P2RX4 Rabbit pAb |
A6682-100ul |
Abclonal |
100 ul |
EUR 308 |
P2RX4 Rabbit pAb |
A6682-200ul |
Abclonal |
200 ul |
EUR 459 |
P2RX4 Rabbit pAb |
A6682-20ul |
Abclonal |
20 ul |
EUR 183 |
P2RX4 Rabbit pAb |
A6682-50ul |
Abclonal |
50 ul |
EUR 223 |
P2RX4 antibody |
70R-19076 |
Fitzgerald |
50 ul |
EUR 435 |
Description: Rabbit polyclonal P2RX4 antibody |
P2RX4 antibody |
39096-100ul |
SAB |
100ul |
EUR 252 |
P2RX4 Antibody |
1-CSB-PA859513LA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against P2RX4. Recognizes P2RX4 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:500-1:5000, IHC:1:20-1:200 |
P2RX4 Antibody |
1-CSB-PA017322GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
|
Description: A polyclonal antibody against P2RX4. Recognizes P2RX4 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC |
P2RX4 antibody |
70R-5172 |
Fitzgerald |
50 ug |
EUR 467 |
Description: Rabbit polyclonal P2RX4 antibody raised against the N terminal of P2RX4 |
Polyclonal P2RX4 / P2X4 Antibody (Internal) |
APR12646G |
Leading Biology |
0.05mg |
EUR 484 |
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human P2RX4 / P2X4 (Internal). This antibody is tested and proven to work in the following applications: |
Polyclonal P2rx4 (mouse) Antibody (internal region) |
APR12645G |
Leading Biology |
0.1 mg |
EUR 484 |
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human P2rx4 (mouse) (internal region). This antibody is tested and proven to work in the following applications: |
P2RX4 Conjugated Antibody |
C39096 |
SAB |
100ul |
EUR 397 |
anti- P2RX4 antibody |
FNab06069 |
FN Test |
100µg |
EUR 505.25 |
- Recommended dilution: WB: 1:500-1:2000
- IP: 1:500-1:1000
- IHC: 1:20-1:200
- IF: 1:20-1:200
- Immunogen: purinergic receptor P2X, ligand-gated ion channel, 4
- Uniprot ID: Q99571
- Gene ID: 5026
- Research Area: Neuroscience, Cardiovascular, Signal Transductio
- Show more
|
Description: Antibody raised against P2RX4 |
anti- P2RX4 antibody |
FNab10076 |
FN Test |
100µg |
EUR 548.75 |
- Recommended dilution: WB: 1:500-1:2000
- IHC: 1:20-1:200
- Immunogen: purinergic receptor P2X, ligand-gated ion channel, 4
- Uniprot ID: Q99571
- Gene ID: 5026
- Research Area: Neuroscience, Cardiovascular, Signal Transduction
|
Description: Antibody raised against P2RX4 |
Anti-P2RX4 Antibody |
PA2127 |
BosterBio |
100ug/vial |
EUR 294 |
Anti-P2RX4 Antibody |
PB9304 |
BosterBio |
100ug/vial |
EUR 294 |
Anti-P2RX4 antibody |
STJ28765 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: The product of this gene belongs to the family of purinoceptors for ATP. This receptor functions as a ligand-gated ion channel with high calcium permeability. The main pharmacological distinction between the members of the purinoceptor family is the relative sensitivity to the antagonists suramin and PPADS. The product of this gene has the lowest sensitivity for these antagonists. Multiple alternatively spliced transcript variants, some protein-coding and some not protein-coding, have been found for this gene. |
Anti-P2RX4 antibody |
STJ191126 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to P2RX4 |
P2RX4 siRNA |
20-abx927530 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
P2RX4 siRNA |
20-abx927531 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
anti-P2RX4 |
YF-PA13571 |
Abfrontier |
50 ul |
EUR 363 |
Description: Mouse polyclonal to P2RX4 |
anti-P2RX4 |
YF-PA13572 |
