Biocat Net

Amine biocat 3.0

PDK3 Rabbit Polyclonal Antibody

Polyclonal PDK3 Antibody

APR10843G 0.1ml
EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human PDK3 . This antibody is tested and proven to work in the following applications:

PDK3 Polyclonal Antibody

ABP59869-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human PDK3 protein at amino acid sequence of 170-250
  • Applications tips:
Description: A polyclonal antibody for detection of PDK3 from Human, Mouse. This PDK3 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PDK3 protein at amino acid sequence of 170-250

PDK3 Polyclonal Antibody

ABP59869-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human PDK3 protein at amino acid sequence of 170-250
  • Applications tips:
Description: A polyclonal antibody for detection of PDK3 from Human, Mouse. This PDK3 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PDK3 protein at amino acid sequence of 170-250

PDK3 Polyclonal Antibody

ABP59869-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human PDK3 protein at amino acid sequence of 170-250
  • Applications tips:
Description: A polyclonal antibody for detection of PDK3 from Human, Mouse. This PDK3 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PDK3 protein at amino acid sequence of 170-250

PDK3 Polyclonal Antibody

ES10074-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against PDK3 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

PDK3 Polyclonal Antibody

ES10074-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against PDK3 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

PDK3 Rabbit pAb

A12480-100ul 100 ul
EUR 308

PDK3 Rabbit pAb

A12480-200ul 200 ul
EUR 459

PDK3 Rabbit pAb

A12480-20ul 20 ul
EUR 183

PDK3 Rabbit pAb

A12480-50ul 50 ul
EUR 223

PDK3 Rabbit pAb

A8028-100ul 100 ul
EUR 308

PDK3 Rabbit pAb

A8028-200ul 200 ul
EUR 459

PDK3 Rabbit pAb

A8028-20ul 20 ul
EUR 183

PDK3 Rabbit pAb

A8028-50ul 50 ul
EUR 223

PDK3 Polyclonal Conjugated Antibody

C27701 100ul
EUR 397

PDK3 Polyclonal Conjugated Antibody

C31423 100ul
EUR 397

PDK3 antibody

70R-2460 50 ug
EUR 467
Description: Rabbit polyclonal PDK3 antibody raised against the middle region of PDK3

PDK3 antibody

70R-2492 50 ug
EUR 467
Description: Rabbit polyclonal PDK3 antibody raised against the N terminal of PDK3

PDK3 Antibody

39575-100ul 100ul
EUR 390

Pdk3 Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against Pdk3. Recognizes Pdk3 from Mouse, Human, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB; Recommended dilution: WB:1:500-1:5000

PDK3 Antibody

  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against PDK3. Recognizes PDK3 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200

Polyclonal PDK3 Antibody (N-term)

APR10823G 0.1ml
EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human PDK3 (N-term). This antibody is tested and proven to work in the following applications:

Polyclonal Mouse Pdk3 Antibody (C-term)

APR07135G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human Mouse Pdk3 (C-term). This antibody is tested and proven to work in the following applications:

Mouse Pdk3 Antibody

abx027930-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Mouse Pdk3 Antibody

abx027930-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

anti- PDK3 antibody

FNab06278 100µg
EUR 548.75
  • Recommended dilution: WB: 1:500 - 1:2000
  • IHC: 1:50 - 1:200
  • Immunogen: pyruvate dehydrogenase kinase, isozyme 3
  • Uniprot ID: Q15120
  • Gene ID: 5165
  • Research Area: Signal Transduction, Metabolism
Description: Antibody raised against PDK3

Anti-PDK3 antibody

PAab06278 100 ug
EUR 386

Anti-PDK3 antibody

STJ110334 100 µl
EUR 277
Description: The pyruvate dehydrogenase (PDH) complex is a nuclear-encoded mitochondrial multienzyme complex that catalyzes the overall conversion of pyruvate to acetyl-CoA and CO(2). It provides the primary link between glycolysis and the tricarboxylic acid (TCA) cycle, and thus is one of the major enzymes responsible for the regulation of glucose metabolism. The enzymatic activity of PDH is regulated by a phosphorylation/dephosphorylation cycle, and phosphorylation results in inactivation of PDH. The protein encoded by this gene is one of the three pyruvate dehydrogenase kinases that inhibits the PDH complex by phosphorylation of the E1 alpha subunit. This gene is predominantly expressed in the heart and skeletal muscles. Alternatively spliced transcript variants encoding different isoforms have been found for this gene.

