PAIP1 Polyclonal Antibody |
ABP59815-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Synthesized peptide derived from part region of human PAIP1 protein at amino acid sequence of 100-180
- Applications tips:
|
Description: A polyclonal antibody for detection of PAIP1 from Human, Mouse. This PAIP1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PAIP1 protein at amino acid sequence of 100-180 |
PAIP1 Polyclonal Antibody |
ABP59815-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from part region of human PAIP1 protein at amino acid sequence of 100-180
- Applications tips:
|
Description: A polyclonal antibody for detection of PAIP1 from Human, Mouse. This PAIP1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PAIP1 protein at amino acid sequence of 100-180 |
PAIP1 Polyclonal Antibody |
ABP59815-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human PAIP1 protein at amino acid sequence of 100-180
- Applications tips:
|
Description: A polyclonal antibody for detection of PAIP1 from Human, Mouse. This PAIP1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PAIP1 protein at amino acid sequence of 100-180 |
PAIP1 Polyclonal Antibody |
30695-100ul |
SAB |
100ul |
EUR 252 |
PAIP1 Polyclonal Antibody |
30695-50ul |
SAB |
50ul |
EUR 187 |
PAIP1 Rabbit pAb |
A6042-100ul |
Abclonal |
100 ul |
EUR 308 |
PAIP1 Rabbit pAb |
A6042-200ul |
Abclonal |
200 ul |
EUR 459 |
PAIP1 Rabbit pAb |
A6042-20ul |
Abclonal |
20 ul |
EUR 183 |
PAIP1 Rabbit pAb |
A6042-50ul |
Abclonal |
50 ul |
EUR 223 |
PAIP1 Polyclonal Conjugated Antibody |
C30695 |
SAB |
100ul |
EUR 397 |
PAIP1 antibody |
70R-4907 |
Fitzgerald |
50 ug |
EUR 467 |
Description: Rabbit polyclonal PAIP1 antibody |
PAIP1 antibody |
70R-19094 |
Fitzgerald |
50 ul |
EUR 435 |
Description: Rabbit polyclonal PAIP1 antibody |
PAIP1 antibody |
70R-1375 |
Fitzgerald |
100 ug |
EUR 377 |
Description: Rabbit polyclonal PAIP1 antibody |
PAIP1 Antibody |
1-CSB-PA880930ESR2HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
|
Description: A polyclonal antibody against PAIP1. Recognizes PAIP1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB; Recommended dilution: WB:1:200-1:1000 |
PAIP1 Antibody |
1-CSB-PA017400GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
|
Description: A polyclonal antibody against PAIP1. Recognizes PAIP1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IF |
anti- PAIP1 antibody |
FNab06116 |
FN Test |
100µg |
EUR 505.25 |
- Immunogen: poly(A) binding protein interacting protein 1
- Uniprot ID: Q9H074
- Gene ID: 10605
- Research Area: Metabolism
|
Description: Antibody raised against PAIP1 |
Anti-PAIP1 antibody |
STJ27838 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: The protein encoded by this gene interacts with poly(A)-binding protein and with the cap-binding complex eIF4A. It is involved in translational initiation and protein biosynthesis. Overexpression of this gene in COS7 cells stimulates translation. Alternative splicing occurs at this locus and three transcript variants encoding three distinct isoforms have been identified. |
Anti-PAIP1 antibody |
STJ191176 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to PAIP1 |
PAIP1 siRNA |
20-abx927633 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
