PAIP1 Rabbit Polyclonal Antibody

PAIP1 Polyclonal Antibody

ABP59815-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human PAIP1 protein at amino acid sequence of 100-180
  • Applications tips:
Description: A polyclonal antibody for detection of PAIP1 from Human, Mouse. This PAIP1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PAIP1 protein at amino acid sequence of 100-180

PAIP1 Polyclonal Antibody

ABP59815-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human PAIP1 protein at amino acid sequence of 100-180
  • Applications tips:
Description: A polyclonal antibody for detection of PAIP1 from Human, Mouse. This PAIP1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PAIP1 protein at amino acid sequence of 100-180

PAIP1 Polyclonal Antibody

ABP59815-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human PAIP1 protein at amino acid sequence of 100-180
  • Applications tips:
Description: A polyclonal antibody for detection of PAIP1 from Human, Mouse. This PAIP1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PAIP1 protein at amino acid sequence of 100-180

PAIP1 Polyclonal Antibody

30695-100ul 100ul
EUR 252

PAIP1 Polyclonal Antibody

30695-50ul 50ul
EUR 187

PAIP1 Rabbit pAb

A6042-100ul 100 ul
EUR 308

PAIP1 Rabbit pAb

A6042-200ul 200 ul
EUR 459

PAIP1 Rabbit pAb

A6042-20ul 20 ul
EUR 183

PAIP1 Rabbit pAb

A6042-50ul 50 ul
EUR 223

PAIP1 Polyclonal Conjugated Antibody

C30695 100ul
EUR 397

PAIP1 antibody

70R-4907 50 ug
EUR 467
Description: Rabbit polyclonal PAIP1 antibody

PAIP1 antibody

70R-19094 50 ul
EUR 435
Description: Rabbit polyclonal PAIP1 antibody

PAIP1 antibody

70R-1375 100 ug
EUR 377
Description: Rabbit polyclonal PAIP1 antibody

PAIP1 Antibody

1-CSB-PA880930ESR2HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against PAIP1. Recognizes PAIP1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB; Recommended dilution: WB:1:200-1:1000

PAIP1 Antibody

1-CSB-PA017400GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against PAIP1. Recognizes PAIP1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IF

anti- PAIP1 antibody

FNab06116 100µg
EUR 505.25
  • Immunogen: poly(A) binding protein interacting protein 1
  • Uniprot ID: Q9H074
  • Gene ID: 10605
  • Research Area: Metabolism
Description: Antibody raised against PAIP1

Anti-PAIP1 antibody

PAab06116 100 ug
EUR 355

Anti-PAIP1 antibody

STJ27838 100 µl
EUR 277
Description: The protein encoded by this gene interacts with poly(A)-binding protein and with the cap-binding complex eIF4A. It is involved in translational initiation and protein biosynthesis. Overexpression of this gene in COS7 cells stimulates translation. Alternative splicing occurs at this locus and three transcript variants encoding three distinct isoforms have been identified.

Anti-PAIP1 antibody

STJ191176 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to PAIP1

PAIP1 siRNA

20-abx927633
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

PAIP1 siRNA

20-abx927634
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

anti-PAIP1

YF-PA25626 50 ul
EUR 334
Description: Mouse polyclonal to PAIP1

PAIP1 Blocking Peptide

33R-6406 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of PAIP1 antibody, catalog no. 70R-4907

PAIP1 Blocking Peptide

33R-2650 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of PAIP1 antibody, catalog no. 70R-1375

PAIP1 cloning plasmid

CSB-CL880930HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1203
  • Sequence: atgtcggacggtttcgatcgggccccagagcaaacgaggcccctgagagctccacctagttcacaggataaaatcccacagcagaactcggagtcagcaatggctaagccccaggtggttgtagctcctgtattaatgtctaagctgtctgtgaatgcccctgaattttaccctt
  • Show more
Description: A cloning plasmid for the PAIP1 gene.

pCMV-SPORT6-PAIP1

PVT13177 2 ug
EUR 391

Anti-PAIP1 (7E7)

YF-MA17395 200 ul
EUR 363
Description: Mouse monoclonal to PAIP1

Anti-PAIP1 (2D11)

YF-MA17396 50 ug
EUR 363
Description: Mouse monoclonal to PAIP1

Mouse PAIP1 shRNA Plasmid

20-abx981209
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human PAIP1 ELISA KIT

ELI-14704h 96 Tests
EUR 824

PAIP1 ELISA KIT|Human

EF001531 96 Tests
EUR 689

Mouse Paip1 ELISA KIT

ELI-45095m 96 Tests
EUR 865

Human PAIP1 shRNA Plasmid

20-abx957218
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

PAIP1 Recombinant Protein (Human)

