NR0B2 Polyclonal Antibody |
ABP59520-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Synthesized peptide derived from part region of human NR0B2 protein at amino acid sequence of 30-110
- Applications tips:
|
Description: A polyclonal antibody for detection of NR0B2 from Human, Mouse, Rat. This NR0B2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human NR0B2 protein at amino acid sequence of 30-110 |
NR0B2 Polyclonal Antibody |
ABP59520-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from part region of human NR0B2 protein at amino acid sequence of 30-110
- Applications tips:
|
Description: A polyclonal antibody for detection of NR0B2 from Human, Mouse, Rat. This NR0B2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human NR0B2 protein at amino acid sequence of 30-110 |
NR0B2 Polyclonal Antibody |
ABP59520-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human NR0B2 protein at amino acid sequence of 30-110
- Applications tips:
|
Description: A polyclonal antibody for detection of NR0B2 from Human, Mouse, Rat. This NR0B2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human NR0B2 protein at amino acid sequence of 30-110 |
NR0B2 Polyclonal Antibody |
A60066 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: kits suitable for this type of research |
NR0B2 Rabbit pAb |
A1836-100ul |
Abclonal |
100 ul |
EUR 308 |
NR0B2 Rabbit pAb |
A1836-200ul |
Abclonal |
200 ul |
EUR 459 |
NR0B2 Rabbit pAb |
A1836-20ul |
Abclonal |
20 ul |
EUR 183 |
NR0B2 Rabbit pAb |
A1836-50ul |
Abclonal |
50 ul |
EUR 223 |
NR0B2 Rabbit pAb |
A16454-100ul |
Abclonal |
100 ul |
EUR 308 |
NR0B2 Rabbit pAb |
A16454-200ul |
Abclonal |
200 ul |
EUR 459 |
NR0B2 Rabbit pAb |
A16454-20ul |
Abclonal |
20 ul |
EUR 183 |
NR0B2 Rabbit pAb |
A16454-50ul |
Abclonal |
50 ul |
EUR 223 |
NR0B2 Antibody |
32460-100ul |
SAB |
100ul |
EUR 252 |
NR0B2 antibody |
22509-100ul |
SAB |
100ul |
EUR 390 |
NR0B2 antibody |
70R-1927 |
Fitzgerald |
50 ug |
EUR 467 |
Description: Rabbit polyclonal NR0B2 antibody raised against the N terminal of NR0B2 |
NR0B2 antibody |
70R-1928 |
Fitzgerald |
50 ug |
EUR 467 |
Description: Rabbit polyclonal NR0B2 antibody raised against the middle region of NR0B2 |
NR0B2 antibody |
70R-13571 |
Fitzgerald |
100 ul |
EUR 457 |
Description: Affinity purified Rabbit polyclonal NR0B2 antibody |
NR0B2 Antibody |
DF6648 |
Affbiotech |
200ul |
EUR 304 |
Description: NR0B2 Antibody detects endogenous levels of total NR0B2. |
NR0B2 Antibody |
1-CSB-PA624025LA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against NR0B2. Recognizes NR0B2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA |
NR0B2 Polyclonal Antibody, Biotin Conjugated |
A60067 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: fast delivery possible |
NR0B2 Polyclonal Antibody, FITC Conjugated |
A60068 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: reagents widely cited |
NR0B2 Polyclonal Antibody, HRP Conjugated |
A60069 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: Ask the seller for details |
NR0B2 Conjugated Antibody |
C32460 |
SAB |
100ul |
EUR 397 |
NR0B2 Antibody (HRP) |
20-abx307126 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
NR0B2 Antibody (FITC) |
20-abx307127 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
NR0B2 Antibody (Biotin) |
