P2RX1 Rabbit Polyclonal Antibody

P2RX1 Polyclonal Antibody
ES9967-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against P2RX1 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

P2RX1 Rabbit pAb
A11817-100ul	Abclonal	100 ul	EUR 308

P2RX1 Rabbit pAb
A11817-200ul	Abclonal	200 ul	EUR 459

P2RX1 Rabbit pAb
A11817-20ul	Abclonal	20 ul	Ask for price

P2RX1 Rabbit pAb
A11817-50ul	Abclonal	50 ul	Ask for price

P2RX1 Rabbit pAb
A7914-100ul	Abclonal	100 ul	EUR 308

P2RX1 Rabbit pAb
A7914-200ul	Abclonal	200 ul	EUR 459

P2RX1 Rabbit pAb
A7914-20ul	Abclonal	20 ul	EUR 183

P2RX1 Rabbit pAb
A7914-50ul	Abclonal	50 ul	EUR 223

P2RX1 antibody
70R-1546	Fitzgerald	100 ug	EUR 377
Description: Rabbit polyclonal P2RX1 antibody raised against the middle region of P2RX1

P2RX1 Antibody
46117-100ul	SAB	100ul	EUR 252

P2RX1 Antibody
46117-50ul	SAB	50ul	EUR 187

P2RX1 Antibody
DF9728	Affbiotech	200ul	EUR 304
Description: P2RX1 Antibody detects endogenous levels of total P2RX1.

P2RX1 Antibody
1-CSB-PA017319LA01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against P2RX1. Recognizes P2RX1 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:200-1:5000, IHC:1:20-1:200, IF:1:50-1:200

P2RX1 Antibody
ABD9728	Lifescience Market	100 ug	EUR 438

Polyclonal P2RX1 Antibody (C-term)
APR12644G	Leading Biology	0.1ml	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human P2RX1 (C-term). This antibody is tested and proven to work in the following applications:

P2RX1 Conjugated Antibody
C46117	SAB	100ul	EUR 397

Anti-P2RX1 antibody
STJ110223	St John's Laboratory	100 µl	EUR 277
Description: The protein encoded by this gene belongs to the P2X family of G-protein-coupled receptors. These proteins can form homo-and heterotimers and function as ATP-gated ion channels and mediate rapid and selective permeability to cations. This protein is primarily localized to smooth muscle where binds ATP and mediates synaptic transmission between neurons and from neurons to smooth muscle and may being responsible for sympathetic vasoconstriction in small arteries, arterioles and vas deferens. Mouse studies suggest that this receptor is essential for normal male reproductive function. This protein may also be involved in promoting apoptosis.

Anti-P2RX1 antibody
STJ113396	St John's Laboratory	100 µl	EUR 277
Description: The protein encoded by this gene belongs to the P2X family of G-protein-coupled receptors. These proteins can form homo-and heterotimers and function as ATP-gated ion channels and mediate rapid and selective permeability to cations. This protein is primarily localized to smooth muscle where binds ATP and mediates synaptic transmission between neurons and from neurons to smooth muscle and may being responsible for sympathetic vasoconstriction in small arteries, arterioles and vas deferens. Mouse studies suggest that this receptor is essential for normal male reproductive function. This protein may also be involved in promoting apoptosis.

Anti-P2RX1 antibody
STJ191125	St John's Laboratory	200 µl	EUR 197
Description: Unconjugated Rabbit polyclonal to P2RX1

P2rx1/ Rat P2rx1 ELISA Kit
ELI-44307r	Lifescience Market	96 Tests	EUR 886

P2RX1 siRNA
20-abx903797	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

P2RX1 siRNA
20-abx927524	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

P2RX1 siRNA
20-abx927525	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

P2RX1 Antibody, HRP conjugated
1-CSB-PA017319LB01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against P2RX1. Recognizes P2RX1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

P2RX1 Antibody, FITC conjugated
1-CSB-PA017319LC01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against P2RX1. Recognizes P2RX1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

P2RX1 Antibody, Biotin conjugated
1-CSB-PA017319LD01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against P2RX1. Recognizes P2RX1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

P2RX1 Blocking Peptide
33R-9880	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of P2RX1 antibody, catalog no. 70R-1546

P2RX1 Blocking Peptide
DF9728-BP	Affbiotech	1mg	EUR 195

P2RX1 cloning plasmid
CSB-CL017319HU1-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1200 Sequence: atggcacggcggttccaggaggagctggccgccttcctcttcgagtatgacaccccccgcatggtgctggtgcgtaataagaaggtgggcgttatcttccgactgatccagctggtggtcctggtctacgtcatcgggtgggtgtttctctatgagaagggctaccagacctcga Show more
Description: A cloning plasmid for the P2RX1 gene.

