Biocat Net

Amine biocat 3.0

NRBP2 Rabbit Polyclonal Antibody

NRBP2 Polyclonal Antibody
ES9947-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NRBP2 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

NRBP2 Polyclonal Antibody
ES9947-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NRBP2 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

NRBP2 antibody
70R-18959 50 ul
EUR 435
Description: Rabbit polyclonal NRBP2 antibody

NRBP2 antibody
70R-2615 50 ug
EUR 467
Description: Rabbit polyclonal NRBP2 antibody raised against the middle region of NRBP2

NRBP2 Antibody
1-CSB-PA878883LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against NRBP2. Recognizes NRBP2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF, IP; Recommended dilution: IHC:1:20-1:200, IF:1:50-1:500, IP:1:200-1:2000

NRBP2 Antibody
1-CSB-PA016073GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against NRBP2. Recognizes NRBP2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

NRBP2 Polyclonal Antibody, HRP Conjugated
A67611 100 µg
EUR 570.55
Description: fast delivery possible

NRBP2 Polyclonal Antibody, FITC Conjugated
A67612 100 µg
EUR 570.55
Description: reagents widely cited

NRBP2 Polyclonal Antibody, Biotin Conjugated
A67613 100 µg
EUR 570.55
Description: Ask the seller for details

Mouse Nrbp2 Antibody
abx027975-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Mouse Nrbp2 Antibody
abx027975-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

anti- NRBP2 antibody
FNab05851 100µg
EUR 548.75
  • Immunogen: nuclear receptor binding protein 2
  • Uniprot ID: Q9NSY0
  • Gene ID: 340371
  • Research Area: Metabolism
Description: Antibody raised against NRBP2

Anti-NRBP2 antibody
PAab05851 100 ug
EUR 386

Anti-NRBP2 antibody
STJ191105 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to NRBP2

NRBP2 siRNA
20-abx926377
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

NRBP2 siRNA
20-abx926378
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

anti-NRBP2
YF-PA22994 50 ul
EUR 363
Description: Mouse polyclonal to NRBP2

anti-NRBP2
YF-PA27035 50 ul
EUR 334
Description: Mouse polyclonal to NRBP2

NRBP2 Antibody, HRP conjugated
1-CSB-PA878883LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against NRBP2. Recognizes NRBP2 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

NRBP2 Antibody, FITC conjugated
1-CSB-PA878883LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against NRBP2. Recognizes NRBP2 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

NRBP2 Antibody, Biotin conjugated
1-CSB-PA878883LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against NRBP2. Recognizes NRBP2 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

NRBP2 Blocking Peptide
33R-9607 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of NRBP2 antibody, catalog no. 70R-2615

NRBP2 cloning plasmid
CSB-CL878883HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 777
  • Sequence: ATGTGTGCGCTGGAGATGGCTGTACTGGAAATCCAGACCAATGGGGACACCCGGGTCACAGAGGAGGCCATTGCTCGCGCCAGGCACTCGCTGAGTGACCCCAACATGCGGGAGTTCATCCTTTGCTGCCTGGCCCGGGACCCTGCCCGCCGGCCCTCTGCCCACAGCCTCCTCTT
  • Show more
Description: A cloning plasmid for the NRBP2 gene.

Anti-NRBP2 (4D1)
YF-MA20110 100 ug
EUR 363
Description: Mouse monoclonal to NRBP2

Anti-NRBP2 (2D5)
YF-MA20111 100 ug
EUR 363
Description: Mouse monoclonal to NRBP2

NRBP2 ELISA KIT|Human
EF001325 96 Tests
EUR 689

Human NRBP2 shRNA Plasmid
20-abx967341
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse NRBP2 shRNA Plasmid
20-abx981272
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

NRBP2 Recombinant Protein (Human)
RP078774 100 ug Ask for price

NRBP2 Recombinant Protein (Mouse)
RP154976 100 ug Ask for price

NRBP2 Recombinant Protein (Rat)
RP214517 100 ug Ask for price

Nuclear Receptor Binding Protein 2 (NRBP2) Antibody
20-abx114184
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Nuclear Receptor Binding Factor 2 (NRBP2) Antibody
abx146243-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Nuclear Receptor Binding Factor 2 (NRBP2) Antibody
abx235851-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

Nuclear Receptor Binding Factor 2 (NRBP2) Antibody
20-abx311431
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Nuclear Receptor Binding Factor 2 (NRBP2) Antibody
20-abx002587
  • EUR 411.00
  • EUR 592.00
  • 100 ul
  • 200 ul
  • Shipped within 5-10 working days.

