PDK3 Rabbit Polyclonal Antibody

PDK3 Polyclonal Antibody

ABP59869-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human PDK3 protein at amino acid sequence of 170-250
  • Applications tips:
Description: A polyclonal antibody for detection of PDK3 from Human, Mouse. This PDK3 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PDK3 protein at amino acid sequence of 170-250

PDK3 Polyclonal Antibody

ABP59869-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human PDK3 protein at amino acid sequence of 170-250
  • Applications tips:
Description: A polyclonal antibody for detection of PDK3 from Human, Mouse. This PDK3 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PDK3 protein at amino acid sequence of 170-250

PDK3 Polyclonal Antibody

31423-100ul 100ul
EUR 252

PDK3 Polyclonal Antibody

31423-50ul 50ul
EUR 187

PDK3 Polyclonal Antibody

27701-100ul 100ul
EUR 252

PDK3 Polyclonal Antibody

27701-50ul 50ul
EUR 187

PDK3 Rabbit pAb

A12480-100ul 100 ul
EUR 308

PDK3 Rabbit pAb

A12480-200ul 200 ul
EUR 459

PDK3 Rabbit pAb

A12480-20ul 20 ul
EUR 183

PDK3 Rabbit pAb

A12480-50ul 50 ul
EUR 223

PDK3 Rabbit pAb

A8028-100ul 100 ul
EUR 308

PDK3 Rabbit pAb

A8028-200ul 200 ul
EUR 459

PDK3 Rabbit pAb

A8028-20ul 20 ul
EUR 183

PDK3 Rabbit pAb

A8028-50ul 50 ul
EUR 223

PDK3 Polyclonal Conjugated Antibody

C31423 100ul
EUR 397

PDK3 Polyclonal Conjugated Antibody

C27701 100ul
EUR 397

PDK3 antibody

70R-2460 50 ug
EUR 467
Description: Rabbit polyclonal PDK3 antibody raised against the middle region of PDK3

PDK3 antibody

70R-2492 50 ug
EUR 467
Description: Rabbit polyclonal PDK3 antibody raised against the N terminal of PDK3

PDK3 Antibody

39575-100ul 100ul
EUR 390

PDK3 Antibody

1-CSB-PA613585ESR2HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against PDK3. Recognizes PDK3 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200

Pdk3 Antibody

1-CSB-PA852852LA01MO
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against Pdk3. Recognizes Pdk3 from Mouse, Human, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB; Recommended dilution: WB:1:500-1:5000

Polyclonal PDK3 Antibody (N-term)

APR10823G 0.1ml
EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human PDK3 (N-term). This antibody is tested and proven to work in the following applications:

Polyclonal Mouse Pdk3 Antibody (C-term)

APR07135G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human Mouse Pdk3 (C-term). This antibody is tested and proven to work in the following applications:

anti- PDK3 antibody

FNab06278 100µg
EUR 548.75
  • Recommended dilution: WB: 1:500 - 1:2000
  • IHC: 1:50 - 1:200
  • Immunogen: pyruvate dehydrogenase kinase, isozyme 3
  • Uniprot ID: Q15120
  • Gene ID: 5165
  • Research Area: Signal Transduction, Metabolism
Description: Antibody raised against PDK3

Mouse Pdk3 Antibody

abx027930-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Mouse Pdk3 Antibody

abx027930-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Anti-PDK3 antibody

PAab06278 100 ug
EUR 386

Anti-PDK3 antibody

STJ110334 100 µl
EUR 277
Description: The pyruvate dehydrogenase (PDH) complex is a nuclear-encoded mitochondrial multienzyme complex that catalyzes the overall conversion of pyruvate to acetyl-CoA and CO(2). It provides the primary link between glycolysis and the tricarboxylic acid (TCA) cycle, and thus is one of the major enzymes responsible for the regulation of glucose metabolism. The enzymatic activity of PDH is regulated by a phosphorylation/dephosphorylation cycle, and phosphorylation results in inactivation of PDH. The protein encoded by this gene is one of the three pyruvate dehydrogenase kinases that inhibits the PDH complex by phosphorylation of the E1 alpha subunit. This gene is predominantly expressed in the heart and skeletal muscles. Alternatively spliced transcript variants encoding different isoforms have been found for this gene.

