NUP62 Polyclonal Antibody |
ABP59565-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from part region of human NUP62 protein at amino acid sequence of 300-380
- Applications tips:
|
Description: A polyclonal antibody for detection of NUP62 from Human, Mouse, Rat. This NUP62 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human NUP62 protein at amino acid sequence of 300-380 |
NUP62 Polyclonal Antibody |
ABP59565-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human NUP62 protein at amino acid sequence of 300-380
- Applications tips:
|
Description: A polyclonal antibody for detection of NUP62 from Human, Mouse, Rat. This NUP62 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human NUP62 protein at amino acid sequence of 300-380 |
Human Nucleoporin 62kDa (NUP62) ELISA Kit |
DLR-NUP62-Hu-48T |
DL Develop |
48T |
EUR 517 |
- Should the Human Nucleoporin 62kDa (NUP62) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Nucleoporin 62kDa (NUP62) in samples from tissue homogenates or other biological fluids. |
Human Nucleoporin 62kDa (NUP62) ELISA Kit |
DLR-NUP62-Hu-96T |
DL Develop |
96T |
EUR 673 |
- Should the Human Nucleoporin 62kDa (NUP62) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Nucleoporin 62kDa (NUP62) in samples from tissue homogenates or other biological fluids. |
Human Nucleoporin 62kDa (NUP62) ELISA Kit |
RD-NUP62-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 521 |
Human Nucleoporin 62kDa (NUP62) ELISA Kit |
RD-NUP62-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 723 |
Human Nucleoporin 62kDa (NUP62) ELISA Kit |
RDR-NUP62-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 544 |
Human Nucleoporin 62kDa (NUP62) ELISA Kit |
RDR-NUP62-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 756 |
NUP62 Rabbit pAb |
A2499-100ul |
Abclonal |
100 ul |
EUR 308 |
NUP62 Rabbit pAb |
A2499-200ul |
Abclonal |
200 ul |
EUR 459 |
NUP62 Rabbit pAb |
A2499-20ul |
Abclonal |
20 ul |
EUR 183 |
NUP62 Rabbit pAb |
A2499-50ul |
Abclonal |
50 ul |
EUR 223 |
NUP62 antibody |
70R-2086 |
Fitzgerald |
50 ug |
EUR 467 |
Description: Rabbit polyclonal NUP62 antibody raised against the N terminal of NUP62 |
NUP62 Antibody |
32676-100ul |
SAB |
100ul |
EUR 252 |
NUP62 antibody |
70R-19006 |
Fitzgerald |
50 ul |
EUR 435 |
Description: Rabbit polyclonal NUP62 antibody |
NUP62 Antibody |
DF6968 |
Affbiotech |
200ul |
EUR 304 |
Description: NUP62 Antibody detects endogenous levels of total NUP62. |
NUP62 Antibody |
1-CSB-PA255769 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
Description: A polyclonal antibody against NUP62. Recognizes NUP62 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:5000, WB:1:500-1:2000, IHC:1:50-1:200 |
NUP62 Antibody |
1-CSB-PA041313 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
Description: A polyclonal antibody against NUP62. Recognizes NUP62 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:5000, WB:1:500-1:2000, IHC:1:50-1:200 |
NUP62 Antibody |
1-CSB-PA016204GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20oC, Avoid freeze / thaw cycles. Antigen Affinity Purified
|
Description: A polyclonal antibody against NUP62. Recognizes NUP62 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB |
NUP62 Antibody |
1-CSB-PA016204LA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against NUP62. Recognizes NUP62 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IP; Recommended dilution: WB:1:500-1:5000, IHC:1:200-1:500, IP:1:200-1:2000 |
Polyclonal NUP62 Antibody (C-Term) |
APG00435G |
Leading Biology |
0.1mg |
EUR 484 |
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human NUP62 (C-Term). This antibody is tested and proven to work in the following applications: |
Polyclonal NUP62 Antibody (C-term E507) |
APR05916G |
Leading Biology |
0.1ml |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human NUP62 (C-term E507). This antibody is tested and proven to work in the following applications: |
NUP62 Conjugated Antibody |
C32676 |
SAB |
100ul |
EUR 397 |
anti- NUP62 antibody |
FNab05927 |
FN Test |
100µg |
EUR 505.25 |
- Recommended dilution: WB: 1:1000 - 1:2000
- IHC: 1:50 - 1:200
- Immunogen: nucleoporin 62kDa
- Uniprot ID: P37198
- Gene ID: 23636
- Research Area: Signal Transduction, Metabolism
|
Description: Antibody raised against NUP62 |
Anti-NUP62 antibody |