Anti-PDK3 antibody

STJ114354 100 µl
EUR 277
Description: The pyruvate dehydrogenase (PDH) complex is a nuclear-encoded mitochondrial multienzyme complex that catalyzes the overall conversion of pyruvate to acetyl-CoA and CO(2). It provides the primary link between glycolysis and the tricarboxylic acid (TCA) cycle, and thus is one of the major enzymes responsible for the regulation of glucose metabolism. The enzymatic activity of PDH is regulated by a phosphorylation/dephosphorylation cycle, and phosphorylation results in inactivation of PDH. The protein encoded by this gene is one of the three pyruvate dehydrogenase kinases that inhibits the PDH complex by phosphorylation of the E1 alpha subunit. This gene is predominantly expressed in the heart and skeletal muscles. Alternatively spliced transcript variants encoding different isoforms have been found for this gene.

Anti-PDK3 antibody

STJ191232 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to PDK3


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


YF-PA13700 100 ul
EUR 403
Description: Rabbit polyclonal to PDK3

Pdk3 Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against Pdk3. Recognizes Pdk3 from Mouse. This antibody is HRP conjugated. Tested in the following application: ELISA

Pdk3 Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against Pdk3. Recognizes Pdk3 from Mouse. This antibody is FITC conjugated. Tested in the following application: ELISA

Pdk3 Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against Pdk3. Recognizes Pdk3 from Mouse. This antibody is Biotin conjugated. Tested in the following application: ELISA

Antibody for Human PDK3

SPC-1188D 0.1ml
EUR 354
Description: A polyclonal antibody for PDK3 from Human | Mouse. The antibody is produced in rabbit after immunization with human synthetic peptide of human PDK3 (AA92-106). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This PDK3 antibody is unconjugated.

Antibody for Human PDK3

SPC-1188D-A390 0.1ml
EUR 401
Description: A polyclonal antibody for PDK3 from Human | Mouse. The antibody is produced in rabbit after immunization with human synthetic peptide of human PDK3 (AA92-106). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This PDK3 antibody is conjugated to ATTO 390.

Antibody for Human PDK3

SPC-1188D-A488 0.1ml
EUR 400
Description: A polyclonal antibody for PDK3 from Human | Mouse. The antibody is produced in rabbit after immunization with human synthetic peptide of human PDK3 (AA92-106). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This PDK3 antibody is conjugated to ATTO 488.

Antibody for Human PDK3

SPC-1188D-A565 0.1ml
EUR 400
Description: A polyclonal antibody for PDK3 from Human | Mouse. The antibody is produced in rabbit after immunization with human synthetic peptide of human PDK3 (AA92-106). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This PDK3 antibody is conjugated to ATTO 565.

Antibody for Human PDK3

SPC-1188D-A594 0.1ml
EUR 400
Description: A polyclonal antibody for PDK3 from Human | Mouse. The antibody is produced in rabbit after immunization with human synthetic peptide of human PDK3 (AA92-106). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This PDK3 antibody is conjugated to ATTO 594.

Antibody for Human PDK3

SPC-1188D-A633 0.1ml
EUR 400
Description: A polyclonal antibody for PDK3 from Human | Mouse. The antibody is produced in rabbit after immunization with human synthetic peptide of human PDK3 (AA92-106). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This PDK3 antibody is conjugated to ATTO 633.

Antibody for Human PDK3

SPC-1188D-A655 0.1ml
EUR 400
Description: A polyclonal antibody for PDK3 from Human | Mouse. The antibody is produced in rabbit after immunization with human synthetic peptide of human PDK3 (AA92-106). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This PDK3 antibody is conjugated to ATTO 655.

Antibody for Human PDK3

SPC-1188D-A680 0.1ml
EUR 400
Description: A polyclonal antibody for PDK3 from Human | Mouse. The antibody is produced in rabbit after immunization with human synthetic peptide of human PDK3 (AA92-106). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This PDK3 antibody is conjugated to ATTO 680.