PAIP1 siRNA |
20-abx927634 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
anti-PAIP1 |
YF-PA25626 |
Abfrontier |
50 ul |
EUR 334 |
Description: Mouse polyclonal to PAIP1 |
PAIP1 Blocking Peptide |
33R-6406 |
Fitzgerald |
100 ug |
EUR 180 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of PAIP1 antibody, catalog no. 70R-4907 |
PAIP1 Blocking Peptide |
33R-2650 |
Fitzgerald |
100 ug |
EUR 180 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of PAIP1 antibody, catalog no. 70R-1375 |
PAIP1 cloning plasmid |
CSB-CL880930HU-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1203
- Sequence: atgtcggacggtttcgatcgggccccagagcaaacgaggcccctgagagctccacctagttcacaggataaaatcccacagcagaactcggagtcagcaatggctaagccccaggtggttgtagctcctgtattaatgtctaagctgtctgtgaatgcccctgaattttaccctt
- Show more
|
Description: A cloning plasmid for the PAIP1 gene. |
Anti-PAIP1 (7E7) |
YF-MA17395 |
Abfrontier |
200 ul |
EUR 363 |
Description: Mouse monoclonal to PAIP1 |
Anti-PAIP1 (2D11) |
YF-MA17396 |
Abfrontier |
50 ug |
EUR 363 |
Description: Mouse monoclonal to PAIP1 |
Mouse PAIP1 shRNA Plasmid |
20-abx981209 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Human PAIP1 shRNA Plasmid |
20-abx957218 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
PAIP1 Recombinant Protein (Human) |
RP022468 |
ABM |
100 ug |
Ask for price |
PAIP1 Recombinant Protein (Rat) |
RP219182 |
ABM |
100 ug |
Ask for price |
PAIP1 Recombinant Protein (Mouse) |
RP159935 |
ABM |
100 ug |
Ask for price |
PAIP1 Recombinant Protein (Mouse) |
RP159938 |
ABM |
100 ug |
Ask for price |
PAIP1 ORF Vector (Human) (pORF) |
ORF007490 |
ABM |
1.0 ug DNA |
EUR 95 |
Paip1 ORF Vector (Rat) (pORF) |
ORF073062 |
ABM |
1.0 ug DNA |
EUR 506 |
Paip1 ORF Vector (Mouse) (pORF) |
ORF053313 |
ABM |
1.0 ug DNA |
EUR 506 |
Paip1 ORF Vector (Mouse) (pORF) |
ORF053314 |
ABM |
1.0 ug DNA |
EUR 506 |
PAIP1 sgRNA CRISPR Lentivector set (Human) |
K1589401 |
ABM |
3 x 1.0 ug |
EUR 339 |
Paip1 sgRNA CRISPR Lentivector set (Mouse) |
K4580901 |
ABM |
3 x 1.0 ug |
EUR 339 |
Paip1 sgRNA CRISPR Lentivector set (Rat) |
K6112701 |
ABM |
3 x 1.0 ug |
EUR 339 |
Poly(A) Binding Protein Interacting Protein 1 (PAIP1) Antibody |
20-abx142125 |
Abbexa |
-
EUR 370.00
-
EUR 606.00
-
EUR 314.00
|
|
- Shipped within 5-10 working days.
|
Poly(A) Binding Protein Interacting Protein 1 (PAIP1) Antibody |
20-abx004650 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
Poly(A) Binding Protein Interacting Protein 1 (PAIP1) Antibody |
abx030721-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
Poly(A) Binding Protein Interacting Protein 1 (PAIP1) Antibody |
abx030721-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
Poly(A) Binding Protein Interacting Protein 1 (PAIP1) Antibody |
20-abx321424 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Poly(A) Binding Protein Interacting Protein 1 (PAIP1) Antibody |
abx340003-100ug |
Abbexa |
100 ug |
EUR 391 |
- Shipped within 5-10 working days.
|
Poly(A) Binding Protein Interacting Protein 1 (PAIP1) Antibody |
abx236116-100ug |
Abbexa |
100 ug |
EUR 481 |
- Shipped within 5-12 working days.
|
Poly(A) Binding Protein Interacting Protein 1 (PAIP1) Antibody |
abx236117-100ug |
Abbexa |
100 ug |
EUR 509 |
- Shipped within 5-12 working days.