STJ24850 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: The nuclear pore complex is a massive structure that extends across the nuclear envelope, forming a gateway that regulates the flow of macromolecules between the nucleus and the cytoplasm. Nucleoporins are the main components of the nuclear pore complex in eukaryotic cells. The protein encoded by this gene is a member of the FG-repeat containing nucleoporins and is localized to the nuclear pore central plug. This protein associates with the importin alpha/beta complex which is involved in the import of proteins containing nuclear localization signals. Multiple transcript variants of this gene encode a single protein isoform. |
Anti-NUP62 antibody |
STJ191100 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to NUP62 |
Nucleoporin 62kDa (NUP62) Polyclonal Antibody (Human, Pig) |
4-PAC257Hu01 |
Cloud-Clone |
-
EUR 247.00
-
EUR 2510.00
-
EUR 625.00
-
EUR 310.00
-
EUR 214.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: NUP62 (Ala186~Lys432)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human, Pig Nucleoporin 62kDa (NUP62) |
NUP62 siRNA |
20-abx903709 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
NUP62 siRNA |
20-abx926643 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
NUP62 siRNA |
20-abx926644 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Nucleoporin 62 (NUP62) Antibody |
20-abx001943 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
Nucleoporin 62 (NUP62) Antibody |
20-abx142112 |
Abbexa |
-
EUR 370.00
-
EUR 606.00
-
EUR 314.00
|
|
- Shipped within 5-10 working days.
|
Nucleoporin 62 (NUP62) Antibody |
abx033433-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
Nucleoporin 62 (NUP62) Antibody |
abx033433-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
Nucleoporin 62 (NUP62) Antibody |
abx433060-200ul |
Abbexa |
200 ul |
EUR 286 |
- Shipped within 1-3 working days.
|
Nucleoporin 62 (NUP62) Antibody |
abx235927-100ug |
Abbexa |
100 ug |
EUR 481 |
- Shipped within 5-12 working days.
|
NUP62 Antibody, HRP conjugated |
1-CSB-PA016204LB01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against NUP62. Recognizes NUP62 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA |
NUP62 Antibody, FITC conjugated |
1-CSB-PA016204LC01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against NUP62. Recognizes NUP62 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA |
NUP62 Antibody, Biotin conjugated |
1-CSB-PA016204LD01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against NUP62. Recognizes NUP62 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA |
Nucleoporin 62kDa (NUP62) Polyclonal Antibody (Human, Pig), APC |
4-PAC257Hu01-APC |
Cloud-Clone |
-
EUR 345.00
-
EUR 3275.00
-
EUR 912.00
-
EUR 440.00
-
EUR 219.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: NUP62 (Ala186~Lys432)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human, Pig Nucleoporin 62kDa (NUP62). This antibody is labeled with APC. |
Nucleoporin 62kDa (NUP62) Polyclonal Antibody (Human, Pig), Biotinylated |
4-PAC257Hu01-Biotin |
Cloud-Clone |
-
EUR 311.00
-
EUR 2460.00
-
EUR 727.00
-
EUR 381.00
-
EUR 219.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: NUP62 (Ala186~Lys432)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human, Pig Nucleoporin 62kDa (NUP62). This antibody is labeled with Biotin. |
Nucleoporin 62kDa (NUP62) Polyclonal Antibody (Human, Pig), Cy3 |
4-PAC257Hu01-Cy3 |
Cloud-Clone |
-
EUR 419.00
-
EUR 4325.00
-
EUR 1175.00
-
EUR 545.00
-
EUR 251.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: NUP62 (Ala186~Lys432)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human, Pig Nucleoporin 62kDa (NUP62). This antibody is labeled with Cy3. |
Nucleoporin 62kDa (NUP62) Polyclonal Antibody (Human, Pig), FITC |
4-PAC257Hu01-FITC |
Cloud-Clone |
-
EUR 296.00
-
EUR 2640.00
-
EUR 750.00
-
EUR 372.00
-
EUR 195.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: NUP62 (Ala186~Lys432)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human, Pig Nucleoporin 62kDa (NUP62). This antibody is labeled with FITC. |
Nucleoporin 62kDa (NUP62) Polyclonal Antibody (Human, Pig), HRP |
4-PAC257Hu01-HRP |
Cloud-Clone |
-
EUR 316.00
-
EUR 2855.00
-
EUR 807.00
-
EUR 398.00
-
EUR 206.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: NUP62 (Ala186~Lys432)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human, Pig Nucleoporin 62kDa (NUP62). This antibody is labeled with HRP. |
Nucleoporin 62kDa (NUP62) Polyclonal Antibody (Human, Pig), PE |
4-PAC257Hu01-PE |
Cloud-Clone |
-
EUR 296.00
-
EUR 2640.00
-
EUR 750.00
-
EUR 372.00
-
EUR 195.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: NUP62 (Ala186~Lys432)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human, Pig Nucleoporin 62kDa (NUP62). This antibody is labeled with PE. |
Rabbit Nucleoporin 62 kDa (NUP62) ELISA Kit |
abx362930-96tests |
Abbexa |
96 tests |
EUR 825 |
- Shipped within 5-12 working days.