Antibody for Human PDK3

SPC-1188D-A700 0.1ml
EUR 400
Description: A polyclonal antibody for PDK3 from Human | Mouse. The antibody is produced in rabbit after immunization with human synthetic peptide of human PDK3 (AA92-106). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This PDK3 antibody is conjugated to ATTO 700.

Antibody for Human PDK3

SPC-1188D-ALP 0.1ml
EUR 394
Description: A polyclonal antibody for PDK3 from Human | Mouse. The antibody is produced in rabbit after immunization with human synthetic peptide of human PDK3 (AA92-106). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This PDK3 antibody is conjugated to Alkaline Phosphatase.

Antibody for Human PDK3

SPC-1188D-APC 0.1ml
EUR 399
Description: A polyclonal antibody for PDK3 from Human | Mouse. The antibody is produced in rabbit after immunization with human synthetic peptide of human PDK3 (AA92-106). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This PDK3 antibody is conjugated to APC .

Antibody for Human PDK3

SPC-1188D-APCCY7 0.1ml
EUR 471
Description: A polyclonal antibody for PDK3 from Human | Mouse. The antibody is produced in rabbit after immunization with human synthetic peptide of human PDK3 (AA92-106). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This PDK3 antibody is conjugated to APC/Cy7.

Antibody for Human PDK3

SPC-1188D-BI 0.1ml
EUR 396
Description: A polyclonal antibody for PDK3 from Human | Mouse. The antibody is produced in rabbit after immunization with human synthetic peptide of human PDK3 (AA92-106). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This PDK3 antibody is conjugated to Biotin.

Antibody for Human PDK3

SPC-1188D-DY350 0.1ml
EUR 475
Description: A polyclonal antibody for PDK3 from Human | Mouse. The antibody is produced in rabbit after immunization with human synthetic peptide of human PDK3 (AA92-106). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This PDK3 antibody is conjugated to Dylight 350.

Antibody for Human PDK3

SPC-1188D-DY405 0.1ml
EUR 452
Description: A polyclonal antibody for PDK3 from Human | Mouse. The antibody is produced in rabbit after immunization with human synthetic peptide of human PDK3 (AA92-106). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This PDK3 antibody is conjugated to Dylight 405.

Antibody for Human PDK3

SPC-1188D-DY488 0.1ml
EUR 432
Description: A polyclonal antibody for PDK3 from Human | Mouse. The antibody is produced in rabbit after immunization with human synthetic peptide of human PDK3 (AA92-106). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This PDK3 antibody is conjugated to Dylight 488.

Antibody for Human PDK3

SPC-1188D-DY594 0.1ml
EUR 436
Description: A polyclonal antibody for PDK3 from Human | Mouse. The antibody is produced in rabbit after immunization with human synthetic peptide of human PDK3 (AA92-106). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This PDK3 antibody is conjugated to Dylight 594.

Antibody for Human PDK3

SPC-1188D-DY633 0.1ml
EUR 426
Description: A polyclonal antibody for PDK3 from Human | Mouse. The antibody is produced in rabbit after immunization with human synthetic peptide of human PDK3 (AA92-106). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This PDK3 antibody is conjugated to Dylight 633.

Antibody for Human PDK3

SPC-1188D-FITC 0.1ml
EUR 392
Description: A polyclonal antibody for PDK3 from Human | Mouse. The antibody is produced in rabbit after immunization with human synthetic peptide of human PDK3 (AA92-106). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This PDK3 antibody is conjugated to FITC.

Antibody for Human PDK3

SPC-1188D-HRP 0.1ml
EUR 388
Description: A polyclonal antibody for PDK3 from Human | Mouse. The antibody is produced in rabbit after immunization with human synthetic peptide of human PDK3 (AA92-106). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This PDK3 antibody is conjugated to HRP.

Antibody for Human PDK3

SPC-1188D-P594 0.1ml
EUR 407
Description: A polyclonal antibody for PDK3 from Human | Mouse. The antibody is produced in rabbit after immunization with human synthetic peptide of human PDK3 (AA92-106). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This PDK3 antibody is conjugated to PE/ATTO 594.

