P2RX1 Polyclonal Antibody |
ES9967-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against P2RX1 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA |
P2RX1 Rabbit pAb |
A11817-100ul |
Abclonal |
100 ul |
EUR 308 |
P2RX1 Rabbit pAb |
A11817-200ul |
Abclonal |
200 ul |
EUR 459 |
P2RX1 Rabbit pAb |
A11817-20ul |
Abclonal |
20 ul |
Ask for price |
P2RX1 Rabbit pAb |
A11817-50ul |
Abclonal |
50 ul |
Ask for price |
P2RX1 Rabbit pAb |
A7914-100ul |
Abclonal |
100 ul |
EUR 308 |
P2RX1 Rabbit pAb |
A7914-200ul |
Abclonal |
200 ul |
EUR 459 |
P2RX1 Rabbit pAb |
A7914-20ul |
Abclonal |
20 ul |
EUR 183 |
P2RX1 Rabbit pAb |
A7914-50ul |
Abclonal |
50 ul |
EUR 223 |
P2RX1 antibody |
70R-1546 |
Fitzgerald |
100 ug |
EUR 377 |
Description: Rabbit polyclonal P2RX1 antibody raised against the middle region of P2RX1 |
P2RX1 Antibody |
46117-100ul |
SAB |
100ul |
EUR 252 |
P2RX1 Antibody |
46117-50ul |
SAB |
50ul |
EUR 187 |
P2RX1 Antibody |
DF9728 |
Affbiotech |
200ul |
EUR 304 |
Description: P2RX1 Antibody detects endogenous levels of total P2RX1. |
P2RX1 Antibody |
1-CSB-PA017319LA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against P2RX1. Recognizes P2RX1 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:200-1:5000, IHC:1:20-1:200, IF:1:50-1:200 |
Polyclonal P2RX1 Antibody (C-term) |
APR12644G |
Leading Biology |
0.1ml |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human P2RX1 (C-term). This antibody is tested and proven to work in the following applications: |
P2RX1 Conjugated Antibody |
C46117 |
SAB |
100ul |
EUR 397 |
Anti-P2RX1 antibody |
STJ110223 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: The protein encoded by this gene belongs to the P2X family of G-protein-coupled receptors. These proteins can form homo-and heterotimers and function as ATP-gated ion channels and mediate rapid and selective permeability to cations. This protein is primarily localized to smooth muscle where binds ATP and mediates synaptic transmission between neurons and from neurons to smooth muscle and may being responsible for sympathetic vasoconstriction in small arteries, arterioles and vas deferens. Mouse studies suggest that this receptor is essential for normal male reproductive function. This protein may also be involved in promoting apoptosis. |
Anti-P2RX1 antibody |
STJ113396 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: The protein encoded by this gene belongs to the P2X family of G-protein-coupled receptors. These proteins can form homo-and heterotimers and function as ATP-gated ion channels and mediate rapid and selective permeability to cations. This protein is primarily localized to smooth muscle where binds ATP and mediates synaptic transmission between neurons and from neurons to smooth muscle and may being responsible for sympathetic vasoconstriction in small arteries, arterioles and vas deferens. Mouse studies suggest that this receptor is essential for normal male reproductive function. This protein may also be involved in promoting apoptosis. |
Anti-P2RX1 antibody |
STJ191125 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to P2RX1 |
P2RX1 siRNA |
20-abx903797 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
P2RX1 siRNA |
20-abx927524 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
P2RX1 siRNA |
20-abx927525 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
P2RX1 Antibody, HRP conjugated |
1-CSB-PA017319LB01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against P2RX1. Recognizes P2RX1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA |
