP Recombinant Protein (Human) |
RP021481 |
ABM |
100 ug |
Ask for price |
NOSIP Recombinant Protein (Rat) |
RP214244 |
ABM |
100 ug |
Ask for price |
NOSIP Recombinant Protein (Mouse) |
RP154595 |
ABM |
100 ug |
Ask for price |
NOSIP Recombinant Protein (Mouse) |
RP154598 |
ABM |
100 ug |
Ask for price |
Nitric Oxide Synthase Interacting Protein (NOSIP) Polyclonal Antibody (Human), APC |
4-PAA330Hu01-APC |
Cloud-Clone |
-
EUR 323.00
-
EUR 2951.00
-
EUR 831.00
-
EUR 407.00
-
EUR 209.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: NOSIP (Gly62~Ser295)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human Nitric Oxide Synthase Interacting Protein (NOSIP). This antibody is labeled with APC. |
Nitric Oxide Synthase Interacting Protein (NOSIP) Polyclonal Antibody (Human), Biotinylated |
4-PAA330Hu01-Biotin |
Cloud-Clone |
-
EUR 295.00
-
EUR 2222.00
-
EUR 668.00
-
EUR 357.00
-
EUR 212.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: NOSIP (Gly62~Ser295)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human Nitric Oxide Synthase Interacting Protein (NOSIP). This antibody is labeled with Biotin. |
Nitric Oxide Synthase Interacting Protein (NOSIP) Polyclonal Antibody (Human), Cy3 |
4-PAA330Hu01-Cy3 |
Cloud-Clone |
-
EUR 389.00
-
EUR 3893.00
-
EUR 1067.00
-
EUR 501.00
-
EUR 237.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: NOSIP (Gly62~Ser295)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human Nitric Oxide Synthase Interacting Protein (NOSIP). This antibody is labeled with Cy3. |
Nitric Oxide Synthase Interacting Protein (NOSIP) Polyclonal Antibody (Human), FITC |
4-PAA330Hu01-FITC |
Cloud-Clone |
-
EUR 278.00
-
EUR 2380.00
-
EUR 685.00
-
EUR 346.00
-
EUR 187.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: NOSIP (Gly62~Ser295)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human Nitric Oxide Synthase Interacting Protein (NOSIP). This antibody is labeled with FITC. |
Nitric Oxide Synthase Interacting Protein (NOSIP) Polyclonal Antibody (Human), HRP |
4-PAA330Hu01-HRP |
Cloud-Clone |
-
EUR 296.00
-
EUR 2574.00
-
EUR 737.00
-
EUR 369.00
-
EUR 198.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: NOSIP (Gly62~Ser295)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human Nitric Oxide Synthase Interacting Protein (NOSIP). This antibody is labeled with HRP. |
Nitric Oxide Synthase Interacting Protein (NOSIP) Polyclonal Antibody (Human), PE |
4-PAA330Hu01-PE |
Cloud-Clone |
-
EUR 278.00
-
EUR 2380.00
-
EUR 685.00
-
EUR 346.00
-
EUR 187.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: NOSIP (Gly62~Ser295)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human Nitric Oxide Synthase Interacting Protein (NOSIP). This antibody is labeled with PE. |
Nitric Oxide Synthase Interacting Protein (NOSIP) Polyclonal Antibody (Human), APC-Cy7 |
4-PAA330Hu01-APC-Cy7 |
Cloud-Clone |
-
EUR 526.00
-
EUR 5782.00
-
EUR 1543.00
-
EUR 695.00
-
EUR 299.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: NOSIP (Gly62~Ser295)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human Nitric Oxide Synthase Interacting Protein (NOSIP). This antibody is labeled with APC-Cy7. |
Nitric Oxide Synthase Interacting Protein (NOSIP) Antibody |
20-abx135942 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
Nitric Oxide Synthase Interacting Protein (NOSIP) Antibody |
20-abx104249 |
Abbexa |
-
EUR 398.00
-
EUR 133.00
-
EUR 1094.00
-
EUR 537.00
-
EUR 314.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Nitric Oxide Synthase Interacting Protein (NOSIP) Antibody |
abx029631-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
Nitric Oxide Synthase Interacting Protein (NOSIP) Antibody |
abx029631-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
Nitric Oxide Synthase Interacting Protein (NOSIP) Antibody |
20-abx173840 |
Abbexa |
|
|
|
NOSIP ORF Vector (Human) (pORF) |
ORF007160 |
ABM |
1.0 ug DNA |
EUR 95 |
NOSIP ORF Vector (Human) (pORF) |
ORF007161 |
ABM |
1.0 ug DNA |
EUR 95 |
Nosip ORF Vector (Rat) (pORF) |
ORF071416 |
ABM |
1.0 ug DNA |
EUR 506 |
Nosip ORF Vector (Mouse) (pORF) |
ORF051533 |
ABM |
1.0 ug DNA |
EUR 506 |
NOSIP Rabbit Polyclonal Antibody