Anti-PDK3 antibody

STJ114354 100 µl
EUR 277
Description: The pyruvate dehydrogenase (PDH) complex is a nuclear-encoded mitochondrial multienzyme complex that catalyzes the overall conversion of pyruvate to acetyl-CoA and CO(2). It provides the primary link between glycolysis and the tricarboxylic acid (TCA) cycle, and thus is one of the major enzymes responsible for the regulation of glucose metabolism. The enzymatic activity of PDH is regulated by a phosphorylation/dephosphorylation cycle, and phosphorylation results in inactivation of PDH. The protein encoded by this gene is one of the three pyruvate dehydrogenase kinases that inhibits the PDH complex by phosphorylation of the E1 alpha subunit. This gene is predominantly expressed in the heart and skeletal muscles. Alternatively spliced transcript variants encoding different isoforms have been found for this gene.

Anti-PDK3 antibody

STJ191232 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to PDK3

PDK3 siRNA

20-abx928148
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

PDK3 siRNA

20-abx928149
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

anti-PDK3

YF-PA13700 100 ul
EUR 403
Description: Rabbit polyclonal to PDK3

Pdk3 Antibody, HRP conjugated

1-CSB-PA852852LB01MO
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against Pdk3. Recognizes Pdk3 from Mouse. This antibody is HRP conjugated. Tested in the following application: ELISA

Pdk3 Antibody, FITC conjugated

1-CSB-PA852852LC01MO
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against Pdk3. Recognizes Pdk3 from Mouse. This antibody is FITC conjugated. Tested in the following application: ELISA

Pdk3 Antibody, Biotin conjugated

1-CSB-PA852852LD01MO
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against Pdk3. Recognizes Pdk3 from Mouse. This antibody is Biotin conjugated. Tested in the following application: ELISA

Antibody for Human PDK3

SPC-1188D 0.1ml
EUR 354
Description: A polyclonal antibody for PDK3 from Human | Mouse. The antibody is produced in rabbit after immunization with human synthetic peptide of human PDK3 (AA92-106). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This PDK3 antibody is unconjugated.

Antibody for Human PDK3

SPC-1188D-A390 0.1ml
EUR 401
Description: A polyclonal antibody for PDK3 from Human | Mouse. The antibody is produced in rabbit after immunization with human synthetic peptide of human PDK3 (AA92-106). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This PDK3 antibody is conjugated to ATTO 390.

Antibody for Human PDK3

SPC-1188D-A488 0.1ml
EUR 400
Description: A polyclonal antibody for PDK3 from Human | Mouse. The antibody is produced in rabbit after immunization with human synthetic peptide of human PDK3 (AA92-106). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This PDK3 antibody is conjugated to ATTO 488.

Antibody for Human PDK3

SPC-1188D-A565 0.1ml
EUR 400
Description: A polyclonal antibody for PDK3 from Human | Mouse. The antibody is produced in rabbit after immunization with human synthetic peptide of human PDK3 (AA92-106). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This PDK3 antibody is conjugated to ATTO 565.

Antibody for Human PDK3

SPC-1188D-A594 0.1ml
EUR 400
Description: A polyclonal antibody for PDK3 from Human | Mouse. The antibody is produced in rabbit after immunization with human synthetic peptide of human PDK3 (AA92-106). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This PDK3 antibody is conjugated to ATTO 594.

Antibody for Human PDK3

SPC-1188D-A633 0.1ml
EUR 400
Description: A polyclonal antibody for PDK3 from Human | Mouse. The antibody is produced in rabbit after immunization with human synthetic peptide of human PDK3 (AA92-106). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This PDK3 antibody is conjugated to ATTO 633.

Antibody for Human PDK3

SPC-1188D-A655 0.1ml
EUR 400
Description: A polyclonal antibody for PDK3 from Human | Mouse. The antibody is produced in rabbit after immunization with human synthetic peptide of human PDK3 (AA92-106). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This PDK3 antibody is conjugated to ATTO 655.

Antibody for Human PDK3

SPC-1188D-A680 0.1ml
EUR 400
Description: A polyclonal antibody for PDK3 from Human | Mouse. The antibody is produced in rabbit after immunization with human synthetic peptide of human PDK3 (AA92-106). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This PDK3 antibody is conjugated to ATTO 680.

