PDK3 Rabbit Polyclonal Antibody

Polyclonal PDK3 Antibody
APR10843G	Leading Biology	0.1ml	EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human PDK3 . This antibody is tested and proven to work in the following applications:

PDK3 Polyclonal Antibody
ABP59869-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Synthesized peptide derived from part region of human PDK3 protein at amino acid sequence of 170-250 Applications tips:
Description: A polyclonal antibody for detection of PDK3 from Human, Mouse. This PDK3 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PDK3 protein at amino acid sequence of 170-250

PDK3 Polyclonal Antibody
ABP59869-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Synthesized peptide derived from part region of human PDK3 protein at amino acid sequence of 170-250 Applications tips:
Description: A polyclonal antibody for detection of PDK3 from Human, Mouse. This PDK3 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PDK3 protein at amino acid sequence of 170-250

PDK3 Polyclonal Antibody
ABP59869-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Synthesized peptide derived from part region of human PDK3 protein at amino acid sequence of 170-250 Applications tips:
Description: A polyclonal antibody for detection of PDK3 from Human, Mouse. This PDK3 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PDK3 protein at amino acid sequence of 170-250

PDK3 Polyclonal Antibody
ES10074-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against PDK3 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

PDK3 Polyclonal Antibody
ES10074-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against PDK3 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

PDK3 Rabbit pAb
A12480-100ul	Abclonal	100 ul	EUR 308

PDK3 Rabbit pAb
A12480-200ul	Abclonal	200 ul	EUR 459

PDK3 Rabbit pAb
A12480-20ul	Abclonal	20 ul	EUR 183

PDK3 Rabbit pAb
A12480-50ul	Abclonal	50 ul	EUR 223

PDK3 Rabbit pAb
A8028-100ul	Abclonal	100 ul	EUR 308

PDK3 Rabbit pAb
A8028-200ul	Abclonal	200 ul	EUR 459

PDK3 Rabbit pAb
A8028-20ul	Abclonal	20 ul	EUR 183

PDK3 Rabbit pAb
A8028-50ul	Abclonal	50 ul	EUR 223

PDK3 Polyclonal Conjugated Antibody
C27701	SAB	100ul	EUR 397

PDK3 Polyclonal Conjugated Antibody
C31423	SAB	100ul	EUR 397

PDK3 antibody
70R-2460	Fitzgerald	50 ug	EUR 467
Description: Rabbit polyclonal PDK3 antibody raised against the middle region of PDK3

PDK3 antibody
70R-2492	Fitzgerald	50 ug	EUR 467
Description: Rabbit polyclonal PDK3 antibody raised against the N terminal of PDK3

PDK3 Antibody
39575-100ul	SAB	100ul	EUR 390

Pdk3 Antibody
1-CSB-PA852852LA01MO	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against Pdk3. Recognizes Pdk3 from Mouse, Human, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB; Recommended dilution: WB:1:500-1:5000

PDK3 Antibody
1-CSB-PA613585ESR2HU	Cusabio	EUR 222.00 EUR 335.00	100ul 50ul
Form: Liquid Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against PDK3. Recognizes PDK3 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200

Polyclonal PDK3 Antibody (N-term)
APR10823G	Leading Biology	0.1ml	EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human PDK3 (N-term). This antibody is tested and proven to work in the following applications:

Polyclonal Mouse Pdk3 Antibody (C-term)
APR07135G	Leading Biology	0.1ml	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human Mouse Pdk3 (C-term). This antibody is tested and proven to work in the following applications:

Mouse Pdk3 Antibody
abx027930-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

Mouse Pdk3 Antibody
abx027930-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

anti- PDK3 antibody
FNab06278	FN Test	100µg	EUR 548.75
Recommended dilution: WB: 1:500 - 1:2000 IHC: 1:50 - 1:200 Immunogen: pyruvate dehydrogenase kinase, isozyme 3 Uniprot ID: Q15120 Gene ID: 5165 Research Area: Signal Transduction, Metabolism
Description: Antibody raised against PDK3

Anti-PDK3 antibody
PAab06278	Lifescience Market	100 ug	EUR 386

Anti-PDK3 antibody
STJ110334	St John's Laboratory	100 µl	EUR 277
Description: The pyruvate dehydrogenase (PDH) complex is a nuclear-encoded mitochondrial multienzyme complex that catalyzes the overall conversion of pyruvate to acetyl-CoA and CO(2). It provides the primary link between glycolysis and the tricarboxylic acid (TCA) cycle, and thus is one of the major enzymes responsible for the regulation of glucose metabolism. The enzymatic activity of PDH is regulated by a phosphorylation/dephosphorylation cycle, and phosphorylation results in inactivation of PDH. The protein encoded by this gene is one of the three pyruvate dehydrogenase kinases that inhibits the PDH complex by phosphorylation of the E1 alpha subunit. This gene is predominantly expressed in the heart and skeletal muscles. Alternatively spliced transcript variants encoding different isoforms have been found for this gene.