Antibody for Human PDK3

SPC-1188D-PCP 0.1ml
EUR 399
Description: A polyclonal antibody for PDK3 from Human | Mouse. The antibody is produced in rabbit after immunization with human synthetic peptide of human PDK3 (AA92-106). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This PDK3 antibody is conjugated to PerCP.

Antibody for Human PDK3

SPC-1188D-RPE 0.1ml
EUR 397
Description: A polyclonal antibody for PDK3 from Human | Mouse. The antibody is produced in rabbit after immunization with human synthetic peptide of human PDK3 (AA92-106). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This PDK3 antibody is conjugated to RPE .

Antibody for Human PDK3

SPC-1188D-STR 0.1ml
EUR 398
Description: A polyclonal antibody for PDK3 from Human | Mouse. The antibody is produced in rabbit after immunization with human synthetic peptide of human PDK3 (AA92-106). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This PDK3 antibody is conjugated to Streptavidin.

PDK3 Blocking Peptide

33R-4222 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of PDK3 antibody, catalog no. 70R-2460

PDK3 Blocking Peptide

33R-8109 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of PDK3 antibody, catalog no. 70R-2492

PDK3 cloning plasmid

CSB-CL613585HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1221
  • Sequence: atgcggctgttccggtggctgctgaagcagccggtgcccaagcagatcgagcgctactcgcgcttttcgccgtcgccgctctccatcaaacaattcctggacttcgggagagataatgcatgtgagaaaacttcatatatgtttctacgaaaggaacttcctgtgcggctggcta
  • Show more
Description: A cloning plasmid for the PDK3 gene.


PVT13165 2 ug
EUR 391

Anti-PDK3 (2B11)

YF-MA10681 100 ug
EUR 363
Description: Mouse monoclonal to PDK3

Anti-PDK3 (3A1)

YF-MA14656 100 ug
EUR 363
Description: Mouse monoclonal to PDK3

Anti-PDK3 (1G11)

YF-MA14657 100 ug
EUR 363
Description: Mouse monoclonal to PDK3

Pyruvate Dehydrogenase Kinase Isozyme 3 (PDK3) Polyclonal Antibody (Mouse)

  • EUR 251.00
  • EUR 2576.00
  • EUR 640.00
  • EUR 316.00
  • EUR 215.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PDK3 (Gly138~Pro396)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Pyruvate Dehydrogenase Kinase Isozyme 3 (PDK3)


ELI-21524h 96 Tests
EUR 824


EF001655 96 Tests
EUR 689

Human PDK3 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse PDK3 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse Pdk3 ELISA KIT

ELI-37725m 96 Tests
EUR 865

PDK3 Recombinant Protein (Human)

RP022942 100 ug Ask for price

PDK3 Recombinant Protein (Mouse)

RP161093 100 ug Ask for price

PDK3 Recombinant Protein (Rat)

RP219902 100 ug Ask for price

Pyruvate Dehydrogenase Kinase Isozyme 3 (PDK3) Polyclonal Antibody (Mouse), APC

  • EUR 351.00
  • EUR 3365.00
  • EUR 935.00
  • EUR 449.00
  • EUR 222.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PDK3 (Gly138~Pro396)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Pyruvate Dehydrogenase Kinase Isozyme 3 (PDK3). This antibody is labeled with APC.

Pyruvate Dehydrogenase Kinase Isozyme 3 (PDK3) Polyclonal Antibody (Mouse), Biotinylated

  • EUR 316.00
  • EUR 2526.00
  • EUR 744.00
  • EUR 387.00
  • EUR 221.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PDK3 (Gly138~Pro396)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Pyruvate Dehydrogenase Kinase Isozyme 3 (PDK3). This antibody is labeled with Biotin.

Pyruvate Dehydrogenase Kinase Isozyme 3 (PDK3) Polyclonal Antibody (Mouse), Cy3

  • EUR 427.00
  • EUR 4445.00
  • EUR 1205.00
  • EUR 557.00
  • EUR 254.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PDK3 (Gly138~Pro396)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Pyruvate Dehydrogenase Kinase Isozyme 3 (PDK3). This antibody is labeled with Cy3.

Pyruvate Dehydrogenase Kinase Isozyme 3 (PDK3) Polyclonal Antibody (Mouse), FITC

  • EUR 301.00
  • EUR 2712.00
  • EUR 768.00
  • EUR 379.00
  • EUR 197.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PDK3 (Gly138~Pro396)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Pyruvate Dehydrogenase Kinase Isozyme 3 (PDK3). This antibody is labeled with FITC.

