NR2C2 Polyclonal Antibody |
ABP59525-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human NR2C2 protein at amino acid sequence of 410-490
- Applications tips:
|
Description: A polyclonal antibody for detection of NR2C2 from Human, Mouse, Rat. This NR2C2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human NR2C2 protein at amino acid sequence of 410-490 |
NR2C2 Polyclonal Antibody |
ES9965-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against NR2C2 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA |
NR2C2 Polyclonal Antibody |
ES9965-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against NR2C2 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA |
NR2C2 Rabbit pAb |
A6422-100ul |
Abclonal |
100 ul |
EUR 308 |
NR2C2 Rabbit pAb |
A6422-200ul |
Abclonal |
200 ul |
EUR 459 |
NR2C2 Rabbit pAb |
A6422-20ul |
Abclonal |
20 ul |
EUR 183 |
NR2C2 Rabbit pAb |
A6422-50ul |
Abclonal |
50 ul |
EUR 223 |
NR2C2 antibody |
20R-2872 |
Fitzgerald |
100 ul |
EUR 349 |
Description: Rabbit polyclonal NR2C2 antibody |
NR2C2 antibody |
70R-1547 |
Fitzgerald |
100 ug |
EUR 377 |
Description: Rabbit polyclonal NR2C2 antibody raised against the C terminal of NR2C2 |
NR2C2 antibody |
38900-100ul |
SAB |
100ul |
EUR 252 |
NR2C2 Antibody |
DF2219 |
Affbiotech |
200ul |
EUR 304 |
Description: NR2C2 antibody detects endogenous levels of total NR2C2. |
NR2C2 Antibody |
DF8175 |
Affbiotech |
200ul |
EUR 304 |
Description: NR2C2 Antibody detects endogenous levels of total NR2C2. |
NR2C2 Antibody |
1-CSB-PA016052ESR1HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
|
Description: A polyclonal antibody against NR2C2. Recognizes NR2C2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200 |
NR2C2 antibody |
70R-5229 |
Fitzgerald |
50 ug |
EUR 467 |
Description: Rabbit polyclonal NR2C2 antibody raised against the N terminal of NR2C2 |
NR2C2 Conjugated Antibody |
C38900 |
SAB |
100ul |
EUR 397 |
anti- NR2C2 antibody |
FNab05841 |
FN Test |
100µg |
EUR 585 |
- Immunogen: nuclear receptor subfamily 2, group C, member 2
- Uniprot ID: P49116
- Gene ID: 7182
- Research Area: Signal Transduction, Metabolism, Developmental biology
|
Description: Antibody raised against NR2C2 |
Anti-NR2C2 antibody |
STJ28505 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: This gene encodes a protein that belongs to the nuclear hormone receptor family. Members of this family act as ligand-activated transcription factors and function in many biological processes such as development, cellular differentiation and homeostasis. The activated receptor/ligand complex is translocated to the nucleus where it binds to hormone response elements of target genes. The protein encoded by this gene plays a role in protecting cells from oxidative stress and damage induced by ionizing radiation. The lack of a similar gene in mouse results in growth retardation, severe spinal curvature, subfertility, premature aging, and prostatic intraepithelial neoplasia (PIN) development. Alternative splicing results in multiple transcript variants encoding different isoforms. |
Anti-NR2C2 antibody |
STJ191123 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to NR2C2 |
NR2C2 siRNA |
20-abx903647 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