P2RX1 Antibody, FITC conjugated |
1-CSB-PA017319LC01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against P2RX1. Recognizes P2RX1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA |
P2RX1 Antibody, Biotin conjugated |
1-CSB-PA017319LD01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against P2RX1. Recognizes P2RX1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA |
P2RX1 Blocking Peptide |
33R-9880 |
Fitzgerald |
100 ug |
EUR 180 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of P2RX1 antibody, catalog no. 70R-1546 |
P2RX1 Blocking Peptide |
DF9728-BP |
Affbiotech |
1mg |
EUR 195 |
P2RX1 cloning plasmid |
CSB-CL017319HU1-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1200
- Sequence: atggcacggcggttccaggaggagctggccgccttcctcttcgagtatgacaccccccgcatggtgctggtgcgtaataagaaggtgggcgttatcttccgactgatccagctggtggtcctggtctacgtcatcgggtgggtgtttctctatgagaagggctaccagacctcga
- Show more
|
Description: A cloning plasmid for the P2RX1 gene. |
P2RX1 cloning plasmid |
CSB-CL017319HU2-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 528
- Sequence: atggcacggcggttccaggaggagctggccgccttcctcttcgagtatgacaccccccgcatggtgctggtgcgtaataagaaggtgggcgttatcttccgactgatccagctggtggtcctggtctacgtcatcgggtgggtgtttctctatgagaagggctaccagacctcgag
- Show more
|
Description: A cloning plasmid for the P2RX1 gene. |
Mouse P2RX1 shRNA Plasmid |
20-abx971906 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Rat P2RX1 shRNA Plasmid |
20-abx985076 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Human P2RX1 shRNA Plasmid |
20-abx953336 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
P2RX1 Recombinant Protein (Human) |
RP022336 |
ABM |
100 ug |
Ask for price |
P2RX1 Recombinant Protein (Human) |
RP022339 |
ABM |
100 ug |
Ask for price |
P2RX1 Recombinant Protein (Mouse) |
RP159743 |
ABM |
100 ug |
Ask for price |
P2RX1 Recombinant Protein (Rat) |
RP219044 |
ABM |
100 ug |
Ask for price |
P2RX1 Recombinant Protein (Rat) |
RP219047 |
ABM |
100 ug |
Ask for price |
Purinergic Receptor P2X 1 (P2RX1) Antibody |
20-abx005663 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
Purinergic Receptor P2X 1 (P2RX1) Antibody |
20-abx217583 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Purinergic Receptor P2X 1 (P2RX1) Antibody |
20-abx126991 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Purinergic Receptor P2X 1 (P2RX1) Antibody |
abx029072-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
Purinergic Receptor P2X 1 (P2RX1) Antibody |
abx029072-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
Purinergic Receptor P2X 1 (P2RX1) Antibody |
20-abx302267 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Purinergic Receptor P2X 1 (P2RX1) Antibody (HRP) |
20-abx315898 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Purinergic Receptor P2X 1 (P2RX1) Antibody (FITC) |
20-abx315899 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Purinergic Receptor P2X 1 (P2RX1) Antibody (Biotin) |
20-abx315900 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
P2rx1 ORF Vector (Rat) (pORF) |
ORF073016 |
ABM |
1.0 ug DNA |
EUR 506 |
P2rx1 ORF Vector (Rat) (pORF) |
ORF073017 |
ABM |
1.0 ug DNA |
EUR 506 |
P2RX1 ORF Vector (Human) (pORF) |
ORF007446 |
ABM |
1.0 ug DNA |
EUR 95 |
P2RX1 ORF Vector (Human) (pORF) |
ORF007447 |
ABM |
1.0 ug DNA |
EUR 95 |
P2rx1 ORF Vector (Mouse) (pORF) |
ORF053249 |
ABM |
1.0 ug DNA |
EUR 506 |
P2rx1 sgRNA CRISPR Lentivector set (Rat) |
K6826701 |
ABM |
3 x 1.0 ug |
EUR 339 |