20-abx307128 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Anti-NR0B2 antibody |
STJ24808 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: The protein encoded by this gene is an unusual orphan receptor that contains a putative ligand-binding domain but lacks a conventional DNA-binding domain. The gene product is a member of the nuclear hormone receptor family, a group of transcription factors regulated by small hydrophobic hormones, a subset of which do not have known ligands and are referred to as orphan nuclear receptors. The protein has been shown to interact with retinoid and thyroid hormone receptors, inhibiting their ligand-dependent transcriptional activation. In addition, interaction with estrogen receptors has been demonstrated, leading to inhibition of function. Studies suggest that the protein represses nuclear hormone receptor-mediated transactivation via two separate steps: competition with coactivators and the direct effects of its transcriptional repressor function. |
Anti-NR0B2 antibody |
STJ191103 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to NR0B2 |
NR0B2 siRNA |
20-abx903639 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
NR0B2 siRNA |
20-abx926315 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
NR0B2 siRNA |
20-abx926316 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
anti-NR0B2 |
YF-PA15626 |
Abfrontier |
50 ug |
EUR 363 |
Description: Mouse polyclonal to NR0B2 |
anti-NR0B2 |
YF-PA25095 |
Abfrontier |
50 ul |
EUR 334 |
Description: Mouse polyclonal to NR0B2 |
NR0B2 Antibody, HRP conjugated |
1-CSB-PA624025LB01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against NR0B2. Recognizes NR0B2 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA |
NR0B2 Antibody, FITC conjugated |
1-CSB-PA624025LC01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against NR0B2. Recognizes NR0B2 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA |
NR0B2 Antibody, Biotin conjugated |
1-CSB-PA624025LD01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against NR0B2. Recognizes NR0B2 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA |
NR0B2 Blocking Peptide |
33R-1113 |
Fitzgerald |
100 ug |
EUR 180 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of SYT12 antibody, catalog no. 70R-9795 |
NR0B2 Blocking Peptide |
33R-8889 |
Fitzgerald |
100 ug |
EUR 180 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of NR0B2 antibody, catalog no. 70R-1927 |
NR0B2 Blocking Peptide |
DF6648-BP |
Affbiotech |
1mg |
EUR 195 |
NR0B2 cloning plasmid |
CSB-CL624025HU-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 774
- Sequence: atgagcaccagccaaccaggggcctgcccatgccagggagctgcaagccgccccgccattctctacgcacttctgagctccagcctcaaggctgtcccccgaccccgtagccgctgcctatgtaggcagcaccggcccgtccagctatgtgcacctcatcgcacctgccgggaggc
- Show more
|
Description: A cloning plasmid for the NR0B2 gene. |
Anti-NR0B2 (1A11) |
YF-MA16353 |
Abfrontier |
100 ug |
EUR 363 |
Description: Mouse monoclonal to NR0B2 |
Mouse NR0B2 shRNA Plasmid |
20-abx973574 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Rat NR0B2 shRNA Plasmid |
20-abx987445 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Human NR0B2 shRNA Plasmid |
20-abx955522 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
NR0B2 Recombinant Protein (Human) |
RP021583 |
ABM |
100 ug |
Ask for price |