Anti-PDK3 antibody
STJ114354	St John's Laboratory	100 µl	EUR 277
Description: The pyruvate dehydrogenase (PDH) complex is a nuclear-encoded mitochondrial multienzyme complex that catalyzes the overall conversion of pyruvate to acetyl-CoA and CO(2). It provides the primary link between glycolysis and the tricarboxylic acid (TCA) cycle, and thus is one of the major enzymes responsible for the regulation of glucose metabolism. The enzymatic activity of PDH is regulated by a phosphorylation/dephosphorylation cycle, and phosphorylation results in inactivation of PDH. The protein encoded by this gene is one of the three pyruvate dehydrogenase kinases that inhibits the PDH complex by phosphorylation of the E1 alpha subunit. This gene is predominantly expressed in the heart and skeletal muscles. Alternatively spliced transcript variants encoding different isoforms have been found for this gene.

Anti-PDK3 antibody
STJ191232	St John's Laboratory	200 µl	EUR 197
Description: Unconjugated Rabbit polyclonal to PDK3

PDK3 siRNA
20-abx928148	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

PDK3 siRNA
20-abx928149	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

anti-PDK3
YF-PA13700	Abfrontier	100 ul	EUR 403
Description: Rabbit polyclonal to PDK3

Pdk3 Antibody, HRP conjugated
1-CSB-PA852852LB01MO	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against Pdk3. Recognizes Pdk3 from Mouse. This antibody is HRP conjugated. Tested in the following application: ELISA

Pdk3 Antibody, FITC conjugated
1-CSB-PA852852LC01MO	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against Pdk3. Recognizes Pdk3 from Mouse. This antibody is FITC conjugated. Tested in the following application: ELISA

Pdk3 Antibody, Biotin conjugated
1-CSB-PA852852LD01MO	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against Pdk3. Recognizes Pdk3 from Mouse. This antibody is Biotin conjugated. Tested in the following application: ELISA

Antibody for Human PDK3
SPC-1188D	Stressmarq	0.1ml	EUR 354
Description: A polyclonal antibody for PDK3 from Human | Mouse. The antibody is produced in rabbit after immunization with human synthetic peptide of human PDK3 (AA92-106). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This PDK3 antibody is unconjugated.

Antibody for Human PDK3
SPC-1188D-A390	Stressmarq	0.1ml	EUR 401
Description: A polyclonal antibody for PDK3 from Human | Mouse. The antibody is produced in rabbit after immunization with human synthetic peptide of human PDK3 (AA92-106). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This PDK3 antibody is conjugated to ATTO 390.

Antibody for Human PDK3
SPC-1188D-A488	Stressmarq	0.1ml	EUR 400
Description: A polyclonal antibody for PDK3 from Human | Mouse. The antibody is produced in rabbit after immunization with human synthetic peptide of human PDK3 (AA92-106). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This PDK3 antibody is conjugated to ATTO 488.

Antibody for Human PDK3
SPC-1188D-A565	Stressmarq	0.1ml	EUR 400
Description: A polyclonal antibody for PDK3 from Human | Mouse. The antibody is produced in rabbit after immunization with human synthetic peptide of human PDK3 (AA92-106). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This PDK3 antibody is conjugated to ATTO 565.

Antibody for Human PDK3
SPC-1188D-A594	Stressmarq	0.1ml	EUR 400
Description: A polyclonal antibody for PDK3 from Human | Mouse. The antibody is produced in rabbit after immunization with human synthetic peptide of human PDK3 (AA92-106). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This PDK3 antibody is conjugated to ATTO 594.

Antibody for Human PDK3
SPC-1188D-A633	Stressmarq	0.1ml	EUR 400
Description: A polyclonal antibody for PDK3 from Human | Mouse. The antibody is produced in rabbit after immunization with human synthetic peptide of human PDK3 (AA92-106). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This PDK3 antibody is conjugated to ATTO 633.

Antibody for Human PDK3
SPC-1188D-A655	Stressmarq	0.1ml	EUR 400
Description: A polyclonal antibody for PDK3 from Human | Mouse. The antibody is produced in rabbit after immunization with human synthetic peptide of human PDK3 (AA92-106). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This PDK3 antibody is conjugated to ATTO 655.