|
PAIP1 sgRNA CRISPR Lentivector (Human) (Target 1) |
K1589402 |
ABM |
1.0 ug DNA |
EUR 154 |
PAIP1 sgRNA CRISPR Lentivector (Human) (Target 2) |
K1589403 |
ABM |
1.0 ug DNA |
EUR 154 |
PAIP1 sgRNA CRISPR Lentivector (Human) (Target 3) |
K1589404 |
ABM |
1.0 ug DNA |
EUR 154 |
Paip1 sgRNA CRISPR Lentivector (Mouse) (Target 1) |
K4580902 |
ABM |
1.0 ug DNA |
EUR 154 |
Paip1 sgRNA CRISPR Lentivector (Mouse) (Target 2) |
K4580903 |
ABM |
1.0 ug DNA |
EUR 154 |
Paip1 sgRNA CRISPR Lentivector (Mouse) (Target 3) |
K4580904 |
ABM |
1.0 ug DNA |
EUR 154 |
Paip1 sgRNA CRISPR Lentivector (Rat) (Target 1) |
K6112702 |
ABM |
1.0 ug DNA |
EUR 154 |
Paip1 sgRNA CRISPR Lentivector (Rat) (Target 2) |
K6112703 |
ABM |
1.0 ug DNA |
EUR 154 |
Paip1 sgRNA CRISPR Lentivector (Rat) (Target 3) |
K6112704 |
ABM |
1.0 ug DNA |
EUR 154 |
PAIP1 Protein Vector (Human) (pPB-C-His) |
PV029957 |
ABM |
500 ng |
EUR 329 |
PAIP1 Protein Vector (Human) (pPB-N-His) |
PV029958 |
ABM |
500 ng |
EUR 329 |
PAIP1 Protein Vector (Human) (pPM-C-HA) |
PV029959 |
ABM |
500 ng |
EUR 329 |
PAIP1 Protein Vector (Human) (pPM-C-His) |
PV029960 |
ABM |
500 ng |
EUR 329 |
PAIP1 Protein Vector (Mouse) (pPB-C-His) |
PV213250 |
ABM |
500 ng |
EUR 603 |
PAIP1 Protein Vector (Mouse) (pPB-N-His) |
PV213251 |
ABM |
500 ng |
EUR 603 |
PAIP1 Protein Vector (Mouse) (pPM-C-HA) |
PV213252 |
ABM |
500 ng |
EUR 603 |
PAIP1 Protein Vector (Mouse) (pPM-C-His) |
PV213253 |
ABM |
500 ng |
EUR 603 |
PAIP1 Protein Vector (Mouse) (pPB-C-His) |
PV213254 |
ABM |
500 ng |
EUR 603 |
PAIP1 Protein Vector (Mouse) (pPB-N-His) |
PV213255 |
ABM |
500 ng |
EUR 603 |
PAIP1 Protein Vector (Mouse) (pPM-C-HA) |
PV213256 |
ABM |
500 ng |
EUR 603 |
PAIP1 Protein Vector (Mouse) (pPM-C-His) |
PV213257 |
ABM |
500 ng |
EUR 603 |
PAIP1 Protein Vector (Rat) (pPB-C-His) |
PV292246 |
ABM |
500 ng |
EUR 603 |
PAIP1 Protein Vector (Rat) (pPB-N-His) |
PV292247 |
ABM |
500 ng |
EUR 603 |
PAIP1 Protein Vector (Rat) (pPM-C-HA) |
PV292248 |
ABM |
500 ng |
EUR 603 |
PAIP1 Protein Vector (Rat) (pPM-C-His) |
PV292249 |
ABM |
500 ng |
EUR 603 |
Paip1 3'UTR GFP Stable Cell Line |
TU165857 |
ABM |
1.0 ml |
Ask for price |
PAIP1 3'UTR Luciferase Stable Cell Line |
TU017340 |
ABM |
1.0 ml |
EUR 1394 |
Paip1 3'UTR Luciferase Stable Cell Line |
TU115857 |
ABM |
1.0 ml |
Ask for price |
PAIP1 3'UTR GFP Stable Cell Line |
TU067340 |
ABM |
1.0 ml |
EUR 1394 |
Paip1 3'UTR GFP Stable Cell Line |
TU265768 |
ABM |
1.0 ml |
Ask for price |
Paip1 3'UTR Luciferase Stable Cell Line |
TU215768 |
ABM |
1.0 ml |
Ask for price |
VEGF Rabbit Polyclonal Antibody |
ES8453-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
VEGF Rabbit Polyclonal Antibody |
ES8453-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
CD10 Rabbit Polyclonal Antibody |
ES8454-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
CD10 Rabbit Polyclonal Antibody |
ES8454-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NM23A Rabbit Polyclonal Antibody |
ES8455-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NM23A Rabbit Polyclonal Antibody |
ES8455-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8456-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8456-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8457-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8457-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
HSC70 Rabbit Polyclonal Antibody |
ES8558-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSC70 Rabbit Polyclonal Antibody |
ES8558-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSP40 Rabbit Polyclonal Antibody |
ES8559-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSP40 Rabbit Polyclonal Antibody |
ES8559-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSP90? Rabbit Polyclonal Antibody |
ES8560-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
HSP90? Rabbit Polyclonal Antibody |
ES8560-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
IkB ? Rabbit Polyclonal Antibody |
ES8561-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
IkB ? Rabbit Polyclonal Antibody |
ES8561-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
JAK1 Rabbit Polyclonal Antibody |
ES8562-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JAK1 Rabbit Polyclonal Antibody |
ES8562-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JAK2 Rabbit Polyclonal Antibody |
ES8563-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JAK2 Rabbit Polyclonal Antibody |
ES8563-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JNK2 Rabbit Polyclonal Antibody |
