P2RX1 Rabbit Polyclonal Antibody

P2RX1 Polyclonal Antibody

ES9967-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against P2RX1 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

P2RX1 Rabbit pAb

A11817-100ul 100 ul
EUR 308

P2RX1 Rabbit pAb

A11817-200ul 200 ul
EUR 459

P2RX1 Rabbit pAb

A11817-20ul 20 ul Ask for price

P2RX1 Rabbit pAb

A11817-50ul 50 ul Ask for price

P2RX1 Rabbit pAb

A7914-100ul 100 ul
EUR 308

P2RX1 Rabbit pAb

A7914-200ul 200 ul
EUR 459

P2RX1 Rabbit pAb

A7914-20ul 20 ul
EUR 183

P2RX1 Rabbit pAb

A7914-50ul 50 ul
EUR 223

P2RX1 antibody

70R-1546 100 ug
EUR 377
Description: Rabbit polyclonal P2RX1 antibody raised against the middle region of P2RX1

P2RX1 Antibody

46117-100ul 100ul
EUR 252

P2RX1 Antibody

46117-50ul 50ul
EUR 187

P2RX1 Antibody

DF9728 200ul
EUR 304
Description: P2RX1 Antibody detects endogenous levels of total P2RX1.

P2RX1 Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against P2RX1. Recognizes P2RX1 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:200-1:5000, IHC:1:20-1:200, IF:1:50-1:200

P2RX1 Antibody

ABD9728 100 ug
EUR 438

Polyclonal P2RX1 Antibody (C-term)

APR12644G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human P2RX1 (C-term). This antibody is tested and proven to work in the following applications:

P2RX1 Conjugated Antibody

C46117 100ul
EUR 397

Anti-P2RX1 antibody

STJ110223 100 µl
EUR 277
Description: The protein encoded by this gene belongs to the P2X family of G-protein-coupled receptors. These proteins can form homo-and heterotimers and function as ATP-gated ion channels and mediate rapid and selective permeability to cations. This protein is primarily localized to smooth muscle where binds ATP and mediates synaptic transmission between neurons and from neurons to smooth muscle and may being responsible for sympathetic vasoconstriction in small arteries, arterioles and vas deferens. Mouse studies suggest that this receptor is essential for normal male reproductive function. This protein may also be involved in promoting apoptosis.

Anti-P2RX1 antibody

STJ113396 100 µl
EUR 277
Description: The protein encoded by this gene belongs to the P2X family of G-protein-coupled receptors. These proteins can form homo-and heterotimers and function as ATP-gated ion channels and mediate rapid and selective permeability to cations. This protein is primarily localized to smooth muscle where binds ATP and mediates synaptic transmission between neurons and from neurons to smooth muscle and may being responsible for sympathetic vasoconstriction in small arteries, arterioles and vas deferens. Mouse studies suggest that this receptor is essential for normal male reproductive function. This protein may also be involved in promoting apoptosis.

Anti-P2RX1 antibody

STJ191125 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to P2RX1

P2rx1/ Rat P2rx1 ELISA Kit

ELI-44307r 96 Tests
EUR 886


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

P2RX1 Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against P2RX1. Recognizes P2RX1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

P2RX1 Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against P2RX1. Recognizes P2RX1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

P2RX1 Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against P2RX1. Recognizes P2RX1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

P2RX1 Blocking Peptide

33R-9880 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of P2RX1 antibody, catalog no. 70R-1546

P2RX1 Blocking Peptide

DF9728-BP 1mg
EUR 195

P2RX1 cloning plasmid

CSB-CL017319HU1-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1200
  • Sequence: atggcacggcggttccaggaggagctggccgccttcctcttcgagtatgacaccccccgcatggtgctggtgcgtaataagaaggtgggcgttatcttccgactgatccagctggtggtcctggtctacgtcatcgggtgggtgtttctctatgagaagggctaccagacctcga
  • Show more
Description: A cloning plasmid for the P2RX1 gene.