Antibody for Human PDK3
SPC-1188D-A680	Stressmarq	0.1ml	EUR 400
Description: A polyclonal antibody for PDK3 from Human | Mouse. The antibody is produced in rabbit after immunization with human synthetic peptide of human PDK3 (AA92-106). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This PDK3 antibody is conjugated to ATTO 680.

Antibody for Human PDK3
SPC-1188D-A700	Stressmarq	0.1ml	EUR 400
Description: A polyclonal antibody for PDK3 from Human | Mouse. The antibody is produced in rabbit after immunization with human synthetic peptide of human PDK3 (AA92-106). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This PDK3 antibody is conjugated to ATTO 700.

Antibody for Human PDK3
SPC-1188D-ALP	Stressmarq	0.1ml	EUR 394
Description: A polyclonal antibody for PDK3 from Human | Mouse. The antibody is produced in rabbit after immunization with human synthetic peptide of human PDK3 (AA92-106). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This PDK3 antibody is conjugated to Alkaline Phosphatase.

Antibody for Human PDK3
SPC-1188D-APC	Stressmarq	0.1ml	EUR 399
Description: A polyclonal antibody for PDK3 from Human | Mouse. The antibody is produced in rabbit after immunization with human synthetic peptide of human PDK3 (AA92-106). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This PDK3 antibody is conjugated to APC .

Antibody for Human PDK3
SPC-1188D-APCCY7	Stressmarq	0.1ml	EUR 471
Description: A polyclonal antibody for PDK3 from Human | Mouse. The antibody is produced in rabbit after immunization with human synthetic peptide of human PDK3 (AA92-106). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This PDK3 antibody is conjugated to APC/Cy7.

Antibody for Human PDK3
SPC-1188D-BI	Stressmarq	0.1ml	EUR 396
Description: A polyclonal antibody for PDK3 from Human | Mouse. The antibody is produced in rabbit after immunization with human synthetic peptide of human PDK3 (AA92-106). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This PDK3 antibody is conjugated to Biotin.

Antibody for Human PDK3
SPC-1188D-DY350	Stressmarq	0.1ml	EUR 475
Description: A polyclonal antibody for PDK3 from Human | Mouse. The antibody is produced in rabbit after immunization with human synthetic peptide of human PDK3 (AA92-106). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This PDK3 antibody is conjugated to Dylight 350.

Antibody for Human PDK3
SPC-1188D-DY405	Stressmarq	0.1ml	EUR 452
Description: A polyclonal antibody for PDK3 from Human | Mouse. The antibody is produced in rabbit after immunization with human synthetic peptide of human PDK3 (AA92-106). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This PDK3 antibody is conjugated to Dylight 405.

Antibody for Human PDK3
SPC-1188D-DY488	Stressmarq	0.1ml	EUR 432
Description: A polyclonal antibody for PDK3 from Human | Mouse. The antibody is produced in rabbit after immunization with human synthetic peptide of human PDK3 (AA92-106). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This PDK3 antibody is conjugated to Dylight 488.

Antibody for Human PDK3
SPC-1188D-DY594	Stressmarq	0.1ml	EUR 436
Description: A polyclonal antibody for PDK3 from Human | Mouse. The antibody is produced in rabbit after immunization with human synthetic peptide of human PDK3 (AA92-106). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This PDK3 antibody is conjugated to Dylight 594.

Antibody for Human PDK3
SPC-1188D-DY633	Stressmarq	0.1ml	EUR 426
Description: A polyclonal antibody for PDK3 from Human | Mouse. The antibody is produced in rabbit after immunization with human synthetic peptide of human PDK3 (AA92-106). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This PDK3 antibody is conjugated to Dylight 633.

Antibody for Human PDK3
SPC-1188D-FITC	Stressmarq	0.1ml	EUR 392
Description: A polyclonal antibody for PDK3 from Human | Mouse. The antibody is produced in rabbit after immunization with human synthetic peptide of human PDK3 (AA92-106). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This PDK3 antibody is conjugated to FITC.

Antibody for Human PDK3
SPC-1188D-HRP	Stressmarq	0.1ml	EUR 388
Description: A polyclonal antibody for PDK3 from Human | Mouse. The antibody is produced in rabbit after immunization with human synthetic peptide of human PDK3 (AA92-106). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This PDK3 antibody is conjugated to HRP.

Antibody for Human PDK3
SPC-1188D-P594	Stressmarq	0.1ml	EUR 407
Description: A polyclonal antibody for PDK3 from Human | Mouse. The antibody is produced in rabbit after immunization with human synthetic peptide of human PDK3 (AA92-106). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This PDK3 antibody is conjugated to PE/ATTO 594.

