NRBP2 Polyclonal Antibody |
ABP59533-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human NRBP2 protein at amino acid sequence of 40-120
- Applications tips:
|
Description: A polyclonal antibody for detection of NRBP2 from Human, Mouse. This NRBP2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human NRBP2 protein at amino acid sequence of 40-120 |
NRBP2 Polyclonal Antibody |
A67610 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: kits suitable for this type of research |
NRBP2 antibody |
70R-2615 |
Fitzgerald |
50 ug |
EUR 467 |
Description: Rabbit polyclonal NRBP2 antibody raised against the middle region of NRBP2 |
NRBP2 antibody |
70R-18959 |
Fitzgerald |
50 ul |
EUR 435 |
Description: Rabbit polyclonal NRBP2 antibody |
NRBP2 Antibody |
1-CSB-PA878883LA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against NRBP2. Recognizes NRBP2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF, IP; Recommended dilution: IHC:1:20-1:200, IF:1:50-1:500, IP:1:200-1:2000 |
NRBP2 Antibody |
1-CSB-PA016073GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
|
Description: A polyclonal antibody against NRBP2. Recognizes NRBP2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB |
NRBP2 Polyclonal Antibody, HRP Conjugated |
A67611 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: fast delivery possible |
NRBP2 Polyclonal Antibody, FITC Conjugated |
A67612 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: reagents widely cited |
NRBP2 Polyclonal Antibody, Biotin Conjugated |
A67613 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: Ask the seller for details |
anti- NRBP2 antibody |
FNab05851 |
FN Test |
100µg |
EUR 548.75 |
- Immunogen: nuclear receptor binding protein 2
- Uniprot ID: Q9NSY0
- Gene ID: 340371
- Research Area: Metabolism
|
Description: Antibody raised against NRBP2 |
Mouse Nrbp2 Antibody |
abx027975-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
Mouse Nrbp2 Antibody |
abx027975-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
Anti-NRBP2 antibody |
STJ191105 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to NRBP2 |
NRBP2 siRNA |
20-abx926377 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
NRBP2 siRNA |
20-abx926378 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
anti-NRBP2 |
YF-PA22994 |
Abfrontier |
50 ul |
EUR 363 |
Description: Mouse polyclonal to NRBP2 |
anti-NRBP2 |
YF-PA27035 |
Abfrontier |
50 ul |
EUR 334 |
Description: Mouse polyclonal to NRBP2 |
NRBP2 Antibody, HRP conjugated |
1-CSB-PA878883LB01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against NRBP2. Recognizes NRBP2 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA |
NRBP2 Antibody, FITC conjugated |
1-CSB-PA878883LC01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against NRBP2. Recognizes NRBP2 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA |
NRBP2 Antibody, Biotin conjugated |
1-CSB-PA878883LD01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against NRBP2. Recognizes NRBP2 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA |
NRBP2 Blocking Peptide |
33R-9607 |
Fitzgerald |
100 ug |
EUR 180 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of NRBP2 antibody, catalog no. 70R-2615 |
NRBP2 cloning plasmid |
CSB-CL878883HU-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 777
- Sequence: ATGTGTGCGCTGGAGATGGCTGTACTGGAAATCCAGACCAATGGGGACACCCGGGTCACAGAGGAGGCCATTGCTCGCGCCAGGCACTCGCTGAGTGACCCCAACATGCGGGAGTTCATCCTTTGCTGCCTGGCCCGGGACCCTGCCCGCCGGCCCTCTGCCCACAGCCTCCTCTT
- Show more
|
Description: A cloning plasmid for the NRBP2 gene. |
Anti-NRBP2 (4D1) |
YF-MA20110 |
Abfrontier |
100 ug |
EUR 363 |
Description: Mouse monoclonal to NRBP2 |
Anti-NRBP2 (2D5) |
YF-MA20111 |
Abfrontier |
100 ug |
EUR 363 |
Description: Mouse monoclonal to NRBP2 |
Mouse NRBP2 shRNA Plasmid |
20-abx981272 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Human NRBP2 shRNA Plasmid |
20-abx967341 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
NRBP2 Recombinant Protein (Human) |
RP078774 |
ABM |
100 ug |
Ask for price |
NRBP2 Recombinant Protein (Rat) |
RP214517 |
ABM |
100 ug |
Ask for price |
NRBP2 Recombinant Protein (Mouse) |
RP154976 |
ABM |
100 ug |
Ask for price |
Nuclear Receptor Binding Protein 2 (NRBP2) Antibody |
20-abx114184 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Nuclear Receptor Binding Factor 2 (NRBP2) Antibody |
20-abx002587 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Nuclear Receptor Binding Factor 2 (NRBP2) Antibody |
abx146243-100ug |
Abbexa |
100 ug |
EUR 391 |
- Shipped within 5-10 working days.
|
Nuclear Receptor Binding Factor 2 (NRBP2) Antibody |
20-abx311431 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Nuclear Receptor Binding Factor 2 (NRBP2) Antibody |
abx235851-100ug |
Abbexa |
100 ug |
EUR 509 |
- Shipped within 5-12 working days.