Abfrontier |
50 ug |
EUR 363 |
Description: Mouse polyclonal to P2RX4 |
anti-P2RX4 |
YF-PA13573 |
Abfrontier |
100 ug |
EUR 403 |
Description: Rabbit polyclonal to P2RX4 |
P2RX4 Antibody, HRP conjugated |
1-CSB-PA859513LB01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against P2RX4. Recognizes P2RX4 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA |
P2RX4 Antibody, FITC conjugated |
1-CSB-PA859513LC01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against P2RX4. Recognizes P2RX4 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA |
P2RX4 Antibody, Biotin conjugated |
1-CSB-PA859513LD01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against P2RX4. Recognizes P2RX4 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA |
P2RX4 Blocking Peptide |
33R-9751 |
Fitzgerald |
100 ug |
EUR 180 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of P2RX4 antibody, catalog no. 70R-5172 |
P2RX4 cloning plasmid |
CSB-CL859513HU-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1167
- Sequence: atggcgggctgctgcgccgcgctggcggccttcctgttcgagtacgacacgccgcgcatcgtgctcatccgcagccgcaaagtggggctcatgaaccgcgccgtgcaactgctcatcctggcctacgtcatcgggtgggtgtttgtgtgggaaaagggctaccaggaaactgact
- Show more
|
Description: A cloning plasmid for the P2RX4 gene. |
Rat P2RX4 shRNA Plasmid |
20-abx985647 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Human P2RX4 shRNA Plasmid |
20-abx953338 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
P2RX4 Recombinant Protein (Human) |
RP022342 |
ABM |
100 ug |
Ask for price |
P2RX4 Recombinant Protein (Mouse) |
RP159758 |
ABM |
100 ug |
Ask for price |
P2RX4 Recombinant Protein (Rat) |
RP219056 |
ABM |
100 ug |
Ask for price |
Purinergic Receptor P2X 4 (P2RX4) Antibody |
20-abx005122 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
Purinergic Receptor P2X 4 (P2RX4) Antibody |
20-abx114922 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Purinergic Receptor P2X 4 (P2RX4) Antibody |
20-abx318758 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Purinergic Receptor P2X 4 (P2RX4) Antibody |
abx236069-100ug |
Abbexa |
100 ug |
EUR 481 |
- Shipped within 5-12 working days.
|
Purinergic Receptor P2X 4 (P2rx4) Antibody |
abx431482-200ul |
Abbexa |
200 ul |
EUR 384 |
- Shipped within 1-3 working days.
|
Purinergic Receptor P2X 4 (P2RX4) Antibody (HRP) |
20-abx316507 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Purinergic Receptor P2X 4 (P2RX4) Antibody (FITC) |
20-abx316508 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Purinergic Receptor P2X 4 (P2RX4) Antibody (Biotin) |
20-abx316509 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Mouse P2X purinoceptor 4 (P2rx4) |
1-CSB-CF884934MOa2 |
Cusabio |
-
EUR 965.00
-
EUR 665.00
-
EUR 715.00
|
|
- MW: 47.5 kDa
- Buffer composition: Tris-based buffer with 50% glycerol.
|
Description: Recombinant Mouse P2X purinoceptor 4(P2rx4),partial expressed in in vitro E.coli expression system |
P2rx4 ORF Vector (Rat) (pORF) |
ORF073020 |
ABM |
1.0 ug DNA |
EUR 506 |
P2RX4 ORF Vector (Human) (pORF) |
ORF007448 |
ABM |
1.0 ug DNA |
EUR 95 |
P2rx4 ORF Vector (Mouse) (pORF) |
ORF053254 |
ABM |
1.0 ug DNA |
EUR 506 |
P2rx4 sgRNA CRISPR Lentivector set (Rat) |
K6833801 |
ABM |
3 x 1.0 ug |
EUR 339 |
P2rx4 sgRNA CRISPR Lentivector set (Mouse) |
K3911801 |
ABM |
3 x 1.0 ug |
EUR 339 |
P2RX4 sgRNA CRISPR Lentivector set (Human) |
K1581501 |
ABM |
3 x 1.0 ug |
EUR 339 |
