NR2C2 Rabbit Polyclonal Antibody

NR2C2 Polyclonal Antibody
ABP59525-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Synthesized peptide derived from part region of human NR2C2 protein at amino acid sequence of 410-490 Applications tips:
Description: A polyclonal antibody for detection of NR2C2 from Human, Mouse, Rat. This NR2C2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human NR2C2 protein at amino acid sequence of 410-490

NR2C2 Polyclonal Antibody
ES9965-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against NR2C2 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

NR2C2 Polyclonal Antibody
ES9965-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against NR2C2 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

NR2C2 Rabbit pAb
A6422-100ul	Abclonal	100 ul	EUR 308

NR2C2 Rabbit pAb
A6422-200ul	Abclonal	200 ul	EUR 459

NR2C2 Rabbit pAb
A6422-20ul	Abclonal	20 ul	EUR 183

NR2C2 Rabbit pAb
A6422-50ul	Abclonal	50 ul	EUR 223

NR2C2 antibody
20R-2872	Fitzgerald	100 ul	EUR 349
Description: Rabbit polyclonal NR2C2 antibody

NR2C2 antibody
70R-1547	Fitzgerald	100 ug	EUR 377
Description: Rabbit polyclonal NR2C2 antibody raised against the C terminal of NR2C2

NR2C2 antibody
38900-100ul	SAB	100ul	EUR 252

NR2C2 Antibody
DF2219	Affbiotech	200ul	EUR 304
Description: NR2C2 antibody detects endogenous levels of total NR2C2.

NR2C2 Antibody
DF8175	Affbiotech	200ul	EUR 304
Description: NR2C2 Antibody detects endogenous levels of total NR2C2.

NR2C2 Antibody
1-CSB-PA016052ESR1HU	Cusabio	EUR 222.00 EUR 335.00	100ul 50ul
Form: Liquid Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against NR2C2. Recognizes NR2C2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

NR2C2 antibody
70R-5229	Fitzgerald	50 ug	EUR 467
Description: Rabbit polyclonal NR2C2 antibody raised against the N terminal of NR2C2

NR2C2 Antibody
ABD2219	Lifescience Market	100 ug	EUR 438

NR2C2 Antibody
ABD8175	Lifescience Market	100 ug	EUR 438

NR2C2 Antibody
ABD8255	Lifescience Market	100 ug	EUR 438

Nr2c2/ Rat Nr2c2 ELISA Kit
ELI-15026r	Lifescience Market	96 Tests	EUR 886

NR2C2 Conjugated Antibody
C38900	SAB	100ul	EUR 397

anti- NR2C2 antibody
FNab05841	FN Test	100µg	EUR 585
Immunogen: nuclear receptor subfamily 2, group C, member 2 Uniprot ID: P49116 Gene ID: 7182 Research Area: Signal Transduction, Metabolism, Developmental biology
Description: Antibody raised against NR2C2

Anti-NR2C2 antibody
PAab05841	Lifescience Market	100 ug	EUR 412

Anti-NR2C2 antibody
STJ28505	St John's Laboratory	100 µl	EUR 277
Description: This gene encodes a protein that belongs to the nuclear hormone receptor family. Members of this family act as ligand-activated transcription factors and function in many biological processes such as development, cellular differentiation and homeostasis. The activated receptor/ligand complex is translocated to the nucleus where it binds to hormone response elements of target genes. The protein encoded by this gene plays a role in protecting cells from oxidative stress and damage induced by ionizing radiation. The lack of a similar gene in mouse results in growth retardation, severe spinal curvature, subfertility, premature aging, and prostatic intraepithelial neoplasia (PIN) development. Alternative splicing results in multiple transcript variants encoding different isoforms.

Anti-NR2C2 antibody
STJ191123	St John's Laboratory	200 µl	EUR 197
Description: Unconjugated Rabbit polyclonal to NR2C2

NR2C2 siRNA
20-abx903647	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

NR2C2 siRNA
20-abx926335	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

NR2C2 siRNA
20-abx926336	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

anti-NR2C2
YF-PA15110	Abfrontier	50 ul	EUR 363
Description: Mouse polyclonal to NR2C2

anti-NR2C2
YF-PA15111	Abfrontier	100 ug	EUR 403
Description: Rabbit polyclonal to NR2C2

anti-NR2C2
YF-PA24892	Abfrontier	50 ul	EUR 334
Description: Mouse polyclonal to NR2C2

NR2C2 Blocking Peptide
33R-4073	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of NR2C2 antibody, catalog no. 70R-5229

