P2RX4 Rabbit Polyclonal Antibody

P2RX4 Rabbit pAb
A6682-100ul	Abclonal	100 ul	EUR 308

P2RX4 Rabbit pAb
A6682-200ul	Abclonal	200 ul	EUR 459

P2RX4 Rabbit pAb
A6682-20ul	Abclonal	20 ul	EUR 183

P2RX4 Rabbit pAb
A6682-50ul	Abclonal	50 ul	EUR 223

P2RX4 antibody
70R-5172	Fitzgerald	50 ug	EUR 467
Description: Rabbit polyclonal P2RX4 antibody raised against the N terminal of P2RX4

P2RX4 antibody
39096-100ul	SAB	100ul	EUR 252

P2RX4 antibody
70R-19076	Fitzgerald	50 ul	EUR 435
Description: Rabbit polyclonal P2RX4 antibody

P2RX4 Antibody
1-CSB-PA859513LA01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against P2RX4. Recognizes P2RX4 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:500-1:5000, IHC:1:20-1:200

P2RX4 Antibody
1-CSB-PA017322GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against P2RX4. Recognizes P2RX4 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

P2RX4 antibody
PAab10076	Lifescience Market	100 ug	EUR 386

Polyclonal P2RX4 / P2X4 Antibody (Internal)
APR12646G	Leading Biology	0.05mg	EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human P2RX4 / P2X4 (Internal). This antibody is tested and proven to work in the following applications:

Polyclonal P2rx4 (mouse) Antibody (internal region)
APR12645G	Leading Biology	0.1 mg	EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human P2rx4 (mouse) (internal region). This antibody is tested and proven to work in the following applications:

P2rx4/ Rat P2rx4 ELISA Kit
ELI-12419r	Lifescience Market	96 Tests	EUR 886

P2RX4 Conjugated Antibody
C39096	SAB	100ul	EUR 397

anti- P2RX4 antibody
FNab10076	FN Test	100µg	EUR 548.75
Recommended dilution: WB: 1:500-1:2000 IHC: 1:20-1:200 Immunogen: purinergic receptor P2X, ligand-gated ion channel, 4 Uniprot ID: Q99571 Gene ID: 5026 Research Area: Neuroscience, Cardiovascular, Signal Transduction
Description: Antibody raised against P2RX4

anti- P2RX4 antibody
FNab06069	FN Test	100µg	EUR 505.25
Recommended dilution: WB: 1:500-1:2000 IP: 1:500-1:1000 IHC: 1:20-1:200 IF: 1:20-1:200 Immunogen: purinergic receptor P2X, ligand-gated ion channel, 4 Uniprot ID: Q99571 Gene ID: 5026 Research Area: Neuroscience, Cardiovascular, Signal Transductio Show more
Description: Antibody raised against P2RX4

Anti-P2RX4 Antibody
PB9304	BosterBio	100ug/vial	EUR 294

Anti-P2RX4 antibody
PAab06069	Lifescience Market	100 ug	EUR 355

Anti-P2RX4 Antibody
PA2127	BosterBio	100ug/vial	EUR 294

Anti-P2RX4 antibody
STJ28765	St John's Laboratory	100 µl	EUR 277
Description: The product of this gene belongs to the family of purinoceptors for ATP. This receptor functions as a ligand-gated ion channel with high calcium permeability. The main pharmacological distinction between the members of the purinoceptor family is the relative sensitivity to the antagonists suramin and PPADS. The product of this gene has the lowest sensitivity for these antagonists. Multiple alternatively spliced transcript variants, some protein-coding and some not protein-coding, have been found for this gene.