Antibody for Human PDK3
SPC-1188D-PCP	Stressmarq	0.1ml	EUR 399
Description: A polyclonal antibody for PDK3 from Human | Mouse. The antibody is produced in rabbit after immunization with human synthetic peptide of human PDK3 (AA92-106). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This PDK3 antibody is conjugated to PerCP.

Antibody for Human PDK3
SPC-1188D-RPE	Stressmarq	0.1ml	EUR 397
Description: A polyclonal antibody for PDK3 from Human | Mouse. The antibody is produced in rabbit after immunization with human synthetic peptide of human PDK3 (AA92-106). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This PDK3 antibody is conjugated to RPE .

Antibody for Human PDK3
SPC-1188D-STR	Stressmarq	0.1ml	EUR 398
Description: A polyclonal antibody for PDK3 from Human | Mouse. The antibody is produced in rabbit after immunization with human synthetic peptide of human PDK3 (AA92-106). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This PDK3 antibody is conjugated to Streptavidin.

PDK3 Blocking Peptide
33R-4222	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of PDK3 antibody, catalog no. 70R-2460

PDK3 Blocking Peptide
33R-8109	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of PDK3 antibody, catalog no. 70R-2492

PDK3 cloning plasmid
CSB-CL613585HU-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1221 Sequence: atgcggctgttccggtggctgctgaagcagccggtgcccaagcagatcgagcgctactcgcgcttttcgccgtcgccgctctccatcaaacaattcctggacttcgggagagataatgcatgtgagaaaacttcatatatgtttctacgaaaggaacttcctgtgcggctggcta Show more
Description: A cloning plasmid for the PDK3 gene.

pCMV-SPORT6-PDK3
PVT13165	Lifescience Market	2 ug	EUR 391

Anti-PDK3 (2B11)
YF-MA10681	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to PDK3

Anti-PDK3 (3A1)
YF-MA14656	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to PDK3

Anti-PDK3 (1G11)
YF-MA14657	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to PDK3

Pyruvate Dehydrogenase Kinase Isozyme 3 (PDK3) Polyclonal Antibody (Mouse)
4-PAD463Mu01	Cloud-Clone	EUR 251.00 EUR 2576.00 EUR 640.00 EUR 316.00 EUR 215.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PDK3 (Gly138~Pro396) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Pyruvate Dehydrogenase Kinase Isozyme 3 (PDK3)

Human PDK3 ELISA KIT
ELI-21524h	Lifescience Market	96 Tests	EUR 824

PDK3 ELISA KIT|Human
EF001655	Lifescience Market	96 Tests	EUR 689

Human PDK3 shRNA Plasmid
20-abx953445	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Mouse PDK3 shRNA Plasmid
20-abx982257	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Mouse Pdk3 ELISA KIT
ELI-37725m	Lifescience Market	96 Tests	EUR 865

PDK3 Recombinant Protein (Human)
RP022942	ABM	100 ug	Ask for price

PDK3 Recombinant Protein (Mouse)
RP161093	ABM	100 ug	Ask for price

PDK3 Recombinant Protein (Rat)
RP219902	ABM	100 ug	Ask for price

Pyruvate Dehydrogenase Kinase Isozyme 3 (PDK3) Polyclonal Antibody (Mouse), APC
4-PAD463Mu01-APC	Cloud-Clone	EUR 351.00 EUR 3365.00 EUR 935.00 EUR 449.00 EUR 222.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PDK3 (Gly138~Pro396) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Pyruvate Dehydrogenase Kinase Isozyme 3 (PDK3). This antibody is labeled with APC.

Pyruvate Dehydrogenase Kinase Isozyme 3 (PDK3) Polyclonal Antibody (Mouse), Biotinylated
4-PAD463Mu01-Biotin	Cloud-Clone	EUR 316.00 EUR 2526.00 EUR 744.00 EUR 387.00 EUR 221.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PDK3 (Gly138~Pro396) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Pyruvate Dehydrogenase Kinase Isozyme 3 (PDK3). This antibody is labeled with Biotin.

Pyruvate Dehydrogenase Kinase Isozyme 3 (PDK3) Polyclonal Antibody (Mouse), Cy3
4-PAD463Mu01-Cy3	Cloud-Clone	EUR 427.00 EUR 4445.00 EUR 1205.00 EUR 557.00 EUR 254.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PDK3 (Gly138~Pro396) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Pyruvate Dehydrogenase Kinase Isozyme 3 (PDK3). This antibody is labeled with Cy3.