P2RX1 cloning plasmid

CSB-CL017319HU2-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 528
  • Sequence: atggcacggcggttccaggaggagctggccgccttcctcttcgagtatgacaccccccgcatggtgctggtgcgtaataagaaggtgggcgttatcttccgactgatccagctggtggtcctggtctacgtcatcgggtgggtgtttctctatgagaagggctaccagacctcgag
  • Show more
Description: A cloning plasmid for the P2RX1 gene.


EF007400 96 Tests
EUR 689

Mouse P2RX1 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Rat P2RX1 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human P2RX1 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

P2RX1 Recombinant Protein (Human)

RP022336 100 ug Ask for price

P2RX1 Recombinant Protein (Human)

RP022339 100 ug Ask for price

P2RX1 Recombinant Protein (Mouse)

RP159743 100 ug Ask for price

P2RX1 Recombinant Protein (Rat)

RP219044 100 ug Ask for price

P2RX1 Recombinant Protein (Rat)

RP219047 100 ug Ask for price

Purinergic Receptor P2X 1 (P2RX1) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Purinergic Receptor P2X 1 (P2RX1) Antibody

  • EUR 425.00
  • EUR 342.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Purinergic Receptor P2X 1 (P2RX1) Antibody

  • EUR 411.00
  • EUR 592.00
  • 100 ul
  • 200 ul
  • Shipped within 5-10 working days.

Purinergic Receptor P2X 1 (P2RX1) Antibody

abx029072-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Purinergic Receptor P2X 1 (P2RX1) Antibody

abx029072-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Purinergic Receptor P2X 1 (P2RX1) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Purinergic Receptor P2X 1 (P2RX1) Antibody (HRP)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Purinergic Receptor P2X 1 (P2RX1) Antibody (FITC)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Purinergic Receptor P2X 1 (P2RX1) Antibody (Biotin)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

P2rx1 ORF Vector (Rat) (pORF)

ORF073016 1.0 ug DNA
EUR 506

P2rx1 ORF Vector (Rat) (pORF)

ORF073017 1.0 ug DNA
EUR 506

P2RX1 ORF Vector (Human) (pORF)

ORF007446 1.0 ug DNA
EUR 95

P2RX1 ORF Vector (Human) (pORF)

ORF007447 1.0 ug DNA
EUR 95

P2rx1 ORF Vector (Mouse) (pORF)

ORF053249 1.0 ug DNA
EUR 506

P2RX1 ELISA Kit (Human) (OKCA00747)

OKCA00747 96 Wells
EUR 833
Description: Description of target: Ligand-gated ion channel with relatively high calcium permeability. Binding to ATP mediates synaptic transmission between neurons and from neurons to smooth muscle. Seems to be linked to apoptosis, by increasing the intracellular concentration of calcium in the presence of ATP, leading to programmed cell death.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.078 ng/mL

P2rx1 sgRNA CRISPR Lentivector set (Rat)

K6826701 3 x 1.0 ug
EUR 339

P2rx1 sgRNA CRISPR Lentivector set (Mouse)

K3656101 3 x 1.0 ug
EUR 339

P2RX1 sgRNA CRISPR Lentivector set (Human)

K1581201 3 x 1.0 ug
EUR 339

Human P2RX1(P2X purinoceptor 1) ELISA Kit

EH4227 96T
EUR 524.1
  • Detection range: 0.156-10 ng/ml
  • Uniprot ID: P51575
  • Alias: P2X1/ATP receptor|P2X purinoceptor 1|P2X receptor/subunit 1|P2X1 receptor|purinergic receptor P2X1
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.094 ng/ml

Mouse P2X purinoceptor 1, P2rx1 ELISA KIT

ELI-14696m 96 Tests
EUR 865

Human P2X purinoceptor 1, P2RX1 ELISA KIT

ELI-44306h 96 Tests
EUR 824

P2rx1 sgRNA CRISPR Lentivector (Rat) (Target 1)