Nrbp2 ORF Vector (Rat) (pORF)
ORF071507 1.0 ug DNA
EUR 506

NRBP2 ORF Vector (Human) (pORF)
ORF026259 1.0 ug DNA
EUR 405

Nrbp2 ORF Vector (Mouse) (pORF)
ORF051660 1.0 ug DNA
EUR 506

Nuclear Receptor Binding Factor 2 (NRBP2) Antibody (HRP)
20-abx311432
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Nuclear Receptor Binding Factor 2 (NRBP2) Antibody (FITC)
20-abx311433
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Nuclear Receptor Binding Factor 2 (NRBP2) Antibody (Biotin)
20-abx311434
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Nrbp2 sgRNA CRISPR Lentivector set (Rat)
K6365901 3 x 1.0 ug
EUR 339

Nrbp2 sgRNA CRISPR Lentivector set (Mouse)
K4306001 3 x 1.0 ug
EUR 339

NRBP2 sgRNA CRISPR Lentivector set (Human)
K1454401 3 x 1.0 ug
EUR 339

Nrbp2 sgRNA CRISPR Lentivector (Rat) (Target 1)
K6365902 1.0 ug DNA
EUR 154

Nrbp2 sgRNA CRISPR Lentivector (Rat) (Target 2)
K6365903 1.0 ug DNA
EUR 154

Nrbp2 sgRNA CRISPR Lentivector (Rat) (Target 3)
K6365904 1.0 ug DNA
EUR 154

Nrbp2 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4306002 1.0 ug DNA
EUR 154

Nrbp2 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4306003 1.0 ug DNA
EUR 154

Nrbp2 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4306004 1.0 ug DNA
EUR 154

NRBP2 sgRNA CRISPR Lentivector (Human) (Target 1)
K1454402 1.0 ug DNA
EUR 154

NRBP2 sgRNA CRISPR Lentivector (Human) (Target 2)
K1454403 1.0 ug DNA
EUR 154

NRBP2 sgRNA CRISPR Lentivector (Human) (Target 3)
K1454404 1.0 ug DNA
EUR 154

NRBP2 Protein Vector (Human) (pPB-C-His)
PV105034 500 ng
EUR 552

NRBP2 Protein Vector (Human) (pPB-N-His)
PV105035 500 ng
EUR 552

NRBP2 Protein Vector (Human) (pPM-C-HA)
PV105036 500 ng
EUR 552

NRBP2 Protein Vector (Human) (pPM-C-His)
PV105037 500 ng
EUR 552

NRBP2 Protein Vector (Rat) (pPB-C-His)
PV286026 500 ng
EUR 603

NRBP2 Protein Vector (Rat) (pPB-N-His)
PV286027 500 ng
EUR 603

NRBP2 Protein Vector (Rat) (pPM-C-HA)
PV286028 500 ng
EUR 603

NRBP2 Protein Vector (Rat) (pPM-C-His)
PV286029 500 ng
EUR 603

NRBP2 Protein Vector (Mouse) (pPB-C-His)
PV206638 500 ng
EUR 603

NRBP2 Protein Vector (Mouse) (pPB-N-His)
PV206639 500 ng
EUR 603

NRBP2 Protein Vector (Mouse) (pPM-C-HA)
PV206640 500 ng
EUR 603

NRBP2 Protein Vector (Mouse) (pPM-C-His)
PV206641 500 ng
EUR 603

Nrbp2 3'UTR Luciferase Stable Cell Line
TU114315 1.0 ml Ask for price

Nrbp2 3'UTR GFP Stable Cell Line
TU164315 1.0 ml Ask for price

Nrbp2 3'UTR Luciferase Stable Cell Line
TU214183 1.0 ml Ask for price

Nrbp2 3'UTR GFP Stable Cell Line
TU264183 1.0 ml Ask for price

NRBP2 3'UTR GFP Stable Cell Line
TU065964 1.0 ml
EUR 1521

NRBP2 3'UTR Luciferase Stable Cell Line
TU015964 1.0 ml
EUR 1521

GAPDH Rabbit Polyclonal Antibody
37985-100ul 100ul
EUR 252

GAPDH Rabbit Polyclonal Antibody
37985-50ul 50ul
EUR 187

EFHD1 Rabbit Polyclonal Antibody
38001-100ul 100ul
EUR 252

EFHD1 Rabbit Polyclonal Antibody
38001-50ul 50ul
EUR 187

NRBP2 Rabbit Polyclonal Antibody