Pyruvate Dehydrogenase Kinase Isozyme 3 (PDK3) Polyclonal Antibody (Mouse), FITC
4-PAD463Mu01-FITC	Cloud-Clone	EUR 301.00 EUR 2712.00 EUR 768.00 EUR 379.00 EUR 197.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PDK3 (Gly138~Pro396) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Pyruvate Dehydrogenase Kinase Isozyme 3 (PDK3). This antibody is labeled with FITC.

Pyruvate Dehydrogenase Kinase Isozyme 3 (PDK3) Polyclonal Antibody (Mouse), HRP
4-PAD463Mu01-HRP	Cloud-Clone	EUR 321.00 EUR 2933.00 EUR 827.00 EUR 405.00 EUR 209.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PDK3 (Gly138~Pro396) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Pyruvate Dehydrogenase Kinase Isozyme 3 (PDK3). This antibody is labeled with HRP.

Pyruvate Dehydrogenase Kinase Isozyme 3 (PDK3) Polyclonal Antibody (Mouse), PE
4-PAD463Mu01-PE	Cloud-Clone	EUR 301.00 EUR 2712.00 EUR 768.00 EUR 379.00 EUR 197.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PDK3 (Gly138~Pro396) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Pyruvate Dehydrogenase Kinase Isozyme 3 (PDK3). This antibody is labeled with PE.

Pyruvate Dehydrogenase Kinase Isozyme 3 (PDK3) Polyclonal Antibody (Mouse), APC-Cy7
4-PAD463Mu01-APC-Cy7	Cloud-Clone	EUR 583.00 EUR 6610.00 EUR 1750.00 EUR 778.00 EUR 324.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PDK3 (Gly138~Pro396) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Pyruvate Dehydrogenase Kinase Isozyme 3 (PDK3). This antibody is labeled with APC-Cy7.

Pyruvate Dehydrogenase Kinase Isozyme 3 (PDK3) Antibody
20-abx006057	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

Pyruvate Dehydrogenase Kinase Isozyme 3 (PDK3) Antibody
abx036493-100ug	Abbexa	100 ug	EUR 391
Shipped within 5-10 working days.

Pyruvate Dehydrogenase Kinase Isozyme 3 (PDK3) Antibody
20-abx129416	Abbexa	EUR 439.00 EUR 133.00 EUR 1233.00 EUR 592.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Pyruvate Dehydrogenase Kinase Isozyme 3 (PDK3) Antibody
abx033137-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

Pyruvate Dehydrogenase Kinase Isozyme 3 (PDK3) Antibody
abx033137-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

Pyruvate Dehydrogenase Kinase Isozyme 3 (PDK3) Antibody
20-abx338957	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Pyruvate Dehydrogenase Kinase Isozyme 3 (PDK3) Antibody
abx236278-100ug	Abbexa	100 ug	EUR 509
Shipped within 5-12 working days.

Pyruvate Dehydrogenase Kinase Isozyme 3 (PDK3) Antibody
20-abx322661	Abbexa	EUR 439.00 EUR 328.00	100 ul 50 ul
Shipped within 5-10 working days.

Pdk3 ORF Vector (Rat) (pORF)
ORF073302	ABM	1.0 ug DNA	EUR 506

h PDK3 inducible lentiviral particles
LVP060	GenTarget	1x107 IFU/ml x 200ul	EUR 451
Description: Pre-made tet-inducible lentiviral particles expressing a human gene with a Blasticidin-RFP fusion marker (Dual selection). The expressed human gene, PDK3, is fully sequence verified and matched to NCBI accession ID: NM_005391.4

PDK3 ORF Vector (Human) (pORF)
ORF007648	ABM	1.0 ug DNA	EUR 95

Pdk3 ORF Vector (Mouse) (pORF)
ORF053699	ABM	1.0 ug DNA	EUR 506

Pyruvate Dehydrogenase Kinase Isozyme 3 (PDK3) Antibody (HRP)
20-abx338936	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Pyruvate Dehydrogenase Kinase Isozyme 3 (PDK3) Antibody (FITC)
20-abx338937	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Pyruvate Dehydrogenase Kinase Isozyme 3 (PDK3) Antibody (Biotin)
20-abx338938	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Pdk3 sgRNA CRISPR Lentivector set (Rat)
K6709901	ABM	3 x 1.0 ug	EUR 339