RP022468 100 ug Ask for price

PAIP1 Recombinant Protein (Rat)

RP219182 100 ug Ask for price

PAIP1 Recombinant Protein (Mouse)

RP159935 100 ug Ask for price

PAIP1 Recombinant Protein (Mouse)

RP159938 100 ug Ask for price

PAIP1 ORF Vector (Human) (pORF)

ORF007490 1.0 ug DNA
EUR 95

Paip1 ORF Vector (Rat) (pORF)

ORF073062 1.0 ug DNA
EUR 506

Paip1 ORF Vector (Mouse) (pORF)

ORF053313 1.0 ug DNA
EUR 506

Paip1 ORF Vector (Mouse) (pORF)

ORF053314 1.0 ug DNA
EUR 506

PAIP1 sgRNA CRISPR Lentivector set (Human)

K1589401 3 x 1.0 ug
EUR 339

Paip1 sgRNA CRISPR Lentivector set (Mouse)

K4580901 3 x 1.0 ug
EUR 339

Paip1 sgRNA CRISPR Lentivector set (Rat)

K6112701 3 x 1.0 ug
EUR 339

Poly(A) Binding Protein Interacting Protein 1 (PAIP1) Antibody

20-abx142125
  • EUR 370.00
  • EUR 606.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 50 ul
  • Shipped within 5-10 working days.

Poly(A) Binding Protein Interacting Protein 1 (PAIP1) Antibody

20-abx004650
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Poly(A) Binding Protein Interacting Protein 1 (PAIP1) Antibody

abx030721-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Poly(A) Binding Protein Interacting Protein 1 (PAIP1) Antibody

abx030721-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Poly(A) Binding Protein Interacting Protein 1 (PAIP1) Antibody

20-abx321424
  • EUR 300.00
  • EUR 244.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Poly(A) Binding Protein Interacting Protein 1 (PAIP1) Antibody

abx340003-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Poly(A) Binding Protein Interacting Protein 1 (PAIP1) Antibody

abx236116-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

Poly(A) Binding Protein Interacting Protein 1 (PAIP1) Antibody

abx236117-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

PAIP1 sgRNA CRISPR Lentivector (Human) (Target 1)

K1589402 1.0 ug DNA
EUR 154

PAIP1 sgRNA CRISPR Lentivector (Human) (Target 2)

K1589403 1.0 ug DNA
EUR 154

PAIP1 sgRNA CRISPR Lentivector (Human) (Target 3)

K1589404 1.0 ug DNA
EUR 154

Paip1 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4580902 1.0 ug DNA
EUR 154

Paip1 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4580903 1.0 ug DNA
EUR 154

Paip1 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4580904 1.0 ug DNA
EUR 154

Paip1 sgRNA CRISPR Lentivector (Rat) (Target 1)

K6112702 1.0 ug DNA
EUR 154

Paip1 sgRNA CRISPR Lentivector (Rat) (Target 2)

K6112703 1.0 ug DNA
EUR 154

Paip1 sgRNA CRISPR Lentivector (Rat) (Target 3)

K6112704 1.0 ug DNA
EUR 154

PAIP1 Protein Vector (Human) (pPB-C-His)

PV029957 500 ng
EUR 329

PAIP1 Protein Vector (Human) (pPB-N-His)

PV029958 500 ng
EUR 329

PAIP1 Protein Vector (Human) (pPM-C-HA)

PV029959 500 ng
EUR 329

PAIP1 Protein Vector (Human) (pPM-C-His)

PV029960 500 ng
EUR 329

PAIP1 Protein Vector (Mouse) (pPB-C-His)

PV213250 500 ng
EUR 603

PAIP1 Protein Vector (Mouse) (pPB-N-His)

PV213251 500 ng
EUR 603

PAIP1 Protein Vector (Mouse) (pPM-C-HA)

PV213252 500 ng
EUR 603

PAIP1 Protein Vector (Mouse) (pPM-C-His)

PV213253 500 ng
EUR 603

PAIP1 Protein Vector (Mouse) (pPB-C-His)

PV213254 500 ng
EUR 603

PAIP1 Protein Vector (Mouse) (pPB-N-His)

PV213255 500 ng
EUR 603

PAIP1 Protein Vector (Mouse) (pPM-C-HA)

PV213256 500 ng
EUR 603

PAIP1 Protein Vector (Mouse) (pPM-C-His)

PV213257 500 ng
EUR 603

PAIP1 Protein Vector (Rat) (pPB-C-His)

PV292246 500 ng
EUR 603

PAIP1 Protein Vector (Rat) (pPB-N-His)

PV292247 500 ng
EUR 603

PAIP1 Protein Vector (Rat) (pPM-C-HA)