Pyruvate Dehydrogenase Kinase Isozyme 3 (PDK3) Polyclonal Antibody (Mouse), HRP

  • EUR 321.00
  • EUR 2933.00
  • EUR 827.00
  • EUR 405.00
  • EUR 209.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PDK3 (Gly138~Pro396)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Pyruvate Dehydrogenase Kinase Isozyme 3 (PDK3). This antibody is labeled with HRP.

Pyruvate Dehydrogenase Kinase Isozyme 3 (PDK3) Polyclonal Antibody (Mouse), PE

  • EUR 301.00
  • EUR 2712.00
  • EUR 768.00
  • EUR 379.00
  • EUR 197.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PDK3 (Gly138~Pro396)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Pyruvate Dehydrogenase Kinase Isozyme 3 (PDK3). This antibody is labeled with PE.

Pyruvate Dehydrogenase Kinase Isozyme 3 (PDK3) Polyclonal Antibody (Mouse), APC-Cy7

  • EUR 583.00
  • EUR 6610.00
  • EUR 1750.00
  • EUR 778.00
  • EUR 324.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PDK3 (Gly138~Pro396)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Pyruvate Dehydrogenase Kinase Isozyme 3 (PDK3). This antibody is labeled with APC-Cy7.

Pyruvate Dehydrogenase Kinase Isozyme 3 (PDK3) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Pyruvate Dehydrogenase Kinase Isozyme 3 (PDK3) Antibody

abx036493-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Pyruvate Dehydrogenase Kinase Isozyme 3 (PDK3) Antibody

  • EUR 439.00
  • EUR 133.00
  • EUR 1233.00
  • EUR 592.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Pyruvate Dehydrogenase Kinase Isozyme 3 (PDK3) Antibody

abx033137-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Pyruvate Dehydrogenase Kinase Isozyme 3 (PDK3) Antibody

abx033137-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Pyruvate Dehydrogenase Kinase Isozyme 3 (PDK3) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Pyruvate Dehydrogenase Kinase Isozyme 3 (PDK3) Antibody

abx236278-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

Pyruvate Dehydrogenase Kinase Isozyme 3 (PDK3) Antibody

  • EUR 439.00
  • EUR 328.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Pdk3 ORF Vector (Rat) (pORF)

ORF073302 1.0 ug DNA
EUR 506

h PDK3 inducible lentiviral particles

LVP060 1x107 IFU/ml x 200ul
EUR 451
Description: Pre-made tet-inducible lentiviral particles expressing a human gene with a Blasticidin-RFP fusion marker (Dual selection). The expressed human gene, PDK3, is fully sequence verified and matched to NCBI accession ID: NM_005391.4

PDK3 ORF Vector (Human) (pORF)

ORF007648 1.0 ug DNA
EUR 95

Pdk3 ORF Vector (Mouse) (pORF)

ORF053699 1.0 ug DNA
EUR 506

Pyruvate Dehydrogenase Kinase Isozyme 3 (PDK3) Antibody (HRP)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Pyruvate Dehydrogenase Kinase Isozyme 3 (PDK3) Antibody (FITC)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Pyruvate Dehydrogenase Kinase Isozyme 3 (PDK3) Antibody (Biotin)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Pdk3 sgRNA CRISPR Lentivector set (Rat)

K6709901 3 x 1.0 ug
EUR 339

Pdk3 sgRNA CRISPR Lentivector set (Mouse)

K4229601 3 x 1.0 ug
EUR 339

PDK3 sgRNA CRISPR Lentivector set (Human)

K1622201 3 x 1.0 ug
EUR 339

Pdk3 sgRNA CRISPR Lentivector (Rat) (Target 1)

K6709902 1.0 ug DNA
EUR 154

Pdk3 sgRNA CRISPR Lentivector (Rat) (Target 2)

K6709903 1.0 ug DNA
EUR 154

Pdk3 sgRNA CRISPR Lentivector (Rat) (Target 3)

K6709904 1.0 ug DNA
EUR 154

Pdk3 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4229602 1.0 ug DNA
EUR 154