NR0B2 Recombinant Protein (Rat) |
RP214427 |
ABM |
100 ug |
Ask for price |
NR0B2 Recombinant Protein (Mouse) |
RP154838 |
ABM |
100 ug |
Ask for price |
Monoclonal NR0B2 Antibody (monoclonal) (M01), Clone: 1A11 |
APR17594G |
Leading Biology |
0.1mg |
EUR 484 |
Description: A Monoclonal antibody against Human NR0B2 (monoclonal) (M01). The antibodies are raised in mouse and are from clone 1A11. This antibody is applicable in WB and IF, E |
NR0B2 ORF Vector (Human) (pORF) |
ORF007195 |
ABM |
1.0 ug DNA |
EUR 95 |
Nr0b2 ORF Vector (Rat) (pORF) |
ORF071477 |
ABM |
1.0 ug DNA |
EUR 506 |
Nr0b2 ORF Vector (Mouse) (pORF) |
ORF051614 |
ABM |
1.0 ug DNA |
EUR 506 |
NR0B2 ELISA Kit (Human) (OKCD00321) |
OKCD00321 |
Aviva Systems Biology |
96 Wells |
EUR 831 |
Description: Description of target: Acts as a transcriptional regulator. Acts as a negative regulator of receptor-dependent signaling pathways. Specifically inhibits transactivation of the nuclear receptor with whom it interacts. Inhibits transcriptional activity of NEUROD1 on E-box-containing promoter by interfering with the coactivation function of the p300/CBP-mediated trancription complex for NEUROD1.1 Publication
<p>Manually curated information for which there is published experimental evidence.</p>
<p><a href="/manual/evidences#ECO:0000269">More…</a></p> Manual assertion based on experiment iniRef.8"Orphan nuclear receptor small heterodimer partner, a novel corepressor for a basic helix-loop-helix transcription factor BETA2/neuroD."_x005F_x005F_x000D_Kim J.Y., Chu K., Kim H.J., Seong H.A., Park K.C., Sanyal S., Takeda J., Ha H., Shong M., Tsai M.J., Choi H.S._x005F_x005F_x000D_Mol. Endocrinol. 18:776-790(2004) [PubMed] [Europe PMC] [Abstract]Cited for: FUNCTION, HETERODIMERIZATION, INTERACTION WITH ID2 AND NEUROD1, SUBCELLULAR LOCATION. ;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.054 ng/mL |
NR0B2 sgRNA CRISPR Lentivector set (Human) |
K1454101 |
ABM |
3 x 1.0 ug |
EUR 339 |
Nr0b2 sgRNA CRISPR Lentivector set (Mouse) |
K4360501 |
ABM |
3 x 1.0 ug |
EUR 339 |
Nr0b2 sgRNA CRISPR Lentivector set (Rat) |
K7090401 |
ABM |
3 x 1.0 ug |
EUR 339 |
NR0B2 sgRNA CRISPR Lentivector (Human) (Target 1) |
K1454102 |
ABM |
1.0 ug DNA |
EUR 154 |
NR0B2 sgRNA CRISPR Lentivector (Human) (Target 2) |
K1454103 |
ABM |
1.0 ug DNA |
EUR 154 |
NR0B2 sgRNA CRISPR Lentivector (Human) (Target 3) |
K1454104 |
ABM |
1.0 ug DNA |
EUR 154 |
Nr0b2 sgRNA CRISPR Lentivector (Mouse) (Target 1) |
K4360502 |
ABM |
1.0 ug DNA |
EUR 154 |
Nr0b2 sgRNA CRISPR Lentivector (Mouse) (Target 2) |
K4360503 |
ABM |
1.0 ug DNA |
EUR 154 |
Nr0b2 sgRNA CRISPR Lentivector (Mouse) (Target 3) |
K4360504 |
ABM |
1.0 ug DNA |
EUR 154 |
Nr0b2 sgRNA CRISPR Lentivector (Rat) (Target 1) |
K7090402 |
ABM |
1.0 ug DNA |
EUR 154 |
Nr0b2 sgRNA CRISPR Lentivector (Rat) (Target 2) |
K7090403 |
ABM |
1.0 ug DNA |
EUR 154 |
Nr0b2 sgRNA CRISPR Lentivector (Rat) (Target 3) |
K7090404 |
ABM |
1.0 ug DNA |
EUR 154 |
NR0B2 Protein Vector (Human) (pPB-C-His) |
PV028777 |
ABM |
500 ng |
EUR 329 |
NR0B2 Protein Vector (Human) (pPB-N-His) |
PV028778 |
ABM |
500 ng |
EUR 329 |
NR0B2 Protein Vector (Human) (pPM-C-HA) |
PV028779 |
ABM |
500 ng |
EUR 329 |
NR0B2 Protein Vector (Human) (pPM-C-His) |
PV028780 |
ABM |
500 ng |
EUR 329 |
NR0B2 Rabbit Polyclonal Antibody