Pdk3 sgRNA CRISPR Lentivector set (Mouse)
K4229601	ABM	3 x 1.0 ug	EUR 339

PDK3 sgRNA CRISPR Lentivector set (Human)
K1622201	ABM	3 x 1.0 ug	EUR 339

Pdk3 sgRNA CRISPR Lentivector (Rat) (Target 1)
K6709902	ABM	1.0 ug DNA	EUR 154

Pdk3 sgRNA CRISPR Lentivector (Rat) (Target 2)
K6709903	ABM	1.0 ug DNA	EUR 154

Pdk3 sgRNA CRISPR Lentivector (Rat) (Target 3)
K6709904	ABM	1.0 ug DNA	EUR 154

Pdk3 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4229602	ABM	1.0 ug DNA	EUR 154

Pdk3 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4229603	ABM	1.0 ug DNA	EUR 154

Pdk3 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4229604	ABM	1.0 ug DNA	EUR 154

PDK3 sgRNA CRISPR Lentivector (Human) (Target 1)
K1622202	ABM	1.0 ug DNA	EUR 154

PDK3 sgRNA CRISPR Lentivector (Human) (Target 2)
K1622203	ABM	1.0 ug DNA	EUR 154

PDK3 sgRNA CRISPR Lentivector (Human) (Target 3)
K1622204	ABM	1.0 ug DNA	EUR 154

PDK3 Protein Vector (Rat) (pPB-C-His)
PV293206	ABM	500 ng	EUR 603

PDK3 Protein Vector (Rat) (pPB-N-His)
PV293207	ABM	500 ng	EUR 603

PDK3 Protein Vector (Rat) (pPM-C-HA)
PV293208	ABM	500 ng	EUR 603

PDK3 Protein Vector (Rat) (pPM-C-His)
PV293209	ABM	500 ng	EUR 603

PDK3 Protein Vector (Mouse) (pPB-C-His)
PV214794	ABM	500 ng	EUR 603

PDK3 Protein Vector (Mouse) (pPB-N-His)
PV214795	ABM	500 ng	EUR 603

PDK3 Protein Vector (Mouse) (pPM-C-HA)
PV214796	ABM	500 ng	EUR 603

PDK3 Protein Vector (Mouse) (pPM-C-His)
PV214797	ABM	500 ng	EUR 603

PDK3 Protein Vector (Human) (pPB-C-His)
PV030589	ABM	500 ng	EUR 329

PDK3 Protein Vector (Human) (pPB-N-His)
PV030590	ABM	500 ng	EUR 329

PDK3 Protein Vector (Human) (pPM-C-HA)
PV030591	ABM	500 ng	EUR 329

PDK3 Protein Vector (Human) (pPM-C-His)
PV030592	ABM	500 ng	EUR 329

Recombinant Pyruvate Dehydrogenase Kinase Isozyme 3 (PDK3)
4-RPD463Mu01	Cloud-Clone	EUR 494.24 EUR 235.00 EUR 1578.40 EUR 592.80 EUR 1085.60 EUR 394.00 EUR 3796.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: Q922H2 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 33.1KDa Isoelectric Point: Inquire
Description: Recombinant Mouse Pyruvate Dehydrogenase Kinase Isozyme 3 expressed in: E.coli