Pdk3 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4229603 1.0 ug DNA
EUR 154

Pdk3 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4229604 1.0 ug DNA
EUR 154

PDK3 sgRNA CRISPR Lentivector (Human) (Target 1)

K1622202 1.0 ug DNA
EUR 154

PDK3 sgRNA CRISPR Lentivector (Human) (Target 2)

K1622203 1.0 ug DNA
EUR 154

PDK3 sgRNA CRISPR Lentivector (Human) (Target 3)

K1622204 1.0 ug DNA
EUR 154

PDK3 Protein Vector (Rat) (pPB-C-His)

PV293206 500 ng
EUR 603

PDK3 Protein Vector (Rat) (pPB-N-His)

PV293207 500 ng
EUR 603

PDK3 Protein Vector (Rat) (pPM-C-HA)

PV293208 500 ng
EUR 603

PDK3 Protein Vector (Rat) (pPM-C-His)

PV293209 500 ng
EUR 603

PDK3 Protein Vector (Mouse) (pPB-C-His)

PV214794 500 ng
EUR 603

PDK3 Protein Vector (Mouse) (pPB-N-His)

PV214795 500 ng
EUR 603

PDK3 Protein Vector (Mouse) (pPM-C-HA)

PV214796 500 ng
EUR 603

PDK3 Protein Vector (Mouse) (pPM-C-His)

PV214797 500 ng
EUR 603

PDK3 Protein Vector (Human) (pPB-C-His)

PV030589 500 ng
EUR 329

PDK3 Protein Vector (Human) (pPB-N-His)

PV030590 500 ng
EUR 329

PDK3 Protein Vector (Human) (pPM-C-HA)

PV030591 500 ng
EUR 329

PDK3 Protein Vector (Human) (pPM-C-His)

PV030592 500 ng
EUR 329

Recombinant Pyruvate Dehydrogenase Kinase Isozyme 3 (PDK3)

  • EUR 494.24
  • EUR 235.00
  • EUR 1578.40
  • EUR 592.80
  • EUR 1085.60
  • EUR 394.00
  • EUR 3796.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q922H2
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 33.1KDa
  • Isoelectric Point: Inquire
Description: Recombinant Mouse Pyruvate Dehydrogenase Kinase Isozyme 3 expressed in: E.coli