P2rx1 sgRNA CRISPR Lentivector set (Mouse) |
K3656101 |
ABM |
3 x 1.0 ug |
EUR 339 |
P2RX1 sgRNA CRISPR Lentivector set (Human) |
K1581201 |
ABM |
3 x 1.0 ug |
EUR 339 |
Human P2RX1(P2X purinoceptor 1) ELISA Kit |
EH4227 |
FN Test |
96T |
EUR 524.1 |
- Detection range: 0.156-10 ng/ml
- Uniprot ID: P51575
- Alias: P2X1/ATP receptor|P2X purinoceptor 1|P2X receptor/subunit 1|P2X1 receptor|purinergic receptor P2X1
|
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.094 ng/ml |
P2rx1 sgRNA CRISPR Lentivector (Rat) (Target 1) |
K6826702 |
ABM |
1.0 ug DNA |
EUR 154 |
P2rx1 sgRNA CRISPR Lentivector (Rat) (Target 2) |
K6826703 |
ABM |
1.0 ug DNA |
EUR 154 |
P2rx1 sgRNA CRISPR Lentivector (Rat) (Target 3) |
K6826704 |
ABM |
1.0 ug DNA |
EUR 154 |
P2rx1 sgRNA CRISPR Lentivector (Mouse) (Target 1) |
K3656102 |
ABM |
1.0 ug DNA |
EUR 154 |
P2rx1 sgRNA CRISPR Lentivector (Mouse) (Target 2) |
K3656103 |
ABM |
1.0 ug DNA |
EUR 154 |
P2rx1 sgRNA CRISPR Lentivector (Mouse) (Target 3) |
K3656104 |
ABM |
1.0 ug DNA |
EUR 154 |
P2RX1 sgRNA CRISPR Lentivector (Human) (Target 1) |
K1581202 |
ABM |
1.0 ug DNA |
EUR 154 |
P2RX1 sgRNA CRISPR Lentivector (Human) (Target 2) |
K1581203 |
ABM |
1.0 ug DNA |
EUR 154 |
P2RX1 sgRNA CRISPR Lentivector (Human) (Target 3) |
K1581204 |
ABM |
1.0 ug DNA |
EUR 154 |
P2RX1 Protein Vector (Rat) (pPB-C-His) |
PV292062 |
ABM |
500 ng |
EUR 603 |
P2RX1 Protein Vector (Rat) (pPB-N-His) |
PV292063 |
ABM |
500 ng |
EUR 603 |
P2RX1 Protein Vector (Rat) (pPM-C-HA) |
PV292064 |
ABM |
500 ng |
EUR 603 |
P2RX1 Protein Vector (Rat) (pPM-C-His) |
PV292065 |
ABM |
500 ng |
EUR 603 |
P2RX1 Protein Vector (Rat) (pPB-C-His) |
PV292066 |
ABM |
500 ng |
EUR 603 |
P2RX1 Protein Vector (Rat) (pPB-N-His) |
PV292067 |
ABM |
500 ng |
EUR 603 |
P2RX1 Protein Vector (Rat) (pPM-C-HA) |
PV292068 |
ABM |
500 ng |
EUR 603 |
P2RX1 Protein Vector (Rat) (pPM-C-His) |
PV292069 |
ABM |
500 ng |
EUR 603 |
P2RX1 Protein Vector (Mouse) (pPB-C-His) |
PV212994 |
ABM |
500 ng |
EUR 603 |
P2RX1 Protein Vector (Mouse) (pPB-N-His) |
PV212995 |
ABM |
500 ng |
EUR 603 |
P2RX1 Protein Vector (Mouse) (pPM-C-HA) |
PV212996 |
ABM |
500 ng |
EUR 603 |
P2RX1 Protein Vector (Mouse) (pPM-C-His) |
PV212997 |
ABM |
500 ng |
EUR 603 |
P2RX1 Protein Vector (Human) (pPB-C-His) |
PV029781 |
ABM |
500 ng |
EUR 329 |
P2RX1 Protein Vector (Human) (pPB-N-His) |
PV029782 |
ABM |
500 ng |
EUR 329 |
P2RX1 Protein Vector (Human) (pPM-C-HA) |
PV029783 |
ABM |
500 ng |
EUR 329 |
P2RX1 Protein Vector (Human) (pPM-C-His) |
PV029784 |
ABM |
500 ng |
EUR 329 |
P2RX1 Protein Vector (Human) (pPB-C-His) |
PV029785 |
ABM |
500 ng |
EUR 329 |
P2RX1 Protein Vector (Human) (pPB-N-His) |
PV029786 |
ABM |
500 ng |
EUR 329 |
P2RX1 Protein Vector (Human) (pPM-C-HA) |
PV029787 |
ABM |
500 ng |
EUR 329 |
P2RX1 Protein Vector (Human) (pPM-C-His) |
PV029788 |
ABM |
500 ng |
EUR 329 |
P2rx1 3'UTR Luciferase Stable Cell Line |
TU115806 |
ABM |
1.0 ml |
Ask for price |
P2rx1 3'UTR GFP Stable Cell Line |
TU165806 |
ABM |
1.0 ml |
Ask for price |
P2rx1 3'UTR GFP Stable Cell Line |
TU265721 |
ABM |
1.0 ml |
Ask for price |
P2rx1 3'UTR Luciferase Stable Cell Line |
TU215721 |
ABM |
1.0 ml |
Ask for price |
P2RX1 3'UTR GFP Stable Cell Line |
TU067246 |
ABM |
1.0 ml |
EUR 1394 |
P2RX1 3'UTR Luciferase Stable Cell Line |
TU017246 |
ABM |
1.0 ml |
EUR 1394 |
Human Purinergic Receptor P2X 1 (P2RX1) ELISA Kit |
abx257453-96tests |
Abbexa |
96 tests |
EUR 637 |
- Shipped within 5-12 working days.
|
P2RX1 Rabbit Polyclonal Antibody