Pdk3 3'UTR Luciferase Stable Cell Line
TU116142	ABM	1.0 ml	Ask for price

Pdk3 3'UTR GFP Stable Cell Line
TU166142	ABM	1.0 ml	Ask for price

Pdk3 3'UTR Luciferase Stable Cell Line
TU216031	ABM	1.0 ml	Ask for price

Pdk3 3'UTR GFP Stable Cell Line
TU266031	ABM	1.0 ml	Ask for price

PDK3 3'UTR GFP Stable Cell Line
TU067674	ABM	1.0 ml	EUR 1394

PDK3 3'UTR Luciferase Stable Cell Line
TU017674	ABM	1.0 ml	EUR 1394

GAPDH Rabbit Polyclonal Antibody
37985-100ul	SAB	100ul	EUR 252

GAPDH Rabbit Polyclonal Antibody
37985-50ul	SAB	50ul	EUR 187

EFHD1 Rabbit Polyclonal Antibody
38001-100ul	SAB	100ul	EUR 252

EFHD1 Rabbit Polyclonal Antibody
38001-50ul	SAB	50ul	EUR 187

Alliinase Rabbit Polyclonal Antibody
38042-100ul	SAB	100ul	EUR 252

Alliinase Rabbit Polyclonal Antibody
38042-50ul	SAB	50ul	EUR 187

ECFP Rabbit Polyclonal Antibody
38077-100ul	SAB	100ul	EUR 252

ECFP Rabbit Polyclonal Antibody
38077-50ul	SAB	50ul	EUR 187

EYFP Rabbit Polyclonal Antibody
38078-100ul	SAB	100ul	EUR 252

EYFP Rabbit Polyclonal Antibody
38078-50ul	SAB	50ul	EUR 187

mOrange Rabbit Polyclonal Antibody
38079-100ul	SAB	100ul	EUR 252

mOrange Rabbit Polyclonal Antibody
38079-50ul	SAB	50ul	EUR 187

mStrawberry Rabbit Polyclonal Antibody
38083-100ul	SAB	100ul	EUR 252

mStrawberry Rabbit Polyclonal Antibody
38083-50ul	SAB	50ul	EUR 187

AmCyan Rabbit Polyclonal Antibody
38086-100ul	SAB	100ul	EUR 252

AmCyan Rabbit Polyclonal Antibody
38086-50ul	SAB	50ul	EUR 187

EBFP Rabbit Polyclonal Antibody
38087-100ul	SAB	100ul	EUR 252

EBFP Rabbit Polyclonal Antibody
38087-50ul	SAB	50ul	EUR 187

Vimentin Rabbit Polyclonal Antibody
38104-100ul	SAB	100ul	EUR 252

Vimentin Rabbit Polyclonal Antibody
38104-50ul	SAB	50ul	EUR 187

LDHD Rabbit Polyclonal Antibody
38105-100ul	SAB	100ul	EUR 252

LDHD Rabbit Polyclonal Antibody
38105-50ul	SAB	50ul	EUR 187

GAPDH Rabbit Polyclonal Antibody
A01021-005ml	Abbkine	0.05ml	EUR 147
Immunogen information: Recombinant Protein Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

GAPDH Rabbit Polyclonal Antibody
A01021-02ml	Abbkine	0.2ml	EUR 332
Immunogen information: Recombinant Protein Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

GAPDH Rabbit Polyclonal Antibody
A01021-02ml5	Abbkine	0.2ml×5	EUR 920
Immunogen information: Recombinant Protein Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

Rabbit Hemoglobin Polyclonal Antibody
A53073	EpiGentek	100 µg	EUR 570.55
Description: The best epigenetics products

Met Rabbit Polyclonal Antibody
ABP57458-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of Met of MET Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

Met Rabbit Polyclonal Antibody
ABP57458-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of Met of MET Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

Met Rabbit Polyclonal Antibody
ABP57458-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of Met of MET Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

VEGF Rabbit Polyclonal Antibody
ABP57460-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of VEGF of VEGFA Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

VEGF Rabbit Polyclonal Antibody
ABP57460-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of VEGF of VEGFA Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

VEGF Rabbit Polyclonal Antibody
ABP57460-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of VEGF of VEGFA Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

CD10 Rabbit Polyclonal Antibody
ABP57461-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of CD10 of MME Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

CD10 Rabbit Polyclonal Antibody
ABP57461-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of CD10 of MME Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

CD10 Rabbit Polyclonal Antibody
ABP57461-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of CD10 of MME Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

NM23A Rabbit Polyclonal Antibody
ABP57462-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of NM23A of NME1 Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1

NM23A Rabbit Polyclonal Antibody
ABP57462-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of NM23A of NME1 Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1

NM23A Rabbit Polyclonal Antibody
ABP57462-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of NM23A of NME1 Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1

ATM Rabbit Polyclonal Antibody
ABP57463-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of ATM of ATM Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody
ABP57463-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of ATM of ATM Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody
ABP57463-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of ATM of ATM Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody
ABP57464-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of ATM of ATM Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody
ABP57464-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of ATM of ATM Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody
ABP57464-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of ATM of ATM Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

HSC70 Rabbit Polyclonal Antibody
ABP57565-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8) Applications tips:
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)

HSC70 Rabbit Polyclonal Antibody
ABP57565-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8) Applications tips:
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)

HSC70 Rabbit Polyclonal Antibody
ABP57565-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8) Applications tips:
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)

HSP40 Rabbit Polyclonal Antibody
ABP57566-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of HSP40 Applications tips:
Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40

HSP40 Rabbit Polyclonal Antibody
ABP57566-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of HSP40 Applications tips:
Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40

HSP40 Rabbit Polyclonal Antibody
ABP57566-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of HSP40 Applications tips:
Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40

HSP90Alpha Rabbit Polyclonal Antibody
ABP57567-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of HSP90? Applications tips:
Description: A polyclonal antibody for detection of HSP90Alpha from Human, Mouse, Rat. This HSP90Alpha antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP90?

HSP90Alpha Rabbit Polyclonal Antibody
ABP57567-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of HSP90? Applications tips:
Description: A polyclonal antibody for detection of HSP90Alpha from Human, Mouse, Rat. This HSP90Alpha antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP90?

HSP90Alpha Rabbit Polyclonal Antibody
ABP57567-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of HSP90? Applications tips:
Description: A polyclonal antibody for detection of HSP90Alpha from Human, Mouse, Rat. This HSP90Alpha antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP90?