PV292248 500 ng
EUR 603

PAIP1 Protein Vector (Rat) (pPM-C-His)

PV292249 500 ng
EUR 603

Paip1 3'UTR GFP Stable Cell Line

TU165857 1.0 ml Ask for price

PAIP1 3'UTR Luciferase Stable Cell Line

TU017340 1.0 ml
EUR 1394

Paip1 3'UTR Luciferase Stable Cell Line

TU115857 1.0 ml Ask for price

PAIP1 3'UTR GFP Stable Cell Line

TU067340 1.0 ml
EUR 1394

Paip1 3'UTR GFP Stable Cell Line

TU265768 1.0 ml Ask for price

Paip1 3'UTR Luciferase Stable Cell Line

TU215768 1.0 ml Ask for price

VEGF Rabbit Polyclonal Antibody

ES8453-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

VEGF Rabbit Polyclonal Antibody

ES8453-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody

ES8454-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody

ES8454-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody

ES8455-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody

ES8455-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8456-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8456-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8457-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8457-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSC70 Rabbit Polyclonal Antibody

ES8558-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSC70 Rabbit Polyclonal Antibody

ES8558-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody

ES8559-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody

ES8559-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP90? Rabbit Polyclonal Antibody

ES8560-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSP90? Rabbit Polyclonal Antibody

ES8560-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

IkB ? Rabbit Polyclonal Antibody

ES8561-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

IkB ? Rabbit Polyclonal Antibody

ES8561-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JAK1 Rabbit Polyclonal Antibody

ES8562-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK1 Rabbit Polyclonal Antibody

ES8562-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK2 Rabbit Polyclonal Antibody

ES8563-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK2 Rabbit Polyclonal Antibody

ES8563-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JNK2 Rabbit Polyclonal Antibody

ES8564-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JNK2 Rabbit Polyclonal Antibody

ES8564-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JNK3 Rabbit Polyclonal Antibody

ES8565-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JNK3 Rabbit Polyclonal Antibody

ES8565-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

MEK2 Rabbit Polyclonal Antibody

ES8566-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC

MEK2 Rabbit Polyclonal Antibody

ES8566-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC

MEK3 Rabbit Polyclonal Antibody

ES8567-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

MEK3 Rabbit Polyclonal Antibody

ES8567-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Nrf2 Rabbit Polyclonal Antibody

ES8568-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Nrf2 Rabbit Polyclonal Antibody

ES8568-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4a Rabbit Polyclonal Antibody

ES8569-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4a Rabbit Polyclonal Antibody

ES8569-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4b Rabbit Polyclonal Antibody

ES8570-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4b Rabbit Polyclonal Antibody

ES8570-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4c Rabbit Polyclonal Antibody

ES8571-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4c Rabbit Polyclonal Antibody

ES8571-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG5 Rabbit Polyclonal Antibody

ES8572-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG5 Rabbit Polyclonal Antibody

ES8572-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG7 Rabbit Polyclonal Antibody

ES8573-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG7 Rabbit Polyclonal Antibody

ES8573-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG13 Rabbit Polyclonal Antibody

ES8574-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG13 Rabbit Polyclonal Antibody

ES8574-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG13 Rabbit Polyclonal Antibody

ES8575-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG13 Rabbit Polyclonal Antibody

ES8575-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG14L Rabbit Polyclonal Antibody

ES8576-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG14L Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG14L Rabbit Polyclonal Antibody

ES8576-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG14L Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NBR1 Rabbit Polyclonal Antibody

ES8578-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NBR1 Rabbit Polyclonal Antibody

ES8578-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NBR1 Rabbit Polyclonal Antibody

ES8579-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NBR1 Rabbit Polyclonal Antibody

ES8579-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

WIPI2 Rabbit Polyclonal Antibody

ES8580-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against WIPI2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

WIPI2 Rabbit Polyclonal Antibody

ES8580-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against WIPI2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Gab1 Rabbit Polyclonal Antibody

ES8582-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against Gab1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Gab1 Rabbit Polyclonal Antibody

ES8582-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against Gab1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ERK1 Rabbit Polyclonal Antibody

ES8583-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ERK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ERK1 Rabbit Polyclonal Antibody

ES8583-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ERK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Met Rabbit Polyclonal Antibody

ABP57458-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

Met Rabbit Polyclonal Antibody

ABP57458-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

Met Rabbit Polyclonal Antibody

ABP57458-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

VEGF Rabbit Polyclonal Antibody

ABP57460-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

VEGF Rabbit Polyclonal Antibody

ABP57460-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

VEGF Rabbit Polyclonal Antibody

ABP57460-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

PAIP1 Rabbit Polyclonal Antibody