|
NRBP2 ORF Vector (Human) (pORF) |
ORF026259 |
ABM |
1.0 ug DNA |
EUR 405 |
Nrbp2 ORF Vector (Rat) (pORF) |
ORF071507 |
ABM |
1.0 ug DNA |
EUR 506 |
Nrbp2 ORF Vector (Mouse) (pORF) |
ORF051660 |
ABM |
1.0 ug DNA |
EUR 506 |
Nuclear Receptor Binding Factor 2 (NRBP2) Antibody (HRP) |
20-abx311432 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Nuclear Receptor Binding Factor 2 (NRBP2) Antibody (FITC) |
20-abx311433 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Nuclear Receptor Binding Factor 2 (NRBP2) Antibody (Biotin) |
20-abx311434 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
NRBP2 sgRNA CRISPR Lentivector set (Human) |
K1454401 |
ABM |
3 x 1.0 ug |
EUR 339 |
Nrbp2 sgRNA CRISPR Lentivector set (Mouse) |
K4306001 |
ABM |
3 x 1.0 ug |
EUR 339 |
Nrbp2 sgRNA CRISPR Lentivector set (Rat) |
K6365901 |
ABM |
3 x 1.0 ug |
EUR 339 |
NRBP2 sgRNA CRISPR Lentivector (Human) (Target 1) |
K1454402 |
ABM |
1.0 ug DNA |
EUR 154 |
NRBP2 sgRNA CRISPR Lentivector (Human) (Target 2) |
K1454403 |
ABM |
1.0 ug DNA |
EUR 154 |
NRBP2 sgRNA CRISPR Lentivector (Human) (Target 3) |
K1454404 |
ABM |
1.0 ug DNA |
EUR 154 |
Nrbp2 sgRNA CRISPR Lentivector (Mouse) (Target 1) |
K4306002 |
ABM |
1.0 ug DNA |
EUR 154 |
Nrbp2 sgRNA CRISPR Lentivector (Mouse) (Target 2) |
K4306003 |
ABM |
1.0 ug DNA |
EUR 154 |
Nrbp2 sgRNA CRISPR Lentivector (Mouse) (Target 3) |
K4306004 |
ABM |
1.0 ug DNA |
EUR 154 |
Nrbp2 sgRNA CRISPR Lentivector (Rat) (Target 1) |
K6365902 |
ABM |
1.0 ug DNA |
EUR 154 |
Nrbp2 sgRNA CRISPR Lentivector (Rat) (Target 2) |
K6365903 |
ABM |
1.0 ug DNA |
EUR 154 |
Nrbp2 sgRNA CRISPR Lentivector (Rat) (Target 3) |
K6365904 |
ABM |
1.0 ug DNA |
EUR 154 |
NRBP2 Protein Vector (Human) (pPB-C-His) |
PV105034 |
ABM |
500 ng |
EUR 552 |
NRBP2 Protein Vector (Human) (pPB-N-His) |
PV105035 |
ABM |
500 ng |
EUR 552 |
NRBP2 Protein Vector (Human) (pPM-C-HA) |
PV105036 |
ABM |
500 ng |
EUR 552 |
NRBP2 Protein Vector (Human) (pPM-C-His) |
PV105037 |
ABM |
500 ng |
EUR 552 |
NRBP2 Protein Vector (Mouse) (pPB-C-His) |
PV206638 |
ABM |
500 ng |
EUR 603 |
NRBP2 Protein Vector (Mouse) (pPB-N-His) |
PV206639 |
ABM |
500 ng |
EUR 603 |
NRBP2 Protein Vector (Mouse) (pPM-C-HA) |
PV206640 |
ABM |
500 ng |
EUR 603 |
NRBP2 Protein Vector (Mouse) (pPM-C-His) |
PV206641 |
ABM |
500 ng |
EUR 603 |
NRBP2 Protein Vector (Rat) (pPB-C-His) |
PV286026 |
ABM |
500 ng |
EUR 603 |
NRBP2 Protein Vector (Rat) (pPB-N-His) |
PV286027 |
ABM |
500 ng |
EUR 603 |
NRBP2 Protein Vector (Rat) (pPM-C-HA) |
PV286028 |
ABM |
500 ng |
EUR 603 |
NRBP2 Protein Vector (Rat) (pPM-C-His) |
PV286029 |
ABM |
500 ng |
EUR 603 |
Nrbp2 3'UTR GFP Stable Cell Line |
TU164315 |
ABM |
1.0 ml |
Ask for price |
NRBP2 3'UTR Luciferase Stable Cell Line |
TU015964 |
ABM |
1.0 ml |
EUR 1521 |
Nrbp2 3'UTR Luciferase Stable Cell Line |
TU114315 |
ABM |
1.0 ml |
Ask for price |
NRBP2 3'UTR GFP Stable Cell Line |
TU065964 |
ABM |
1.0 ml |
EUR 1521 |
Nrbp2 3'UTR GFP Stable Cell Line |
TU264183 |
ABM |
1.0 ml |
Ask for price |
Nrbp2 3'UTR Luciferase Stable Cell Line |
TU214183 |
ABM |
1.0 ml |
Ask for price |
VEGF Rabbit Polyclonal Antibody |
ES8453-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
VEGF Rabbit Polyclonal Antibody |
ES8453-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
CD10 Rabbit Polyclonal Antibody |
ES8454-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
CD10 Rabbit Polyclonal Antibody |
ES8454-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NRBP2 Rabbit Polyclonal Antibody