Antibody for Human PDK3

SPC-1188D-A700 0.1ml
EUR 400
Description: A polyclonal antibody for PDK3 from Human | Mouse. The antibody is produced in rabbit after immunization with human synthetic peptide of human PDK3 (AA92-106). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This PDK3 antibody is conjugated to ATTO 700.

Antibody for Human PDK3

SPC-1188D-ALP 0.1ml
EUR 394
Description: A polyclonal antibody for PDK3 from Human | Mouse. The antibody is produced in rabbit after immunization with human synthetic peptide of human PDK3 (AA92-106). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This PDK3 antibody is conjugated to Alkaline Phosphatase.

Antibody for Human PDK3

SPC-1188D-APC 0.1ml
EUR 399
Description: A polyclonal antibody for PDK3 from Human | Mouse. The antibody is produced in rabbit after immunization with human synthetic peptide of human PDK3 (AA92-106). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This PDK3 antibody is conjugated to APC .

Antibody for Human PDK3

SPC-1188D-APCCY7 0.1ml
EUR 471
Description: A polyclonal antibody for PDK3 from Human | Mouse. The antibody is produced in rabbit after immunization with human synthetic peptide of human PDK3 (AA92-106). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This PDK3 antibody is conjugated to APC/Cy7.

Antibody for Human PDK3

SPC-1188D-BI 0.1ml
EUR 396
Description: A polyclonal antibody for PDK3 from Human | Mouse. The antibody is produced in rabbit after immunization with human synthetic peptide of human PDK3 (AA92-106). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This PDK3 antibody is conjugated to Biotin.

Antibody for Human PDK3

SPC-1188D-DY350 0.1ml
EUR 475
Description: A polyclonal antibody for PDK3 from Human | Mouse. The antibody is produced in rabbit after immunization with human synthetic peptide of human PDK3 (AA92-106). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This PDK3 antibody is conjugated to Dylight 350.

Antibody for Human PDK3

SPC-1188D-DY405 0.1ml
EUR 452
Description: A polyclonal antibody for PDK3 from Human | Mouse. The antibody is produced in rabbit after immunization with human synthetic peptide of human PDK3 (AA92-106). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This PDK3 antibody is conjugated to Dylight 405.

Antibody for Human PDK3

SPC-1188D-DY488 0.1ml
EUR 432
Description: A polyclonal antibody for PDK3 from Human | Mouse. The antibody is produced in rabbit after immunization with human synthetic peptide of human PDK3 (AA92-106). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This PDK3 antibody is conjugated to Dylight 488.

Antibody for Human PDK3

SPC-1188D-DY594 0.1ml
EUR 436
Description: A polyclonal antibody for PDK3 from Human | Mouse. The antibody is produced in rabbit after immunization with human synthetic peptide of human PDK3 (AA92-106). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This PDK3 antibody is conjugated to Dylight 594.

Antibody for Human PDK3

SPC-1188D-DY633 0.1ml
EUR 426
Description: A polyclonal antibody for PDK3 from Human | Mouse. The antibody is produced in rabbit after immunization with human synthetic peptide of human PDK3 (AA92-106). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This PDK3 antibody is conjugated to Dylight 633.

Antibody for Human PDK3

SPC-1188D-FITC 0.1ml
EUR 392
Description: A polyclonal antibody for PDK3 from Human | Mouse. The antibody is produced in rabbit after immunization with human synthetic peptide of human PDK3 (AA92-106). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This PDK3 antibody is conjugated to FITC.

Antibody for Human PDK3

SPC-1188D-HRP 0.1ml
EUR 388
Description: A polyclonal antibody for PDK3 from Human | Mouse. The antibody is produced in rabbit after immunization with human synthetic peptide of human PDK3 (AA92-106). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This PDK3 antibody is conjugated to HRP.

Antibody for Human PDK3

SPC-1188D-P594 0.1ml
EUR 407
Description: A polyclonal antibody for PDK3 from Human | Mouse. The antibody is produced in rabbit after immunization with human synthetic peptide of human PDK3 (AA92-106). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This PDK3 antibody is conjugated to PE/ATTO 594.