|
NUP62 cloning plasmid |
CSB-CL016204HU1-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1569
- Sequence: atgagcgggtttaattttggaggcactggggcccctacaggcgggttcacgtttggcactgcaaagacggcaacaaccacacctgctacagggttttctttctccacctctggcactggagggtttaattttggggctcccttccaaccagccacaagtaccccttccaccggcc
- Show more
|
Description: A cloning plasmid for the NUP62 gene. |
NUP62 cloning plasmid |
CSB-CL016204HU2-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1569
- Sequence: atgagcgggtttaattttggaggcactggggcccctacaggcgggttcacgtttggcactgcaaagacggcaacaaccacacctgctacagggttttctttctccacctctggcactggagggtttaattttggggctcccttccaaccagccacaagtaccccttccaccggcc
- Show more
|
Description: A cloning plasmid for the NUP62 gene. |
NUP62 Blocking Peptide |
33R-8456 |
Fitzgerald |
100 ug |
EUR 180 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of NUP62 antibody, catalog no. 70R-2086 |
NUP62 Blocking Peptide |
DF6968-BP |
Affbiotech |
1mg |
EUR 195 |
Nucleoporin 62 kDa (NUP62) Antibody |
20-abx114230 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Nucleoporin 62 kDa (NUP62) Antibody |
20-abx128968 |
Abbexa |
-
EUR 314.00
-
EUR 133.00
-
EUR 815.00
-
EUR 425.00
-
EUR 272.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Nucleoporin 62 kDa (NUP62) Antibody |
20-abx173878 |
Abbexa |
|
|
|
Nucleoporin 62 kDa (NUP62) Antibody |
20-abx242160 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Nucleoporin 62 kDa (NUP62) Antibody |
20-abx242161 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Nucleoporin 62kDa (NUP62) Polyclonal Antibody (Human, Pig), APC-Cy7 |
4-PAC257Hu01-APC-Cy7 |
Cloud-Clone |
-
EUR 571.00
-
EUR 6430.00
-
EUR 1705.00
-
EUR 760.00
-
EUR 319.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: NUP62 (Ala186~Lys432)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human, Pig Nucleoporin 62kDa (NUP62). This antibody is labeled with APC-Cy7. |
Rat NUP62 shRNA Plasmid |
20-abx986442 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Human NUP62 shRNA Plasmid |
20-abx958412 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Mouse NUP62 shRNA Plasmid |
20-abx971843 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
NUP62 Recombinant Protein (Human) |
RP021928 |
ABM |
100 ug |
Ask for price |
NUP62 Recombinant Protein (Human) |
RP021931 |
ABM |
100 ug |
Ask for price |
Recombinant Nucleoporin 62kDa (NUP62) |
4-RPC257Hu01 |
Cloud-Clone |
-
EUR 494.24
-
EUR 235.00
-
EUR 1578.40
-
EUR 592.80
-
EUR 1085.60
-
EUR 394.00
-
EUR 3796.00
|
-
100 ug
-
10ug
-
1 mg
-
200 ug
-
500 ug
-
50ug
-
5 mg
|
- Uniprot ID: P37198
- Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 30.0kDa
- Isoelectric Point: 5.8
|
Description: Recombinant Human Nucleoporin 62kDa expressed in: E.coli |
Recombinant Nucleoporin 62 (NUP62) |
4-RPC257Ra01 |
Cloud-Clone |
-
EUR 530.08
-
EUR 245.00
-
EUR 1712.80
-
EUR 637.60
-
EUR 1175.20
-
EUR 418.00
-
EUR 4132.00
|
-
100 ug
-
10ug
-
1 mg
-
200 ug
-
500 ug
-
50ug
-
5 mg
|
- Uniprot ID: P17955
- Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 56.7kDa
- Isoelectric Point: 5
|
Description: Recombinant Rat Nucleoporin 62 expressed in: E.coli |
NUP62 Recombinant Protein (Rat) |
RP214868 |
ABM |
100 ug |
Ask for price |
NUP62 Recombinant Protein (Mouse) |
RP155507 |
ABM |
100 ug |
Ask for price |
NUP62 Rabbit Polyclonal Antibody