NR2C2 Blocking Peptide
33R-1445	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of NR2C2 antibody, catalog no. 70R-1547

NR2C2 Blocking Peptide
DF2219-BP	Affbiotech	1mg	EUR 195

NR2C2 Blocking Peptide
DF8175-BP	Affbiotech	1mg	EUR 195

NR2C2 cloning plasmid
CSB-CL016052HU-10ug	Cusabio	10ug	EUR 556
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1593 Sequence: atgaccagcccctccccacgcatccagataatctccaccgactctgctgtagcctcacctcagcgcattcagggctctgaacctgcctctggcccattgagtgttttcacatctttgaacaaagagaagattgtcacagaccagcagacaggacagaaaatccagatagtcaccg Show more
Description: A cloning plasmid for the NR2C2 gene.

pET32a-NR2C2 Plasmid
PVT14773	Lifescience Market	2 ug	EUR 370

Anti-NR2C2 (2A5)
YF-MA10970	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to NR2C2

Human NR2C2 ELISA Kit
ELA-E10644h	Lifescience Market	96 Tests	EUR 824

Mouse Nr2c2 ELISA KIT
ELI-21288m	Lifescience Market	96 Tests	EUR 865

NR2C2 ELISA KIT|Human
EF001317	Lifescience Market	96 Tests	EUR 689

Mouse NR2C2 shRNA Plasmid
20-abx973203	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Rat NR2C2 shRNA Plasmid
20-abx985745	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Human NR2C2 shRNA Plasmid
20-abx954932	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Human NR2C2 ELISA KIT
ELI-36908h	Lifescience Market	96 Tests	EUR 824

NR2C2 Recombinant Protein (Human)
RP021607	ABM	100 ug	Ask for price

NR2C2 Recombinant Protein (Mouse)
RP154892	ABM	100 ug	Ask for price

NR2C2 Recombinant Protein (Rat)
RP214457	ABM	100 ug	Ask for price

Nr2c2 ORF Vector (Rat) (pORF)
ORF071487	ABM	1.0 ug DNA	EUR 506

NR2C2 ORF Vector (Human) (pORF)
ORF007203	ABM	1.0 ug DNA	EUR 95

Nr2c2 ORF Vector (Mouse) (pORF)
ORF051632	ABM	1.0 ug DNA	EUR 506

NR2C2 ELISA Kit (Human) (OKEH07633)
OKEH07633	Aviva Systems Biology	96 Wells	EUR 896
Description: Description of target: This gene encodes a protein that belongs to the nuclear hormone receptor family. Members of this family act as ligand-activated transcription factors and function in many biological processes such as development, cellular differentiation and homeostasis. The activated receptor/ligand complex is translocated to the nucleus where it binds to hormone response elements of target genes. The protein encoded by this gene plays a role in protecting cells from oxidative stress and damage induced by ionizing radiation. The lack of a similar gene in mouse results in growth retardation, severe spinal curvature, subfertility, premature aging, and prostatic intraepithelial neoplasia (PIN) development. Alternative splicing results in multiple transcript variants encoding different isoforms.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.081ng/mL

Nr2c2 sgRNA CRISPR Lentivector set (Rat)
K6870201	ABM	3 x 1.0 ug	EUR 339

Nr2c2 sgRNA CRISPR Lentivector set (Mouse)
K4452001	ABM	3 x 1.0 ug	EUR 339

NR2C2 sgRNA CRISPR Lentivector set (Human)
K1452201	ABM	3 x 1.0 ug	EUR 339

Nr2c2 sgRNA CRISPR Lentivector (Rat) (Target 1)
K6870202	ABM	1.0 ug DNA	EUR 154

Nr2c2 sgRNA CRISPR Lentivector (Rat) (Target 2)
K6870203	ABM	1.0 ug DNA	EUR 154

Nr2c2 sgRNA CRISPR Lentivector (Rat) (Target 3)
K6870204	ABM	1.0 ug DNA	EUR 154

Nr2c2 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4452002	ABM	1.0 ug DNA	EUR 154

Nr2c2 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4452003	ABM	1.0 ug DNA	EUR 154

Nr2c2 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4452004	ABM	1.0 ug DNA	EUR 154

NR2C2 sgRNA CRISPR Lentivector (Human) (Target 1)
K1452202	ABM	1.0 ug DNA	EUR 154

NR2C2 sgRNA CRISPR Lentivector (Human) (Target 2)
K1452203	ABM	1.0 ug DNA	EUR 154