Antibody for Human PDK3

SPC-1188D-PCP 0.1ml
EUR 399
Description: A polyclonal antibody for PDK3 from Human | Mouse. The antibody is produced in rabbit after immunization with human synthetic peptide of human PDK3 (AA92-106). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This PDK3 antibody is conjugated to PerCP.

Antibody for Human PDK3

SPC-1188D-RPE 0.1ml
EUR 397
Description: A polyclonal antibody for PDK3 from Human | Mouse. The antibody is produced in rabbit after immunization with human synthetic peptide of human PDK3 (AA92-106). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This PDK3 antibody is conjugated to RPE .

Antibody for Human PDK3

SPC-1188D-STR 0.1ml
EUR 398
Description: A polyclonal antibody for PDK3 from Human | Mouse. The antibody is produced in rabbit after immunization with human synthetic peptide of human PDK3 (AA92-106). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This PDK3 antibody is conjugated to Streptavidin.

PDK3 cloning plasmid

CSB-CL613585HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1221
  • Sequence: atgcggctgttccggtggctgctgaagcagccggtgcccaagcagatcgagcgctactcgcgcttttcgccgtcgccgctctccatcaaacaattcctggacttcgggagagataatgcatgtgagaaaacttcatatatgtttctacgaaaggaacttcctgtgcggctggcta
  • Show more
Description: A cloning plasmid for the PDK3 gene.

PDK3 Blocking Peptide

33R-4222 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of PDK3 antibody, catalog no. 70R-2460

PDK3 Blocking Peptide

33R-8109 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of PDK3 antibody, catalog no. 70R-2492

pCMV-SPORT6-PDK3

PVT13165 2 ug
EUR 391

Anti-PDK3 (3A1)

YF-MA14656 100 ug
EUR 363
Description: Mouse monoclonal to PDK3

Anti-PDK3 (1G11)

YF-MA14657 100 ug
EUR 363
Description: Mouse monoclonal to PDK3

Anti-PDK3 (2B11)

YF-MA10681 100 ug
EUR 363
Description: Mouse monoclonal to PDK3

Pyruvate Dehydrogenase Kinase Isozyme 3 (PDK3) Polyclonal Antibody (Mouse)

4-PAD463Mu01
  • EUR 251.00
  • EUR 2576.00
  • EUR 640.00
  • EUR 316.00
  • EUR 215.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PDK3 (Gly138~Pro396)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Pyruvate Dehydrogenase Kinase Isozyme 3 (PDK3)

Human PDK3 ELISA KIT

ELI-21524h 96 Tests
EUR 824

PDK3 ELISA KIT|Human

EF001655 96 Tests
EUR 689

Mouse Pdk3 ELISA KIT

ELI-37725m 96 Tests
EUR 865

Human PDK3 shRNA Plasmid

20-abx953445
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse PDK3 shRNA Plasmid

20-abx982257
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

PDK3 Recombinant Protein (Human)

RP022942 100 ug Ask for price

PDK3 Recombinant Protein (Rat)

RP219902 100 ug Ask for price

PDK3 Recombinant Protein (Mouse)

RP161093 100 ug Ask for price

Pyruvate Dehydrogenase Kinase Isozyme 3 (PDK3) Polyclonal Antibody (Mouse), APC

4-PAD463Mu01-APC
  • EUR 351.00
  • EUR 3365.00
  • EUR 935.00
  • EUR 449.00
  • EUR 222.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PDK3 (Gly138~Pro396)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Pyruvate Dehydrogenase Kinase Isozyme 3 (PDK3). This antibody is labeled with APC.

Pyruvate Dehydrogenase Kinase Isozyme 3 (PDK3) Polyclonal Antibody (Mouse), Biotinylated

4-PAD463Mu01-Biotin
  • EUR 316.00
  • EUR 2526.00
  • EUR 744.00
  • EUR 387.00
  • EUR 221.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PDK3 (Gly138~Pro396)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Pyruvate Dehydrogenase Kinase Isozyme 3 (PDK3). This antibody is labeled with Biotin.