P2rx4 sgRNA CRISPR Lentivector (Rat) (Target 1) |
K6833802 |
ABM |
1.0 ug DNA |
EUR 154 |
P2rx4 sgRNA CRISPR Lentivector (Rat) (Target 2) |
K6833803 |
ABM |
1.0 ug DNA |
EUR 154 |
P2rx4 sgRNA CRISPR Lentivector (Rat) (Target 3) |
K6833804 |
ABM |
1.0 ug DNA |
EUR 154 |
P2rx4 sgRNA CRISPR Lentivector (Mouse) (Target 1) |
K3911802 |
ABM |
1.0 ug DNA |
EUR 154 |
P2rx4 sgRNA CRISPR Lentivector (Mouse) (Target 2) |
K3911803 |
ABM |
1.0 ug DNA |
EUR 154 |
P2rx4 sgRNA CRISPR Lentivector (Mouse) (Target 3) |
K3911804 |
ABM |
1.0 ug DNA |
EUR 154 |
P2RX4 sgRNA CRISPR Lentivector (Human) (Target 1) |
K1581502 |
ABM |
1.0 ug DNA |
EUR 154 |
P2RX4 sgRNA CRISPR Lentivector (Human) (Target 2) |
K1581503 |
ABM |
1.0 ug DNA |
EUR 154 |
P2RX4 sgRNA CRISPR Lentivector (Human) (Target 3) |
K1581504 |
ABM |
1.0 ug DNA |
EUR 154 |
P2RX4 Protein Vector (Rat) (pPB-C-His) |
PV292078 |
ABM |
500 ng |
EUR 603 |
P2RX4 Protein Vector (Rat) (pPB-N-His) |
PV292079 |
ABM |
500 ng |
EUR 603 |
P2RX4 Protein Vector (Rat) (pPM-C-HA) |
PV292080 |
ABM |
500 ng |
EUR 603 |
P2RX4 Protein Vector (Rat) (pPM-C-His) |
PV292081 |
ABM |
500 ng |
EUR 603 |
P2RX4 Protein Vector (Mouse) (pPB-C-His) |
PV213014 |
ABM |
500 ng |
EUR 603 |
P2RX4 Protein Vector (Mouse) (pPB-N-His) |
PV213015 |
ABM |
500 ng |
EUR 603 |
P2RX4 Protein Vector (Mouse) (pPM-C-HA) |
PV213016 |
ABM |
500 ng |
EUR 603 |
P2RX4 Protein Vector (Mouse) (pPM-C-His) |
PV213017 |
ABM |
500 ng |
EUR 603 |
P2RX4 Protein Vector (Human) (pPB-C-His) |
PV029789 |
ABM |
500 ng |
EUR 329 |
P2RX4 Protein Vector (Human) (pPB-N-His) |
PV029790 |
ABM |
500 ng |
EUR 329 |
P2RX4 Protein Vector (Human) (pPM-C-HA) |
PV029791 |
ABM |
500 ng |
EUR 329 |
P2RX4 Protein Vector (Human) (pPM-C-His) |
PV029792 |
ABM |
500 ng |
EUR 329 |
P2rx4 3'UTR Luciferase Stable Cell Line |
TU115809 |
ABM |
1.0 ml |
Ask for price |
P2rx4 3'UTR GFP Stable Cell Line |
TU165809 |
ABM |
1.0 ml |
Ask for price |
P2rx4 3'UTR GFP Stable Cell Line |
TU265724 |
ABM |
1.0 ml |
Ask for price |
P2rx4 3'UTR Luciferase Stable Cell Line |
TU215724 |
ABM |
1.0 ml |
Ask for price |
P2RX4 3'UTR GFP Stable Cell Line |
TU067249 |
ABM |
1.0 ml |
EUR 1394 |
P2RX4 3'UTR Luciferase Stable Cell Line |
TU017249 |
ABM |
1.0 ml |
EUR 1394 |
Human Purinergic Receptor P2X 4 (P2RX4) ELISA Kit |
abx382012-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
P2RX4 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV) |
LV691975 |
ABM |
1.0 ug DNA |
EUR 682 |
P2RX4 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC) |
LV691979 |
ABM |
1.0 ug DNA |
EUR 682 |
P2RX4 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a) |
LV691980 |
ABM |
1.0 ug DNA |
EUR 682 |
GAPDH Rabbit Polyclonal Antibody |
37985-100ul |
SAB |
100ul |
EUR 252 |
GAPDH Rabbit Polyclonal Antibody |
37985-50ul |
SAB |
50ul |
EUR 187 |
EFHD1 Rabbit Polyclonal Antibody |
38001-100ul |
SAB |
100ul |
EUR 252 |
EFHD1 Rabbit Polyclonal Antibody |
38001-50ul |
SAB |
50ul |
EUR 187 |
Alliinase Rabbit Polyclonal Antibody |
38042-100ul |
SAB |
100ul |
EUR 252 |
Alliinase Rabbit Polyclonal Antibody |
38042-50ul |
SAB |
50ul |
EUR 187 |
ECFP Rabbit Polyclonal Antibody |
38077-100ul |
SAB |
100ul |
EUR 252 |
ECFP Rabbit Polyclonal Antibody |
38077-50ul |
SAB |
50ul |
EUR 187 |
EYFP Rabbit Polyclonal Antibody |
38078-100ul |
SAB |
100ul |
EUR 252 |
EYFP Rabbit Polyclonal Antibody |
38078-50ul |
SAB |
50ul |
EUR 187 |
P2RX4 Rabbit Polyclonal Antibody