JAK1 Rabbit Polyclonal Antibody
ABP57569-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of JAK1 Applications tips:
Description: A polyclonal antibody for detection of JAK1 from Human, Mouse, Rat. This JAK1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK1

JAK1 Rabbit Polyclonal Antibody
ABP57569-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of JAK1 Applications tips:
Description: A polyclonal antibody for detection of JAK1 from Human, Mouse, Rat. This JAK1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK1

JAK1 Rabbit Polyclonal Antibody
ABP57569-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of JAK1 Applications tips:
Description: A polyclonal antibody for detection of JAK1 from Human, Mouse, Rat. This JAK1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK1

JAK2 Rabbit Polyclonal Antibody
ABP57570-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of JAK2 Applications tips:
Description: A polyclonal antibody for detection of JAK2 from Human, Mouse, Rat. This JAK2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK2

JAK2 Rabbit Polyclonal Antibody
ABP57570-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of JAK2 Applications tips:
Description: A polyclonal antibody for detection of JAK2 from Human, Mouse, Rat. This JAK2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK2

JAK2 Rabbit Polyclonal Antibody
ABP57570-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of JAK2 Applications tips:
Description: A polyclonal antibody for detection of JAK2 from Human, Mouse, Rat. This JAK2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK2

JNK2 Rabbit Polyclonal Antibody
ABP57571-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of JNK2 Applications tips:
Description: A polyclonal antibody for detection of JNK2 from Human, Mouse, Rat. This JNK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK2

JNK2 Rabbit Polyclonal Antibody
ABP57571-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of JNK2 Applications tips:
Description: A polyclonal antibody for detection of JNK2 from Human, Mouse, Rat. This JNK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK2

JNK2 Rabbit Polyclonal Antibody
ABP57571-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of JNK2 Applications tips:
Description: A polyclonal antibody for detection of JNK2 from Human, Mouse, Rat. This JNK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK2

JNK3 Rabbit Polyclonal Antibody
ABP57572-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of JNK3 Applications tips:
Description: A polyclonal antibody for detection of JNK3 from Human, Mouse, Rat. This JNK3 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK3

JNK3 Rabbit Polyclonal Antibody
ABP57572-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of JNK3 Applications tips:
Description: A polyclonal antibody for detection of JNK3 from Human, Mouse, Rat. This JNK3 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK3

JNK3 Rabbit Polyclonal Antibody
ABP57572-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of JNK3 Applications tips:
Description: A polyclonal antibody for detection of JNK3 from Human, Mouse, Rat. This JNK3 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK3

MEK2 Rabbit Polyclonal Antibody
ABP57573-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of MEK2 Applications tips:
Description: A polyclonal antibody for detection of MEK2 from Human. This MEK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of MEK2

MEK2 Rabbit Polyclonal Antibody
ABP57573-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of MEK2 Applications tips:
Description: A polyclonal antibody for detection of MEK2 from Human. This MEK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of MEK2

MEK2 Rabbit Polyclonal Antibody
ABP57573-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of MEK2 Applications tips:
Description: A polyclonal antibody for detection of MEK2 from Human. This MEK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of MEK2

MEK3 Rabbit Polyclonal Antibody
ABP57574-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of MEK3 Applications tips:
Description: A polyclonal antibody for detection of MEK3 from Human, Mouse, Rat. This MEK3 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of MEK3

MEK3 Rabbit Polyclonal Antibody
ABP57574-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of MEK3 Applications tips:
Description: A polyclonal antibody for detection of MEK3 from Human, Mouse, Rat. This MEK3 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of MEK3

MEK3 Rabbit Polyclonal Antibody
ABP57574-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of MEK3 Applications tips:
Description: A polyclonal antibody for detection of MEK3 from Human, Mouse, Rat. This MEK3 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of MEK3

Nrf2 Rabbit Polyclonal Antibody
ABP57575-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of Nrf2 Applications tips:
Description: A polyclonal antibody for detection of Nrf2 from Human, Mouse, Rat. This Nrf2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Nrf2

Nrf2 Rabbit Polyclonal Antibody
ABP57575-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of Nrf2 Applications tips:
Description: A polyclonal antibody for detection of Nrf2 from Human, Mouse, Rat. This Nrf2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Nrf2

Nrf2 Rabbit Polyclonal Antibody
ABP57575-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of Nrf2 Applications tips:
Description: A polyclonal antibody for detection of Nrf2 from Human, Mouse, Rat. This Nrf2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Nrf2

PDK3 Rabbit Polyclonal Antibody