Pdk3 3'UTR Luciferase Stable Cell Line

TU116142 1.0 ml Ask for price

Pdk3 3'UTR GFP Stable Cell Line

TU166142 1.0 ml Ask for price

Pdk3 3'UTR Luciferase Stable Cell Line

TU216031 1.0 ml Ask for price

Pdk3 3'UTR GFP Stable Cell Line

TU266031 1.0 ml Ask for price

PDK3 3'UTR GFP Stable Cell Line

TU067674 1.0 ml
EUR 1394

PDK3 3'UTR Luciferase Stable Cell Line

TU017674 1.0 ml
EUR 1394

GAPDH Rabbit Polyclonal Antibody

37985-100ul 100ul
EUR 252

GAPDH Rabbit Polyclonal Antibody

37985-50ul 50ul
EUR 187

EFHD1 Rabbit Polyclonal Antibody

38001-100ul 100ul
EUR 252

EFHD1 Rabbit Polyclonal Antibody

38001-50ul 50ul
EUR 187

Alliinase Rabbit Polyclonal Antibody

38042-100ul 100ul
EUR 252

Alliinase Rabbit Polyclonal Antibody

38042-50ul 50ul
EUR 187

ECFP Rabbit Polyclonal Antibody

38077-100ul 100ul
EUR 252

ECFP Rabbit Polyclonal Antibody

38077-50ul 50ul
EUR 187

EYFP Rabbit Polyclonal Antibody

38078-100ul 100ul
EUR 252

EYFP Rabbit Polyclonal Antibody

38078-50ul 50ul
EUR 187

mOrange Rabbit Polyclonal Antibody

38079-100ul 100ul
EUR 252

mOrange Rabbit Polyclonal Antibody

38079-50ul 50ul
EUR 187

mStrawberry Rabbit Polyclonal Antibody

38083-100ul 100ul
EUR 252

mStrawberry Rabbit Polyclonal Antibody

38083-50ul 50ul
EUR 187

AmCyan Rabbit Polyclonal Antibody

38086-100ul 100ul
EUR 252

AmCyan Rabbit Polyclonal Antibody

38086-50ul 50ul
EUR 187

EBFP Rabbit Polyclonal Antibody

38087-100ul 100ul
EUR 252

EBFP Rabbit Polyclonal Antibody

38087-50ul 50ul
EUR 187

Vimentin Rabbit Polyclonal Antibody

38104-100ul 100ul
EUR 252

Vimentin Rabbit Polyclonal Antibody

38104-50ul 50ul
EUR 187

LDHD Rabbit Polyclonal Antibody

38105-100ul 100ul
EUR 252

LDHD Rabbit Polyclonal Antibody

38105-50ul 50ul
EUR 187

GAPDH Rabbit Polyclonal Antibody

A01021-005ml 0.05ml
EUR 147
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

GAPDH Rabbit Polyclonal Antibody

A01021-02ml 0.2ml
EUR 332
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

GAPDH Rabbit Polyclonal Antibody

A01021-02ml5 0.2ml×5
EUR 920
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

Rabbit Hemoglobin Polyclonal Antibody

A53073 100 µg
EUR 570.55
Description: The best epigenetics products

Met Rabbit Polyclonal Antibody

ABP57458-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

Met Rabbit Polyclonal Antibody

ABP57458-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

Met Rabbit Polyclonal Antibody

ABP57458-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

VEGF Rabbit Polyclonal Antibody

ABP57460-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

VEGF Rabbit Polyclonal Antibody

ABP57460-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

VEGF Rabbit Polyclonal Antibody

ABP57460-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

CD10 Rabbit Polyclonal Antibody

ABP57461-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

CD10 Rabbit Polyclonal Antibody

ABP57461-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

CD10 Rabbit Polyclonal Antibody

ABP57461-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

NM23A Rabbit Polyclonal Antibody

ABP57462-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of NM23A of NME1
  • Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1

NM23A Rabbit Polyclonal Antibody

ABP57462-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of NM23A of NME1
  • Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1

NM23A Rabbit Polyclonal Antibody

ABP57462-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of NM23A of NME1
  • Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1

ATM Rabbit Polyclonal Antibody

ABP57463-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody

ABP57463-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody

ABP57463-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody

ABP57464-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody

ABP57464-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody

ABP57464-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

HSC70 Rabbit Polyclonal Antibody

ABP57565-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
  • Applications tips:
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)

HSC70 Rabbit Polyclonal Antibody

ABP57565-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
  • Applications tips:
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)

HSC70 Rabbit Polyclonal Antibody

ABP57565-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
  • Applications tips:
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)

HSP40 Rabbit Polyclonal Antibody

ABP57566-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of HSP40
  • Applications tips:
Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40

HSP40 Rabbit Polyclonal Antibody

ABP57566-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of HSP40
  • Applications tips:
Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40

HSP40 Rabbit Polyclonal Antibody

ABP57566-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of HSP40
  • Applications tips:
Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40

HSP90Alpha Rabbit Polyclonal Antibody

ABP57567-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of HSP90?
  • Applications tips:
Description: A polyclonal antibody for detection of HSP90Alpha from Human, Mouse, Rat. This HSP90Alpha antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP90?

HSP90Alpha Rabbit Polyclonal Antibody

ABP57567-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of HSP90?
  • Applications tips:
Description: A polyclonal antibody for detection of HSP90Alpha from Human, Mouse, Rat. This HSP90Alpha antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP90?

HSP90Alpha Rabbit Polyclonal Antibody

ABP57567-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of HSP90?
  • Applications tips:
Description: A polyclonal antibody for detection of HSP90Alpha from Human, Mouse, Rat. This HSP90Alpha antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP90?