NR2C2 siRNA |
20-abx926335 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
NR2C2 siRNA |
20-abx926336 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
anti-NR2C2 |
YF-PA15110 |
Abfrontier |
50 ul |
EUR 363 |
Description: Mouse polyclonal to NR2C2 |
anti-NR2C2 |
YF-PA15111 |
Abfrontier |
100 ug |
EUR 403 |
Description: Rabbit polyclonal to NR2C2 |
anti-NR2C2 |
YF-PA24892 |
Abfrontier |
50 ul |
EUR 334 |
Description: Mouse polyclonal to NR2C2 |
NR2C2 Blocking Peptide |
33R-4073 |
Fitzgerald |
100 ug |
EUR 180 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of NR2C2 antibody, catalog no. 70R-5229 |
NR2C2 Blocking Peptide |
33R-1445 |
Fitzgerald |
100 ug |
EUR 180 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of NR2C2 antibody, catalog no. 70R-1547 |
NR2C2 Blocking Peptide |
DF2219-BP |
Affbiotech |
1mg |
EUR 195 |
NR2C2 Blocking Peptide |
DF8175-BP |
Affbiotech |
1mg |
EUR 195 |
NR2C2 cloning plasmid |
CSB-CL016052HU-10ug |
Cusabio |
10ug |
EUR 556 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1593
- Sequence: atgaccagcccctccccacgcatccagataatctccaccgactctgctgtagcctcacctcagcgcattcagggctctgaacctgcctctggcccattgagtgttttcacatctttgaacaaagagaagattgtcacagaccagcagacaggacagaaaatccagatagtcaccg
- Show more
|
Description: A cloning plasmid for the NR2C2 gene. |
Anti-NR2C2 (2A5) |
YF-MA10970 |
Abfrontier |
100 ug |
EUR 363 |
Description: Mouse monoclonal to NR2C2 |
Mouse NR2C2 shRNA Plasmid |
20-abx973203 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Rat NR2C2 shRNA Plasmid |
20-abx985745 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Human NR2C2 shRNA Plasmid |
20-abx954932 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
NR2C2 Recombinant Protein (Human) |
RP021607 |
ABM |
100 ug |
Ask for price |
NR2C2 Recombinant Protein (Mouse) |
RP154892 |
ABM |
100 ug |
Ask for price |
NR2C2 Recombinant Protein (Rat) |
RP214457 |
ABM |
100 ug |
Ask for price |
Nr2c2 ORF Vector (Rat) (pORF) |
ORF071487 |
ABM |
1.0 ug DNA |
EUR 506 |
NR2C2 ORF Vector (Human) (pORF) |
ORF007203 |
ABM |
1.0 ug DNA |
EUR 95 |
Nr2c2 ORF Vector (Mouse) (pORF) |
ORF051632 |
ABM |
1.0 ug DNA |
EUR 506 |
Nr2c2 sgRNA CRISPR Lentivector set (Rat) |
K6870201 |
ABM |
3 x 1.0 ug |
EUR 339 |
Nr2c2 sgRNA CRISPR Lentivector set (Mouse) |
K4452001 |
ABM |
3 x 1.0 ug |
EUR 339 |
NR2C2 sgRNA CRISPR Lentivector set (Human) |
K1452201 |
ABM |
3 x 1.0 ug |
EUR 339 |
Nr2c2 sgRNA CRISPR Lentivector (Rat) (Target 1) |
K6870202 |
ABM |
1.0 ug DNA |
EUR 154 |
Nr2c2 sgRNA CRISPR Lentivector (Rat) (Target 2) |
K6870203 |
ABM |
1.0 ug DNA |
EUR 154 |
Nr2c2 sgRNA CRISPR Lentivector (Rat) (Target 3) |
K6870204 |
ABM |
1.0 ug DNA |
EUR 154 |
Nr2c2 sgRNA CRISPR Lentivector (Mouse) (Target 1) |
K4452002 |
ABM |
1.0 ug DNA |
EUR 154 |
Nr2c2 sgRNA CRISPR Lentivector (Mouse) (Target 2) |
K4452003 |
ABM |
1.0 ug DNA |
EUR 154 |
Nr2c2 sgRNA CRISPR Lentivector (Mouse) (Target 3) |
K4452004 |
ABM |
1.0 ug DNA |
EUR 154 |
NR2C2 sgRNA CRISPR Lentivector (Human) (Target 1) |
K1452202 |
ABM |
1.0 ug DNA |
EUR 154 |
NR2C2 sgRNA CRISPR Lentivector (Human) (Target 2) |
K1452203 |
ABM |
1.0 ug DNA |
EUR 154 |
NR2C2 sgRNA CRISPR Lentivector (Human) (Target 3) |
K1452204 |
ABM |
1.0 ug DNA |
EUR 154 |