Pyruvate Dehydrogenase Kinase Isozyme 3 (PDK3) Polyclonal Antibody (Mouse), Cy3

4-PAD463Mu01-Cy3
  • EUR 427.00
  • EUR 4445.00
  • EUR 1205.00
  • EUR 557.00
  • EUR 254.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PDK3 (Gly138~Pro396)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Pyruvate Dehydrogenase Kinase Isozyme 3 (PDK3). This antibody is labeled with Cy3.

Pyruvate Dehydrogenase Kinase Isozyme 3 (PDK3) Polyclonal Antibody (Mouse), FITC

4-PAD463Mu01-FITC
  • EUR 301.00
  • EUR 2712.00
  • EUR 768.00
  • EUR 379.00
  • EUR 197.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PDK3 (Gly138~Pro396)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Pyruvate Dehydrogenase Kinase Isozyme 3 (PDK3). This antibody is labeled with FITC.

Pyruvate Dehydrogenase Kinase Isozyme 3 (PDK3) Polyclonal Antibody (Mouse), HRP

4-PAD463Mu01-HRP
  • EUR 321.00
  • EUR 2933.00
  • EUR 827.00
  • EUR 405.00
  • EUR 209.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PDK3 (Gly138~Pro396)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Pyruvate Dehydrogenase Kinase Isozyme 3 (PDK3). This antibody is labeled with HRP.

Pyruvate Dehydrogenase Kinase Isozyme 3 (PDK3) Polyclonal Antibody (Mouse), PE

4-PAD463Mu01-PE
  • EUR 301.00
  • EUR 2712.00
  • EUR 768.00
  • EUR 379.00
  • EUR 197.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PDK3 (Gly138~Pro396)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Pyruvate Dehydrogenase Kinase Isozyme 3 (PDK3). This antibody is labeled with PE.

Pyruvate Dehydrogenase Kinase Isozyme 3 (PDK3) Polyclonal Antibody (Mouse), APC-Cy7

4-PAD463Mu01-APC-Cy7
  • EUR 583.00
  • EUR 6610.00
  • EUR 1750.00
  • EUR 778.00
  • EUR 324.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PDK3 (Gly138~Pro396)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Pyruvate Dehydrogenase Kinase Isozyme 3 (PDK3). This antibody is labeled with APC-Cy7.

Pyruvate Dehydrogenase Kinase Isozyme 3 (PDK3) Antibody

20-abx129416
  • EUR 439.00
  • EUR 133.00
  • EUR 1233.00
  • EUR 592.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Pyruvate Dehydrogenase Kinase Isozyme 3 (PDK3) Antibody

abx036493-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Pyruvate Dehydrogenase Kinase Isozyme 3 (PDK3) Antibody

abx033137-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Pyruvate Dehydrogenase Kinase Isozyme 3 (PDK3) Antibody

abx033137-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Pyruvate Dehydrogenase Kinase Isozyme 3 (PDK3) Antibody

20-abx006057
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Pyruvate Dehydrogenase Kinase Isozyme 3 (PDK3) Antibody

20-abx322661
  • EUR 439.00
  • EUR 328.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Pyruvate Dehydrogenase Kinase Isozyme 3 (PDK3) Antibody

20-abx338957
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Pyruvate Dehydrogenase Kinase Isozyme 3 (PDK3) Antibody

abx236278-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

PDK3 ORF Vector (Human) (pORF)

ORF007648 1.0 ug DNA
EUR 95

h PDK3 inducible lentiviral particles

LVP060 1x107 IFU/ml x 200ul
EUR 451
Description: Pre-made tet-inducible lentiviral particles expressing a human gene with a Blasticidin-RFP fusion marker (Dual selection). The expressed human gene, PDK3, is fully sequence verified and matched to NCBI accession ID: NM_005391.4

Pdk3 ORF Vector (Rat) (pORF)

ORF073302 1.0 ug DNA
EUR 506

Pdk3 ORF Vector (Mouse) (pORF)

ORF053699 1.0 ug DNA
EUR 506

Pyruvate Dehydrogenase Kinase Isozyme 3 (PDK3) Antibody (HRP)

20-abx338936
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Pyruvate Dehydrogenase Kinase Isozyme 3 (PDK3) Antibody (FITC)

20-abx338937
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Pyruvate Dehydrogenase Kinase Isozyme 3 (PDK3) Antibody (Biotin)

