Biocat Net

Amine biocat 3.0

NXPH2 Rabbit Polyclonal Antibody

NXPH2 Polyclonal Antibody
ABP59567-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human NXPH2 protein at amino acid sequence of 140-220
  • Applications tips:
Description: A polyclonal antibody for detection of NXPH2 from Human, Mouse. This NXPH2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human NXPH2 protein at amino acid sequence of 140-220

NXPH2 Polyclonal Antibody
ABP59567-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human NXPH2 protein at amino acid sequence of 140-220
  • Applications tips:
Description: A polyclonal antibody for detection of NXPH2 from Human, Mouse. This NXPH2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human NXPH2 protein at amino acid sequence of 140-220

NXPH2 Polyclonal Antibody
A57429 100 µg
EUR 570.55
Description: kits suitable for this type of research

NXPH2 Antibody
ABD9683 100 ug
EUR 438

NXPH2 antibody
70R-50863 100 ul
EUR 244
Description: Purified Polyclonal NXPH2 antibody

NXPH2 Antibody
46080-100ul 100ul
EUR 252

NXPH2 Antibody
46080-50ul 50ul
EUR 187

NXPH2 Antibody
DF9683 200ul
EUR 304
Description: NXPH2 Antibody detects endogenous levels of total NXPH2.

NXPH2 Antibody
1-CSB-PA016228LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against NXPH2. Recognizes NXPH2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

NXPH2 Polyclonal Antibody, HRP Conjugated
A57430 100 µg
EUR 570.55
Description: fast delivery possible

NXPH2 Polyclonal Antibody, FITC Conjugated
A57431 100 µg
EUR 570.55
Description: reagents widely cited

NXPH2 Polyclonal Antibody, Biotin Conjugated
A57432 100 µg
EUR 570.55
Description: Ask the seller for details

NXPH2 Conjugated Antibody
C46080 100ul
EUR 397

NXPH2 Antibody (HRP)
20-abx304692
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

NXPH2 Antibody (FITC)
20-abx304693
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

NXPH2 Antibody (Biotin)
20-abx304694
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Anti-NXPH2 antibody
STJ191057 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to NXPH2

Polyclonal NXPH2 Antibody - C-terminal region
AMM06877G 0.05mg
EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human NXPH2 - C-terminal region. This antibody is tested and proven to work in the following applications:

NXPH2 siRNA
20-abx926698
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

NXPH2 siRNA
20-abx926699
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

Neurexophilin-2 (NXPH2) Antibody
20-abx008273
  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

Neurexophilin-2 (NXPH2) Antibody
20-abx217298
  • EUR 425.00
  • EUR 342.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Neurexophilin-2 (NXPH2) Antibody
20-abx301241
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

NXPH2 Antibody, HRP conjugated
1-CSB-PA016228LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against NXPH2. Recognizes NXPH2 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

NXPH2 Antibody, FITC conjugated
1-CSB-PA016228LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against NXPH2. Recognizes NXPH2 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

NXPH2 Antibody, Biotin conjugated
1-CSB-PA016228LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against NXPH2. Recognizes NXPH2 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

NXPH2 cloning plasmid
CSB-CL016228HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 795
  • Sequence: ATGCGCCTGCGGCCGCTGCCCCTCGTGGTGGTCCCTGGCTTGCTGCAGCTGCTATTTTGTGACAGTAAGGAAGTGGTGCATGCCACGGAGGGGCTGGATTGGGAAGACAAAGATGCTCCAGGGACGTTGGTCGGCAACGTGGTGCACTCAAGGATCATCAGTCCCCTGCGCCTGTT
  • Show more
Description: A cloning plasmid for the NXPH2 gene.

NXPH2 Blocking Peptide
20-abx063738
  • EUR 272.00
  • EUR 411.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.

NXPH2 Rabbit Polyclonal Antibody