K6826702 1.0 ug DNA
EUR 154

P2rx1 sgRNA CRISPR Lentivector (Rat) (Target 2)

K6826703 1.0 ug DNA
EUR 154

P2rx1 sgRNA CRISPR Lentivector (Rat) (Target 3)

K6826704 1.0 ug DNA
EUR 154

P2rx1 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3656102 1.0 ug DNA
EUR 154

P2rx1 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3656103 1.0 ug DNA
EUR 154

P2rx1 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3656104 1.0 ug DNA
EUR 154

P2RX1 sgRNA CRISPR Lentivector (Human) (Target 1)

K1581202 1.0 ug DNA
EUR 154

P2RX1 sgRNA CRISPR Lentivector (Human) (Target 2)

K1581203 1.0 ug DNA
EUR 154

P2RX1 sgRNA CRISPR Lentivector (Human) (Target 3)

K1581204 1.0 ug DNA
EUR 154

P2RX1 Protein Vector (Rat) (pPB-C-His)

PV292062 500 ng
EUR 603

P2RX1 Protein Vector (Rat) (pPB-N-His)

PV292063 500 ng
EUR 603

P2RX1 Protein Vector (Rat) (pPM-C-HA)

PV292064 500 ng
EUR 603

P2RX1 Protein Vector (Rat) (pPM-C-His)

PV292065 500 ng
EUR 603

P2RX1 Protein Vector (Rat) (pPB-C-His)

PV292066 500 ng
EUR 603

P2RX1 Protein Vector (Rat) (pPB-N-His)

PV292067 500 ng
EUR 603

P2RX1 Protein Vector (Rat) (pPM-C-HA)

PV292068 500 ng
EUR 603

P2RX1 Protein Vector (Rat) (pPM-C-His)

PV292069 500 ng
EUR 603

P2RX1 Protein Vector (Mouse) (pPB-C-His)

PV212994 500 ng
EUR 603

P2RX1 Protein Vector (Mouse) (pPB-N-His)

PV212995 500 ng
EUR 603

P2RX1 Protein Vector (Mouse) (pPM-C-HA)

PV212996 500 ng
EUR 603

P2RX1 Protein Vector (Mouse) (pPM-C-His)

PV212997 500 ng
EUR 603

P2RX1 Protein Vector (Human) (pPB-C-His)

PV029781 500 ng
EUR 329

P2RX1 Protein Vector (Human) (pPB-N-His)

PV029782 500 ng
EUR 329

P2RX1 Protein Vector (Human) (pPM-C-HA)

PV029783 500 ng
EUR 329

P2RX1 Protein Vector (Human) (pPM-C-His)

PV029784 500 ng
EUR 329

P2RX1 Protein Vector (Human) (pPB-C-His)

PV029785 500 ng
EUR 329

P2RX1 Protein Vector (Human) (pPB-N-His)

PV029786 500 ng
EUR 329

P2RX1 Protein Vector (Human) (pPM-C-HA)

PV029787 500 ng
EUR 329

P2RX1 Protein Vector (Human) (pPM-C-His)

PV029788 500 ng
EUR 329

P2rx1 3'UTR Luciferase Stable Cell Line

TU115806 1.0 ml Ask for price

P2rx1 3'UTR GFP Stable Cell Line

TU165806 1.0 ml Ask for price

P2rx1 3'UTR GFP Stable Cell Line

TU265721 1.0 ml Ask for price

P2rx1 3'UTR Luciferase Stable Cell Line

TU215721 1.0 ml Ask for price

P2RX1 3'UTR GFP Stable Cell Line

TU067246 1.0 ml
EUR 1394

P2RX1 3'UTR Luciferase Stable Cell Line

TU017246 1.0 ml
EUR 1394

P2RX1 Rabbit Polyclonal Antibody