Anti-P2RX4 antibody
STJ191126	St John's Laboratory	200 µl	EUR 197
Description: Unconjugated Rabbit polyclonal to P2RX4

P2RX4 siRNA
20-abx927530	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

P2RX4 siRNA
20-abx927531	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

anti-P2RX4
YF-PA13571	Abfrontier	50 ul	EUR 363
Description: Mouse polyclonal to P2RX4

anti-P2RX4
YF-PA13572	Abfrontier	50 ug	EUR 363
Description: Mouse polyclonal to P2RX4

anti-P2RX4
YF-PA13573	Abfrontier	100 ug	EUR 403
Description: Rabbit polyclonal to P2RX4

P2RX4 Antibody, HRP conjugated
1-CSB-PA859513LB01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against P2RX4. Recognizes P2RX4 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

P2RX4 Antibody, FITC conjugated
1-CSB-PA859513LC01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against P2RX4. Recognizes P2RX4 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

P2RX4 Antibody, Biotin conjugated
1-CSB-PA859513LD01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against P2RX4. Recognizes P2RX4 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Anti-P2rx4 (mouse) antibody
STJ72755	St John's Laboratory	100 µg	EUR 359

P2RX4 Blocking Peptide
33R-9751	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of P2RX4 antibody, catalog no. 70R-5172

P2RX4 cloning plasmid
CSB-CL859513HU-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1167 Sequence: atggcgggctgctgcgccgcgctggcggccttcctgttcgagtacgacacgccgcgcatcgtgctcatccgcagccgcaaagtggggctcatgaaccgcgccgtgcaactgctcatcctggcctacgtcatcgggtgggtgtttgtgtgggaaaagggctaccaggaaactgact Show more
Description: A cloning plasmid for the P2RX4 gene.

Rat P2RX4 shRNA Plasmid
20-abx985647	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

P2RX4 ELISA KIT|Human
EF001496	Lifescience Market	96 Tests	EUR 689

Human P2RX4 shRNA Plasmid
20-abx953338	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

P2RX4 Recombinant Protein (Human)
RP022342	ABM	100 ug	Ask for price

P2RX4 Recombinant Protein (Rat)
RP219056	ABM	100 ug	Ask for price

P2RX4 Recombinant Protein (Mouse)
RP159758	ABM	100 ug	Ask for price

Purinergic Receptor P2X 4 (P2RX4) Antibody
20-abx114922	Abbexa	EUR 732.00 EUR 398.00	150 ul 50 ul
Shipped within 5-10 working days.

Purinergic Receptor P2X 4 (P2RX4) Antibody
20-abx005122	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

Purinergic Receptor P2X 4 (P2RX4) Antibody
20-abx318758	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Purinergic Receptor P2X 4 (P2rx4) Antibody
abx431482-200ul	Abbexa	200 ul	EUR 384
Shipped within 1-3 working days.

Purinergic Receptor P2X 4 (P2RX4) Antibody
abx236069-100ug	Abbexa	100 ug	EUR 481
Shipped within 5-12 working days.

Purinergic Receptor P2X 4 (P2RX4) Antibody (HRP)
20-abx316507	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Purinergic Receptor P2X 4 (P2RX4) Antibody (FITC)
20-abx316508	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Purinergic Receptor P2X 4 (P2RX4) Antibody (Biotin)
20-abx316509	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Mouse P2X purinoceptor 4 (P2rx4)
1-CSB-CF884934MOa2	Cusabio	EUR 965.00 EUR 665.00 EUR 715.00	1MG 200ug 500ug
MW: 47.5 kDa Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Mouse P2X purinoceptor 4(P2rx4),partial expressed in in vitro E.coli expression system

P2RX4 ORF Vector (Human) (pORF)
ORF007448	ABM	1.0 ug DNA	EUR 95

P2rx4 ORF Vector (Rat) (pORF)
ORF073020	ABM	1.0 ug DNA	EUR 506

P2rx4 ORF Vector (Mouse) (pORF)
ORF053254	ABM	1.0 ug DNA	EUR 506

P2RX4 sgRNA CRISPR Lentivector set (Human)
K1581501	ABM	3 x 1.0 ug	EUR 339

P2rx4 sgRNA CRISPR Lentivector set (Mouse)
K3911801	ABM	3 x 1.0 ug	EUR 339

P2rx4 sgRNA CRISPR Lentivector set (Rat)
K6833801	ABM	3 x 1.0 ug	EUR 339

Mouse P2X purinoceptor 4, P2rx4 ELISA KIT
ELI-14549m	Lifescience Market	96 Tests	EUR 865

Bovine P2X purinoceptor 4, P2RX4 ELISA KIT
ELI-23282b	Lifescience Market	96 Tests	EUR 928