NR2C2 sgRNA CRISPR Lentivector (Human) (Target 3)
K1452204	ABM	1.0 ug DNA	EUR 154

NR2C2 Protein Vector (Rat) (pPB-C-His)
PV285946	ABM	500 ng	EUR 603

NR2C2 Protein Vector (Rat) (pPB-N-His)
PV285947	ABM	500 ng	EUR 603

NR2C2 Protein Vector (Rat) (pPM-C-HA)
PV285948	ABM	500 ng	EUR 603

NR2C2 Protein Vector (Rat) (pPM-C-His)
PV285949	ABM	500 ng	EUR 603

NR2C2 Protein Vector (Mouse) (pPB-C-His)
PV206526	ABM	500 ng	EUR 603

NR2C2 Protein Vector (Mouse) (pPB-N-His)
PV206527	ABM	500 ng	EUR 603

NR2C2 Protein Vector (Mouse) (pPM-C-HA)
PV206528	ABM	500 ng	EUR 603

NR2C2 Protein Vector (Mouse) (pPM-C-His)
PV206529	ABM	500 ng	EUR 603

NR2C2 Protein Vector (Human) (pPB-C-His)
PV028809	ABM	500 ng	EUR 329

NR2C2 Protein Vector (Human) (pPB-N-His)
PV028810	ABM	500 ng	EUR 329

NR2C2 Protein Vector (Human) (pPM-C-HA)
PV028811	ABM	500 ng	EUR 329

NR2C2 Protein Vector (Human) (pPM-C-His)
PV028812	ABM	500 ng	EUR 329

Recombinant Human NR2C2 Protein, His, E.coli-100ug
QP8855-ec-100ug	EnQuireBio	100ug	EUR 408

Recombinant Human NR2C2 Protein, His, E.coli-10ug
QP8855-ec-10ug	EnQuireBio	10ug	EUR 200

Recombinant Human NR2C2 Protein, His, E.coli-1mg
QP8855-ec-1mg	EnQuireBio	1mg	EUR 1632

Recombinant Human NR2C2 Protein, His, E.coli-200ug
QP8855-ec-200ug	EnQuireBio	200ug	EUR 634

Recombinant Human NR2C2 Protein, His, E.coli-500ug
QP8855-ec-500ug	EnQuireBio	500ug	EUR 1060

Recombinant Human NR2C2 Protein, His, E.coli-50ug
QP8855-ec-50ug	EnQuireBio	50ug	EUR 263

Nr2c2 3'UTR Luciferase Stable Cell Line
TU114294	ABM	1.0 ml	Ask for price

Nr2c2 3'UTR GFP Stable Cell Line
TU164294	ABM	1.0 ml	Ask for price

Nr2c2 3'UTR Luciferase Stable Cell Line
TU214164	ABM	1.0 ml	Ask for price

Nr2c2 3'UTR GFP Stable Cell Line
TU264164	ABM	1.0 ml	Ask for price

NR2C2 3'UTR GFP Stable Cell Line
TU065940	ABM	1.0 ml	EUR 4617

NR2C2 3'UTR Luciferase Stable Cell Line
TU015940	ABM	1.0 ml	EUR 4617

Nuclear Receptor Subfamily 2 Group C Member 2 (NR2C2) Antibody
20-abx004915	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

Nuclear Receptor Subfamily 3, Group C, Member 2 (NR2C2) Antibody
20-abx114197	Abbexa	EUR 732.00 EUR 398.00	150 ul 50 ul
Shipped within 5-10 working days.

Nuclear Receptor Subfamily 2 Group C Member 2 (NR2C2) Antibody
abx147000-100ug	Abbexa	100 ug	EUR 439
Shipped within 5-10 working days.

Nuclear Receptor Subfamily 2 Group C Member 2 (NR2C2) Antibody
abx147131-100ug	Abbexa	100 ug	EUR 439
Shipped within 5-10 working days.

Nuclear Receptor Subfamily 2 Group C Member 2 (NR2C2) Antibody
abx030944-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

Nuclear Receptor Subfamily 2 Group C Member 2 (NR2C2) Antibody
abx030944-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

Nuclear Receptor Subfamily 2 Group C Member 2 (NR2C2) Antibody
20-abx320475	Abbexa	EUR 300.00 EUR 244.00	100 ul 50 ul
Shipped within 5-10 working days.

Nuclear Receptor Subfamily 2 Group C Member 2 (NR2C2) Antibody
abx235841-100ug	Abbexa	100 ug	EUR 551
Shipped within 5-12 working days.

NR2C2 Rabbit Polyclonal Antibody