NXPH2 Polyclonal Antibody |
ABP59567-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from part region of human NXPH2 protein at amino acid sequence of 140-220
- Applications tips:
|
Description: A polyclonal antibody for detection of NXPH2 from Human, Mouse. This NXPH2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human NXPH2 protein at amino acid sequence of 140-220 |
NXPH2 Polyclonal Antibody |
ABP59567-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human NXPH2 protein at amino acid sequence of 140-220
- Applications tips:
|
Description: A polyclonal antibody for detection of NXPH2 from Human, Mouse. This NXPH2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human NXPH2 protein at amino acid sequence of 140-220 |
NXPH2 Polyclonal Antibody |
A57429 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: kits suitable for this type of research |
NXPH2 antibody |
70R-50863 |
Fitzgerald |
100 ul |
EUR 244 |
Description: Purified Polyclonal NXPH2 antibody |
NXPH2 Antibody |
46080-100ul |
SAB |
100ul |
EUR 252 |
NXPH2 Antibody |
46080-50ul |
SAB |
50ul |
EUR 187 |
NXPH2 Antibody |
DF9683 |
Affbiotech |
200ul |
EUR 304 |
Description: NXPH2 Antibody detects endogenous levels of total NXPH2. |
NXPH2 Antibody |
1-CSB-PA016228LA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against NXPH2. Recognizes NXPH2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200 |
NXPH2 Polyclonal Antibody, HRP Conjugated |
A57430 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: fast delivery possible |
NXPH2 Polyclonal Antibody, FITC Conjugated |
A57431 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: reagents widely cited |
NXPH2 Polyclonal Antibody, Biotin Conjugated |
A57432 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: Ask the seller for details |
NXPH2 Conjugated Antibody |
C46080 |
SAB |
100ul |
EUR 397 |
NXPH2 Antibody (HRP) |
20-abx304692 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
NXPH2 Antibody (FITC) |
20-abx304693 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
NXPH2 Antibody (Biotin) |
20-abx304694 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Anti-NXPH2 antibody |
STJ191057 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to NXPH2 |
Polyclonal NXPH2 Antibody - C-terminal region |
AMM06877G |
Leading Biology |
0.05mg |
EUR 528 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human NXPH2 - C-terminal region. This antibody is tested and proven to work in the following applications: |
NXPH2 siRNA |
20-abx926698 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
NXPH2 siRNA |
20-abx926699 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Neurexophilin-2 (NXPH2) Antibody |
20-abx008273 |
Abbexa |
-
EUR 300.00
-
EUR 439.00
-
EUR 189.00
|
|
- Shipped within 5-10 working days.
|
Neurexophilin-2 (NXPH2) Antibody |
20-abx217298 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Neurexophilin-2 (NXPH2) Antibody |
20-abx301241 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
NXPH2 Antibody, HRP conjugated |
1-CSB-PA016228LB01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against NXPH2. Recognizes NXPH2 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA |
NXPH2 Antibody, FITC conjugated |
1-CSB-PA016228LC01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against NXPH2. Recognizes NXPH2 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA |
NXPH2 Antibody, Biotin conjugated |
1-CSB-PA016228LD01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against NXPH2. Recognizes NXPH2 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA |
NXPH2 cloning plasmid |
CSB-CL016228HU-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 795
- Sequence: ATGCGCCTGCGGCCGCTGCCCCTCGTGGTGGTCCCTGGCTTGCTGCAGCTGCTATTTTGTGACAGTAAGGAAGTGGTGCATGCCACGGAGGGGCTGGATTGGGAAGACAAAGATGCTCCAGGGACGTTGGTCGGCAACGTGGTGCACTCAAGGATCATCAGTCCCCTGCGCCTGTT
- Show more
|
Description: A cloning plasmid for the NXPH2 gene. |
NXPH2 Blocking Peptide |
20-abx063738 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
NXPH2 Rabbit Polyclonal Antibody