Human P2X purinoceptor 4, P2RX4 ELISA KIT
ELI-35726h	Lifescience Market	96 Tests	EUR 824

P2RX4 sgRNA CRISPR Lentivector (Human) (Target 1)
K1581502	ABM	1.0 ug DNA	EUR 154

P2RX4 sgRNA CRISPR Lentivector (Human) (Target 2)
K1581503	ABM	1.0 ug DNA	EUR 154

P2RX4 sgRNA CRISPR Lentivector (Human) (Target 3)
K1581504	ABM	1.0 ug DNA	EUR 154

P2rx4 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K3911802	ABM	1.0 ug DNA	EUR 154

P2rx4 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K3911803	ABM	1.0 ug DNA	EUR 154

P2rx4 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K3911804	ABM	1.0 ug DNA	EUR 154

P2rx4 sgRNA CRISPR Lentivector (Rat) (Target 1)
K6833802	ABM	1.0 ug DNA	EUR 154

P2rx4 sgRNA CRISPR Lentivector (Rat) (Target 2)
K6833803	ABM	1.0 ug DNA	EUR 154

P2rx4 sgRNA CRISPR Lentivector (Rat) (Target 3)
K6833804	ABM	1.0 ug DNA	EUR 154

P2RX4 Protein Vector (Human) (pPB-C-His)
PV029789	ABM	500 ng	EUR 329

P2RX4 Protein Vector (Human) (pPB-N-His)
PV029790	ABM	500 ng	EUR 329

P2RX4 Protein Vector (Human) (pPM-C-HA)
PV029791	ABM	500 ng	EUR 329

P2RX4 Protein Vector (Human) (pPM-C-His)
PV029792	ABM	500 ng	EUR 329

P2RX4 Protein Vector (Mouse) (pPB-C-His)
PV213014	ABM	500 ng	EUR 603

P2RX4 Protein Vector (Mouse) (pPB-N-His)
PV213015	ABM	500 ng	EUR 603

P2RX4 Protein Vector (Mouse) (pPM-C-HA)
PV213016	ABM	500 ng	EUR 603

P2RX4 Protein Vector (Mouse) (pPM-C-His)
PV213017	ABM	500 ng	EUR 603

P2RX4 Protein Vector (Rat) (pPB-C-His)
PV292078	ABM	500 ng	EUR 603

P2RX4 Protein Vector (Rat) (pPB-N-His)
PV292079	ABM	500 ng	EUR 603

P2RX4 Protein Vector (Rat) (pPM-C-HA)
PV292080	ABM	500 ng	EUR 603

P2RX4 Protein Vector (Rat) (pPM-C-His)
PV292081	ABM	500 ng	EUR 603

P2rx4 3'UTR GFP Stable Cell Line
TU165809	ABM	1.0 ml	Ask for price

P2RX4 3'UTR Luciferase Stable Cell Line
TU017249	ABM	1.0 ml	EUR 1394

P2rx4 3'UTR Luciferase Stable Cell Line
TU115809	ABM	1.0 ml	Ask for price

P2RX4 3'UTR GFP Stable Cell Line
TU067249	ABM	1.0 ml	EUR 1394

P2rx4 3'UTR GFP Stable Cell Line
TU265724	ABM	1.0 ml	Ask for price

P2rx4 3'UTR Luciferase Stable Cell Line
TU215724	ABM	1.0 ml	Ask for price

Human Purinergic Receptor P2X 4 (P2RX4) ELISA Kit
abx382012-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

P2RX4 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)
LV691975	ABM	1.0 ug DNA	EUR 682

P2RX4 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)
LV691979	ABM	1.0 ug DNA	EUR 682

P2RX4 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)
LV691980	ABM	1.0 ug DNA	EUR 682

VEGF Rabbit Polyclonal Antibody
ES8453-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

VEGF Rabbit Polyclonal Antibody
ES8453-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody
ES8454-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody
ES8454-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody
ES8455-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody
ES8455-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody
ES8456-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody
ES8456-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody
ES8457-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody
ES8457-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

P2RX4 Rabbit Polyclonal Antibody