20-abx338938
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

PDK3 sgRNA CRISPR Lentivector set (Human)

K1622201 3 x 1.0 ug
EUR 339

Pdk3 sgRNA CRISPR Lentivector set (Mouse)

K4229601 3 x 1.0 ug
EUR 339

Pdk3 sgRNA CRISPR Lentivector set (Rat)

K6709901 3 x 1.0 ug
EUR 339

PDK3 sgRNA CRISPR Lentivector (Human) (Target 1)

K1622202 1.0 ug DNA
EUR 154

PDK3 sgRNA CRISPR Lentivector (Human) (Target 2)

K1622203 1.0 ug DNA
EUR 154

PDK3 sgRNA CRISPR Lentivector (Human) (Target 3)

K1622204 1.0 ug DNA
EUR 154

Pdk3 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4229602 1.0 ug DNA
EUR 154

Pdk3 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4229603 1.0 ug DNA
EUR 154

Pdk3 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4229604 1.0 ug DNA
EUR 154

Pdk3 sgRNA CRISPR Lentivector (Rat) (Target 1)

K6709902 1.0 ug DNA
EUR 154

Pdk3 sgRNA CRISPR Lentivector (Rat) (Target 2)

K6709903 1.0 ug DNA
EUR 154

Pdk3 sgRNA CRISPR Lentivector (Rat) (Target 3)

K6709904 1.0 ug DNA
EUR 154

Recombinant Pyruvate Dehydrogenase Kinase Isozyme 3 (PDK3)

4-RPD463Mu01
  • EUR 494.24
  • EUR 235.00
  • EUR 1578.40
  • EUR 592.80
  • EUR 1085.60
  • EUR 394.00
  • EUR 3796.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q922H2
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 33.1KDa
  • Isoelectric Point: Inquire
Description: Recombinant Mouse Pyruvate Dehydrogenase Kinase Isozyme 3 expressed in: E.coli

PDK3 Protein Vector (Human) (pPB-C-His)

PV030589 500 ng
EUR 329

PDK3 Protein Vector (Human) (pPB-N-His)

PV030590 500 ng
EUR 329

PDK3 Protein Vector (Human) (pPM-C-HA)

PV030591 500 ng
EUR 329

PDK3 Protein Vector (Human) (pPM-C-His)

PV030592 500 ng
EUR 329

PDK3 Protein Vector (Mouse) (pPB-C-His)

PV214794 500 ng
EUR 603

PDK3 Protein Vector (Mouse) (pPB-N-His)

PV214795 500 ng
EUR 603

PDK3 Protein Vector (Mouse) (pPM-C-HA)

PV214796 500 ng
EUR 603

PDK3 Protein Vector (Mouse) (pPM-C-His)

PV214797 500 ng
EUR 603

PDK3 Protein Vector (Rat) (pPB-C-His)

PV293206 500 ng
EUR 603

PDK3 Protein Vector (Rat) (pPB-N-His)

PV293207 500 ng
EUR 603

PDK3 Protein Vector (Rat) (pPM-C-HA)

PV293208 500 ng
EUR 603

PDK3 Protein Vector (Rat) (pPM-C-His)

PV293209 500 ng
EUR 603

Pdk3 3'UTR GFP Stable Cell Line

TU166142 1.0 ml Ask for price

PDK3 3'UTR Luciferase Stable Cell Line

TU017674 1.0 ml
EUR 1394

Pdk3 3'UTR Luciferase Stable Cell Line

TU116142 1.0 ml Ask for price

PDK3 3'UTR GFP Stable Cell Line

TU067674 1.0 ml
EUR 1394

Pdk3 3'UTR GFP Stable Cell Line

TU266031 1.0 ml Ask for price

Pdk3 3'UTR Luciferase Stable Cell Line

TU216031 1.0 ml Ask for price

VEGF Rabbit Polyclonal Antibody

ES8453-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

VEGF Rabbit Polyclonal Antibody

ES8453-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody

ES8454-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody

ES8454-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody

ES8455-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody

ES8455-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8456-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8456-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8457-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8457-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSC70 Rabbit Polyclonal Antibody

ES8558-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSC70 Rabbit Polyclonal Antibody