JAK1 Rabbit Polyclonal Antibody

ABP57569-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of JAK1
  • Applications tips:
Description: A polyclonal antibody for detection of JAK1 from Human, Mouse, Rat. This JAK1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK1

JAK1 Rabbit Polyclonal Antibody

ABP57569-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of JAK1
  • Applications tips:
Description: A polyclonal antibody for detection of JAK1 from Human, Mouse, Rat. This JAK1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK1

JAK1 Rabbit Polyclonal Antibody

ABP57569-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of JAK1
  • Applications tips:
Description: A polyclonal antibody for detection of JAK1 from Human, Mouse, Rat. This JAK1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK1

JAK2 Rabbit Polyclonal Antibody

ABP57570-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of JAK2
  • Applications tips:
Description: A polyclonal antibody for detection of JAK2 from Human, Mouse, Rat. This JAK2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK2

JAK2 Rabbit Polyclonal Antibody

ABP57570-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of JAK2
  • Applications tips:
Description: A polyclonal antibody for detection of JAK2 from Human, Mouse, Rat. This JAK2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK2

JAK2 Rabbit Polyclonal Antibody

ABP57570-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of JAK2
  • Applications tips:
Description: A polyclonal antibody for detection of JAK2 from Human, Mouse, Rat. This JAK2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK2

JNK2 Rabbit Polyclonal Antibody

ABP57571-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of JNK2
  • Applications tips:
Description: A polyclonal antibody for detection of JNK2 from Human, Mouse, Rat. This JNK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK2

JNK2 Rabbit Polyclonal Antibody

ABP57571-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of JNK2
  • Applications tips:
Description: A polyclonal antibody for detection of JNK2 from Human, Mouse, Rat. This JNK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK2

JNK2 Rabbit Polyclonal Antibody

ABP57571-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of JNK2
  • Applications tips:
Description: A polyclonal antibody for detection of JNK2 from Human, Mouse, Rat. This JNK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK2

JNK3 Rabbit Polyclonal Antibody

ABP57572-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of JNK3
  • Applications tips:
Description: A polyclonal antibody for detection of JNK3 from Human, Mouse, Rat. This JNK3 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK3

JNK3 Rabbit Polyclonal Antibody

ABP57572-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of JNK3
  • Applications tips:
Description: A polyclonal antibody for detection of JNK3 from Human, Mouse, Rat. This JNK3 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK3

JNK3 Rabbit Polyclonal Antibody

ABP57572-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of JNK3
  • Applications tips:
Description: A polyclonal antibody for detection of JNK3 from Human, Mouse, Rat. This JNK3 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK3

MEK2 Rabbit Polyclonal Antibody

ABP57573-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of MEK2
  • Applications tips:
Description: A polyclonal antibody for detection of MEK2 from Human. This MEK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of MEK2

MEK2 Rabbit Polyclonal Antibody

ABP57573-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of MEK2
  • Applications tips:
Description: A polyclonal antibody for detection of MEK2 from Human. This MEK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of MEK2

MEK2 Rabbit Polyclonal Antibody

ABP57573-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of MEK2
  • Applications tips:
Description: A polyclonal antibody for detection of MEK2 from Human. This MEK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of MEK2

MEK3 Rabbit Polyclonal Antibody

ABP57574-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of MEK3
  • Applications tips:
Description: A polyclonal antibody for detection of MEK3 from Human, Mouse, Rat. This MEK3 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of MEK3

MEK3 Rabbit Polyclonal Antibody

ABP57574-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of MEK3
  • Applications tips:
Description: A polyclonal antibody for detection of MEK3 from Human, Mouse, Rat. This MEK3 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of MEK3

MEK3 Rabbit Polyclonal Antibody

ABP57574-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of MEK3
  • Applications tips:
Description: A polyclonal antibody for detection of MEK3 from Human, Mouse, Rat. This MEK3 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of MEK3

Nrf2 Rabbit Polyclonal Antibody

ABP57575-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of Nrf2
  • Applications tips:
Description: A polyclonal antibody for detection of Nrf2 from Human, Mouse, Rat. This Nrf2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Nrf2

Nrf2 Rabbit Polyclonal Antibody

ABP57575-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of Nrf2
  • Applications tips:
Description: A polyclonal antibody for detection of Nrf2 from Human, Mouse, Rat. This Nrf2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Nrf2

Nrf2 Rabbit Polyclonal Antibody

ABP57575-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of Nrf2
  • Applications tips:
Description: A polyclonal antibody for detection of Nrf2 from Human, Mouse, Rat. This Nrf2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Nrf2

PDK3 Rabbit Polyclonal Antibody