ES8564-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
JNK2 Rabbit Polyclonal Antibody |
ES8564-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
JNK3 Rabbit Polyclonal Antibody |
ES8565-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JNK3 Rabbit Polyclonal Antibody |
ES8565-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
MEK2 Rabbit Polyclonal Antibody |
ES8566-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC |
MEK2 Rabbit Polyclonal Antibody |
ES8566-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC |
MEK3 Rabbit Polyclonal Antibody |
ES8567-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
MEK3 Rabbit Polyclonal Antibody |
ES8567-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
Nrf2 Rabbit Polyclonal Antibody |
ES8568-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
Nrf2 Rabbit Polyclonal Antibody |
ES8568-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4a Rabbit Polyclonal Antibody |
ES8569-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4a Rabbit Polyclonal Antibody |
ES8569-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4b Rabbit Polyclonal Antibody |
ES8570-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4b Rabbit Polyclonal Antibody |
ES8570-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4c Rabbit Polyclonal Antibody |
ES8571-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4c Rabbit Polyclonal Antibody |
ES8571-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG5 Rabbit Polyclonal Antibody |
ES8572-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG5 Rabbit Polyclonal Antibody |
ES8572-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG7 Rabbit Polyclonal Antibody |
ES8573-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG7 Rabbit Polyclonal Antibody |
ES8573-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG13 Rabbit Polyclonal Antibody |
ES8574-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG13 Rabbit Polyclonal Antibody |
ES8574-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG13 Rabbit Polyclonal Antibody |
ES8575-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG13 Rabbit Polyclonal Antibody |
ES8575-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG14L Rabbit Polyclonal Antibody |
ES8576-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG14L Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG14L Rabbit Polyclonal Antibody |
ES8576-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG14L Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NBR1 Rabbit Polyclonal Antibody |
ES8578-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NBR1 Rabbit Polyclonal Antibody |
ES8578-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NBR1 Rabbit Polyclonal Antibody |
ES8579-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NBR1 Rabbit Polyclonal Antibody |
ES8579-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
WIPI2 Rabbit Polyclonal Antibody |
ES8580-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against WIPI2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
WIPI2 Rabbit Polyclonal Antibody |
ES8580-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against WIPI2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
Gab1 Rabbit Polyclonal Antibody |
ES8582-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against Gab1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
Gab1 Rabbit Polyclonal Antibody |
ES8582-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against Gab1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ERK1 Rabbit Polyclonal Antibody |
ES8583-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ERK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ERK1 Rabbit Polyclonal Antibody |
ES8583-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ERK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
Met Rabbit Polyclonal Antibody |
ABP57458-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
Met Rabbit Polyclonal Antibody |
ABP57458-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
Met Rabbit Polyclonal Antibody |
ABP57458-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
VEGF Rabbit Polyclonal Antibody |
ABP57460-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
VEGF Rabbit Polyclonal Antibody |
ABP57460-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
VEGF Rabbit Polyclonal Antibody |
ABP57460-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
PAIP1 Rabbit Polyclonal Antibody