NR2C2 Protein Vector (Rat) (pPB-C-His) |
PV285946 |
ABM |
500 ng |
EUR 603 |
NR2C2 Protein Vector (Rat) (pPB-N-His) |
PV285947 |
ABM |
500 ng |
EUR 603 |
NR2C2 Protein Vector (Rat) (pPM-C-HA) |
PV285948 |
ABM |
500 ng |
EUR 603 |
NR2C2 Protein Vector (Rat) (pPM-C-His) |
PV285949 |
ABM |
500 ng |
EUR 603 |
NR2C2 Protein Vector (Mouse) (pPB-C-His) |
PV206526 |
ABM |
500 ng |
EUR 603 |
NR2C2 Protein Vector (Mouse) (pPB-N-His) |
PV206527 |
ABM |
500 ng |
EUR 603 |
NR2C2 Protein Vector (Mouse) (pPM-C-HA) |
PV206528 |
ABM |
500 ng |
EUR 603 |
NR2C2 Protein Vector (Mouse) (pPM-C-His) |
PV206529 |
ABM |
500 ng |
EUR 603 |
NR2C2 Protein Vector (Human) (pPB-C-His) |
PV028809 |
ABM |
500 ng |
EUR 329 |
NR2C2 Protein Vector (Human) (pPB-N-His) |
PV028810 |
ABM |
500 ng |
EUR 329 |
NR2C2 Protein Vector (Human) (pPM-C-HA) |
PV028811 |
ABM |
500 ng |
EUR 329 |
NR2C2 Protein Vector (Human) (pPM-C-His) |
PV028812 |
ABM |
500 ng |
EUR 329 |
Recombinant Human NR2C2 Protein, His, E.coli-100ug |
QP8855-ec-100ug |
EnQuireBio |
100ug |
EUR 408 |
Recombinant Human NR2C2 Protein, His, E.coli-10ug |
QP8855-ec-10ug |
EnQuireBio |
10ug |
EUR 200 |
Recombinant Human NR2C2 Protein, His, E.coli-1mg |
QP8855-ec-1mg |
EnQuireBio |
1mg |
EUR 1632 |
Recombinant Human NR2C2 Protein, His, E.coli-200ug |
QP8855-ec-200ug |
EnQuireBio |
200ug |
EUR 634 |
Recombinant Human NR2C2 Protein, His, E.coli-500ug |
QP8855-ec-500ug |
EnQuireBio |
500ug |
EUR 1060 |
Recombinant Human NR2C2 Protein, His, E.coli-50ug |
QP8855-ec-50ug |
EnQuireBio |
50ug |
EUR 263 |
Nr2c2 3'UTR Luciferase Stable Cell Line |
TU114294 |
ABM |
1.0 ml |
Ask for price |
Nr2c2 3'UTR GFP Stable Cell Line |
TU164294 |
ABM |
1.0 ml |
Ask for price |
Nr2c2 3'UTR Luciferase Stable Cell Line |
TU214164 |
ABM |
1.0 ml |
Ask for price |
Nr2c2 3'UTR GFP Stable Cell Line |
TU264164 |
ABM |
1.0 ml |
Ask for price |
NR2C2 3'UTR GFP Stable Cell Line |
TU065940 |
ABM |
1.0 ml |
EUR 4617 |
NR2C2 3'UTR Luciferase Stable Cell Line |
TU015940 |
ABM |
1.0 ml |
EUR 4617 |
Nuclear Receptor Subfamily 2 Group C Member 2 (NR2C2) Antibody |
20-abx004915 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
Nuclear Receptor Subfamily 3, Group C, Member 2 (NR2C2) Antibody |
20-abx114197 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Nuclear Receptor Subfamily 2 Group C Member 2 (NR2C2) Antibody |
abx147000-100ug |
Abbexa |
100 ug |
EUR 439 |
- Shipped within 5-10 working days.
|
Nuclear Receptor Subfamily 2 Group C Member 2 (NR2C2) Antibody |
abx147131-100ug |
Abbexa |
100 ug |
EUR 439 |
- Shipped within 5-10 working days.
|
Nuclear Receptor Subfamily 2 Group C Member 2 (NR2C2) Antibody |
abx030944-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
Nuclear Receptor Subfamily 2 Group C Member 2 (NR2C2) Antibody |
abx030944-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
Nuclear Receptor Subfamily 2 Group C Member 2 (NR2C2) Antibody |
20-abx320475 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Nuclear Receptor Subfamily 2 Group C Member 2 (NR2C2) Antibody |
abx235841-100ug |
Abbexa |
100 ug |
EUR 551 |
- Shipped within 5-12 working days.
|
NR2C2 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV) |
LV662767 |
ABM |
1.0 ug DNA |
EUR 682 |
NR2C2 Rabbit Polyclonal Antibody