P2RX1 cloning plasmid
CSB-CL017319HU2-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 528 Sequence: atggcacggcggttccaggaggagctggccgccttcctcttcgagtatgacaccccccgcatggtgctggtgcgtaataagaaggtgggcgttatcttccgactgatccagctggtggtcctggtctacgtcatcgggtgggtgtttctctatgagaagggctaccagacctcgag Show more
Description: A cloning plasmid for the P2RX1 gene.

P2RX1 ELISA KIT|Human
EF007400	Lifescience Market	96 Tests	EUR 689

Mouse P2RX1 shRNA Plasmid
20-abx971906	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Rat P2RX1 shRNA Plasmid
20-abx985076	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Human P2RX1 shRNA Plasmid
20-abx953336	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

P2RX1 Recombinant Protein (Human)
RP022336	ABM	100 ug	Ask for price

P2RX1 Recombinant Protein (Human)
RP022339	ABM	100 ug	Ask for price

P2RX1 Recombinant Protein (Mouse)
RP159743	ABM	100 ug	Ask for price

P2RX1 Recombinant Protein (Rat)
RP219044	ABM	100 ug	Ask for price

P2RX1 Recombinant Protein (Rat)
RP219047	ABM	100 ug	Ask for price

Purinergic Receptor P2X 1 (P2RX1) Antibody
20-abx005663	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

Purinergic Receptor P2X 1 (P2RX1) Antibody
20-abx217583	Abbexa	EUR 425.00 EUR 342.00	100 ug 50 ug
Shipped within 5-10 working days.

Purinergic Receptor P2X 1 (P2RX1) Antibody
20-abx126991	Abbexa	EUR 411.00 EUR 592.00	100 ul 200 ul
Shipped within 5-10 working days.

Purinergic Receptor P2X 1 (P2RX1) Antibody
abx029072-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

Purinergic Receptor P2X 1 (P2RX1) Antibody
abx029072-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

Purinergic Receptor P2X 1 (P2RX1) Antibody
20-abx302267	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Purinergic Receptor P2X 1 (P2RX1) Antibody (HRP)
20-abx315898	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Purinergic Receptor P2X 1 (P2RX1) Antibody (FITC)
20-abx315899	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Purinergic Receptor P2X 1 (P2RX1) Antibody (Biotin)
20-abx315900	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

P2rx1 ORF Vector (Rat) (pORF)
ORF073016	ABM	1.0 ug DNA	EUR 506

P2rx1 ORF Vector (Rat) (pORF)
ORF073017	ABM	1.0 ug DNA	EUR 506

P2RX1 ORF Vector (Human) (pORF)
ORF007446	ABM	1.0 ug DNA	EUR 95

P2RX1 ORF Vector (Human) (pORF)
ORF007447	ABM	1.0 ug DNA	EUR 95

P2rx1 ORF Vector (Mouse) (pORF)
ORF053249	ABM	1.0 ug DNA	EUR 506

P2RX1 ELISA Kit (Human) (OKCA00747)
OKCA00747	Aviva Systems Biology	96 Wells	EUR 833
Description: Description of target: Ligand-gated ion channel with relatively high calcium permeability. Binding to ATP mediates synaptic transmission between neurons and from neurons to smooth muscle. Seems to be linked to apoptosis, by increasing the intracellular concentration of calcium in the presence of ATP, leading to programmed cell death.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.078 ng/mL

P2rx1 sgRNA CRISPR Lentivector set (Rat)
K6826701	ABM	3 x 1.0 ug	EUR 339

P2rx1 sgRNA CRISPR Lentivector set (Mouse)
K3656101	ABM	3 x 1.0 ug	EUR 339

P2RX1 sgRNA CRISPR Lentivector set (Human)
K1581201	ABM	3 x 1.0 ug	EUR 339

Human P2RX1(P2X purinoceptor 1) ELISA Kit
EH4227	FN Test	96T	EUR 524.1
Detection range: 0.156-10 ng/ml Uniprot ID: P51575 Alias: P2X1/ATP receptor|P2X purinoceptor 1|P2X receptor/subunit 1|P2X1 receptor|purinergic receptor P2X1
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.094 ng/ml