ES8558-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody

ES8559-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody

ES8559-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP90? Rabbit Polyclonal Antibody

ES8560-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSP90? Rabbit Polyclonal Antibody

ES8560-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

IkB ? Rabbit Polyclonal Antibody

ES8561-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

IkB ? Rabbit Polyclonal Antibody

ES8561-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JAK1 Rabbit Polyclonal Antibody

ES8562-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK1 Rabbit Polyclonal Antibody

ES8562-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK2 Rabbit Polyclonal Antibody

ES8563-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK2 Rabbit Polyclonal Antibody

ES8563-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JNK2 Rabbit Polyclonal Antibody

ES8564-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JNK2 Rabbit Polyclonal Antibody

ES8564-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JNK3 Rabbit Polyclonal Antibody

ES8565-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JNK3 Rabbit Polyclonal Antibody

ES8565-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

MEK2 Rabbit Polyclonal Antibody

ES8566-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC

MEK2 Rabbit Polyclonal Antibody

ES8566-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC

MEK3 Rabbit Polyclonal Antibody

ES8567-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

MEK3 Rabbit Polyclonal Antibody

ES8567-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Nrf2 Rabbit Polyclonal Antibody

ES8568-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Nrf2 Rabbit Polyclonal Antibody

ES8568-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4a Rabbit Polyclonal Antibody

ES8569-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4a Rabbit Polyclonal Antibody

ES8569-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4b Rabbit Polyclonal Antibody

ES8570-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4b Rabbit Polyclonal Antibody

ES8570-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4c Rabbit Polyclonal Antibody

ES8571-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4c Rabbit Polyclonal Antibody

ES8571-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG5 Rabbit Polyclonal Antibody

ES8572-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG5 Rabbit Polyclonal Antibody

ES8572-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG7 Rabbit Polyclonal Antibody

ES8573-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG7 Rabbit Polyclonal Antibody

ES8573-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG13 Rabbit Polyclonal Antibody

ES8574-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG13 Rabbit Polyclonal Antibody

ES8574-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG13 Rabbit Polyclonal Antibody

ES8575-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG13 Rabbit Polyclonal Antibody

ES8575-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG14L Rabbit Polyclonal Antibody

ES8576-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG14L Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG14L Rabbit Polyclonal Antibody

ES8576-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG14L Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NBR1 Rabbit Polyclonal Antibody

ES8578-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NBR1 Rabbit Polyclonal Antibody

ES8578-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NBR1 Rabbit Polyclonal Antibody

ES8579-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NBR1 Rabbit Polyclonal Antibody

ES8579-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

WIPI2 Rabbit Polyclonal Antibody

ES8580-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against WIPI2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

WIPI2 Rabbit Polyclonal Antibody

ES8580-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against WIPI2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Gab1 Rabbit Polyclonal Antibody

ES8582-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against Gab1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Gab1 Rabbit Polyclonal Antibody

ES8582-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against Gab1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ERK1 Rabbit Polyclonal Antibody

ES8583-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ERK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ERK1 Rabbit Polyclonal Antibody

ES8583-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ERK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Met Rabbit Polyclonal Antibody

ABP57458-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

Met Rabbit Polyclonal Antibody

ABP57458-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

Met Rabbit Polyclonal Antibody

ABP57458-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

VEGF Rabbit Polyclonal Antibody

ABP57460-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

VEGF Rabbit Polyclonal Antibody

ABP57460-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

VEGF Rabbit Polyclonal Antibody

ABP57460-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

CD10 Rabbit Polyclonal Antibody

ABP57461-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

CD10 Rabbit Polyclonal Antibody

ABP57461-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

CD10 Rabbit Polyclonal Antibody

ABP57461-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

NM23A Rabbit Polyclonal Antibody

ABP57462-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of NM23A of NME1
  • Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1

NM23A Rabbit Polyclonal Antibody

ABP57462-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of NM23A of NME1
  • Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1

NM23A Rabbit Polyclonal Antibody

ABP57462-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of NM23A of NME1
  • Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1

ATM Rabbit Polyclonal Antibody

ABP57463-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody

ABP57463-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody

ABP57463-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody

ABP57464-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

PDK3 Rabbit Polyclonal Antibody