Mouse P2X purinoceptor 1, P2rx1 ELISA KIT
ELI-14696m	Lifescience Market	96 Tests	EUR 865

Human P2X purinoceptor 1, P2RX1 ELISA KIT
ELI-44306h	Lifescience Market	96 Tests	EUR 824

P2rx1 sgRNA CRISPR Lentivector (Rat) (Target 1)
K6826702	ABM	1.0 ug DNA	EUR 154

P2rx1 sgRNA CRISPR Lentivector (Rat) (Target 2)
K6826703	ABM	1.0 ug DNA	EUR 154

P2rx1 sgRNA CRISPR Lentivector (Rat) (Target 3)
K6826704	ABM	1.0 ug DNA	EUR 154

P2rx1 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K3656102	ABM	1.0 ug DNA	EUR 154

P2rx1 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K3656103	ABM	1.0 ug DNA	EUR 154

P2rx1 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K3656104	ABM	1.0 ug DNA	EUR 154

P2RX1 sgRNA CRISPR Lentivector (Human) (Target 1)
K1581202	ABM	1.0 ug DNA	EUR 154

P2RX1 sgRNA CRISPR Lentivector (Human) (Target 2)
K1581203	ABM	1.0 ug DNA	EUR 154

P2RX1 sgRNA CRISPR Lentivector (Human) (Target 3)
K1581204	ABM	1.0 ug DNA	EUR 154

P2RX1 Protein Vector (Rat) (pPB-C-His)
PV292062	ABM	500 ng	EUR 603

P2RX1 Protein Vector (Rat) (pPB-N-His)
PV292063	ABM	500 ng	EUR 603

P2RX1 Protein Vector (Rat) (pPM-C-HA)
PV292064	ABM	500 ng	EUR 603

P2RX1 Protein Vector (Rat) (pPM-C-His)
PV292065	ABM	500 ng	EUR 603

P2RX1 Protein Vector (Rat) (pPB-C-His)
PV292066	ABM	500 ng	EUR 603

P2RX1 Protein Vector (Rat) (pPB-N-His)
PV292067	ABM	500 ng	EUR 603

P2RX1 Protein Vector (Rat) (pPM-C-HA)
PV292068	ABM	500 ng	EUR 603

P2RX1 Protein Vector (Rat) (pPM-C-His)
PV292069	ABM	500 ng	EUR 603

P2RX1 Protein Vector (Mouse) (pPB-C-His)
PV212994	ABM	500 ng	EUR 603

P2RX1 Protein Vector (Mouse) (pPB-N-His)
PV212995	ABM	500 ng	EUR 603

P2RX1 Protein Vector (Mouse) (pPM-C-HA)
PV212996	ABM	500 ng	EUR 603

P2RX1 Protein Vector (Mouse) (pPM-C-His)
PV212997	ABM	500 ng	EUR 603

P2RX1 Protein Vector (Human) (pPB-C-His)
PV029781	ABM	500 ng	EUR 329

P2RX1 Protein Vector (Human) (pPB-N-His)
PV029782	ABM	500 ng	EUR 329

P2RX1 Protein Vector (Human) (pPM-C-HA)
PV029783	ABM	500 ng	EUR 329

P2RX1 Protein Vector (Human) (pPM-C-His)
PV029784	ABM	500 ng	EUR 329

P2RX1 Protein Vector (Human) (pPB-C-His)
PV029785	ABM	500 ng	EUR 329

P2RX1 Protein Vector (Human) (pPB-N-His)
PV029786	ABM	500 ng	EUR 329

P2RX1 Protein Vector (Human) (pPM-C-HA)
PV029787	ABM	500 ng	EUR 329

P2RX1 Protein Vector (Human) (pPM-C-His)
PV029788	ABM	500 ng	EUR 329

P2rx1 3'UTR Luciferase Stable Cell Line
TU115806	ABM	1.0 ml	Ask for price

P2rx1 3'UTR GFP Stable Cell Line
TU165806	ABM	1.0 ml	Ask for price

P2rx1 3'UTR GFP Stable Cell Line
TU265721	ABM	1.0 ml	Ask for price

P2rx1 3'UTR Luciferase Stable Cell Line
TU215721	ABM	1.0 ml	Ask for price

P2RX1 3'UTR GFP Stable Cell Line
TU067246	ABM	1.0 ml	EUR 1394

P2RX1 3'UTR Luciferase Stable Cell Line
TU017246	ABM	1.0 ml	EUR 1394

P2RX1 Rabbit Polyclonal Antibody