PECR Polyclonal Antibody |
ABP59875-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from part region of human PECR protein at amino acid sequence of 40-120
- Applications tips:
|
Description: A polyclonal antibody for detection of PECR from Human, Mouse, Rat. This PECR antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PECR protein at amino acid sequence of 40-120 |
PECR Polyclonal Antibody |
ABP59875-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human PECR protein at amino acid sequence of 40-120
- Applications tips:
|
Description: A polyclonal antibody for detection of PECR from Human, Mouse, Rat. This PECR antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PECR protein at amino acid sequence of 40-120 |
PECR Polyclonal Antibody |
A60226 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: kits suitable for this type of research |
PECR Polyclonal Antibody |
30855-100ul |
SAB |
100ul |
EUR 252 |
PECR Polyclonal Antibody |
30855-50ul |
SAB |
50ul |
EUR 187 |
PECR Rabbit pAb |
A7206-100ul |
Abclonal |
100 ul |
EUR 308 |
PECR Rabbit pAb |
A7206-200ul |
Abclonal |
200 ul |
EUR 459 |
PECR Rabbit pAb |
A7206-20ul |
Abclonal |
20 ul |
EUR 183 |
PECR Rabbit pAb |
A7206-50ul |
Abclonal |
50 ul |
EUR 223 |
PECR Polyclonal Conjugated Antibody |
C30855 |
SAB |
100ul |
EUR 397 |
PECR antibody |
22145-100ul |
SAB |
100ul |
EUR 390 |
PECR antibody |
10R-5232 |
Fitzgerald |
100 ul |
EUR 726 |
Description: Mouse monoclonal PECR antibody |
PECR antibody |
10R-5233 |
Fitzgerald |
100 ul |
EUR 691 |
Description: Mouse monoclonal PECR antibody |
PECR antibody |
10R-5235 |
Fitzgerald |
100 ul |
EUR 691 |
Description: Mouse monoclonal PECR antibody |
PECR antibody |
70R-19207 |
Fitzgerald |
50 ul |
EUR 435 |
Description: Rabbit polyclonal PECR antibody |
PECR antibody |
70R-13465 |
Fitzgerald |
100 ul |
EUR 457 |
Description: Affinity purified Rabbit polyclonal PECR antibody |
PECR Antibody |
1-CSB-PA017769ESR1HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
|
Description: A polyclonal antibody against PECR. Recognizes PECR from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200 |
PECR Antibody |
1-CSB-PA017769ESR2HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
|
Description: A polyclonal antibody against PECR. Recognizes PECR from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200 |
PECR Antibody |
1-CSB-PA017769GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
|
Description: A polyclonal antibody against PECR. Recognizes PECR from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC |
PECR Antibody |
1-CSB-PA017769LA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against PECR. Recognizes PECR from Human. This antibody is Unconjugated. Tested in the following application: ELISA |
PECR Polyclonal Antibody, Biotin Conjugated |
A60227 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: fast delivery possible |
PECR Polyclonal Antibody, FITC Conjugated |
A60228 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: reagents widely cited |
PECR Polyclonal Antibody, HRP Conjugated |
A60229 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: Ask the seller for details |
Polyclonal PECR antibody - C-terminal region |
APR09035G |
Leading Biology |
0.05mg |
EUR 528 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human PECR - C-terminal region. This antibody is tested and proven to work in the following applications: |
anti- PECR antibody |
FNab06300 |
FN Test |
100µg |
EUR 548.75 |
- Immunogen: peroxisomal trans-2-enoyl-CoA reductase
- Uniprot ID: Q9BY49
- Gene ID: 55825
- Research Area: Metabolism
|
Description: Antibody raised against PECR |
Human PECR Antibody |
33241-05111 |
AssayPro |
150 ug |
EUR 261 |
Anti-PECR antibody |
STJ191141 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to PECR |
PECR siRNA |
20-abx903934 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
PECR siRNA |
20-abx928223 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
PECR siRNA |
20-abx928224 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
PECR Antibody, HRP conjugated |
1-CSB-PA017769LB01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against PECR. Recognizes PECR from Human. This antibody is HRP conjugated. Tested in the following application: ELISA |
PECR Antibody, FITC conjugated |
1-CSB-PA017769LC01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against PECR. Recognizes PECR from Human. This antibody is FITC conjugated. Tested in the following application: ELISA |
PECR Antibody, Biotin conjugated |
1-CSB-PA017769LD01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against PECR. Recognizes PECR from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA |
PECR cloning plasmid |
CSB-CL017769HU-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 912
- Sequence: atggcctcctgggctaagggcaggagctacctggcgcctggtttgctgcagggccaagtggccatcgtcaccggcggggccacgggcatcggaaaagccatcgtgaaggagctcctggagctggggagtaatgtggtcattgcatcccgtaagttggagagattgaagtctgcggc
- Show more
|
Description: A cloning plasmid for the PECR gene. |
Anti-PECR (2F10) |
YF-MA18843 |
Abfrontier |
200 ul |
EUR 363 |
Description: Mouse monoclonal to PECR |
Human PECR Antibody (Biotin Conjugate) |
33241-05121 |
AssayPro |
150 ug |
EUR 369 |
Mouse PECR shRNA Plasmid |
20-abx980128 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Rat PECR shRNA Plasmid |
20-abx987129 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
PECR protein (His tag) |
80R-1994 |
Fitzgerald |
100 ug |
EUR 322 |
Description: Recombinant human PECR protein (His tag) |
Human PECR shRNA Plasmid |
20-abx960951 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
PECR Recombinant Protein (Human) |
RP023053 |
ABM |
100 ug |
Ask for price |
PECR Recombinant Protein (Rat) |
RP220010 |
ABM |
100 ug |
Ask for price |
PECR Recombinant Protein (Mouse) |
RP161288 |
ABM |
100 ug |
Ask for price |
Human PECR AssayLite Antibody (FITC Conjugate) |
33241-05141 |
AssayPro |
150 ug |
EUR 428 |
Human PECR AssayLite Antibody (RPE Conjugate) |
33241-05151 |
AssayPro |
150 ug |
EUR 428 |
Human PECR AssayLite Antibody (APC Conjugate) |
33241-05161 |
AssayPro |
150 ug |
EUR 428 |
Human PECR AssayLite Antibody (PerCP Conjugate) |
33241-05171 |
AssayPro |
150 ug |
EUR 471 |
PECR ORF Vector (Human) (pORF) |
ORF007685 |
ABM |
1.0 ug DNA |
EUR 95 |
Pecr ORF Vector (Rat) (pORF) |
ORF073338 |
ABM |
1.0 ug DNA |
EUR 506 |
Pecr ORF Vector (Mouse) (pORF) |
ORF053764 |
ABM |
1.0 ug DNA |
EUR 506 |
Peroxisomal Trans-2-Enoyl-CoA Reductase (PECR) Antibody |
20-abx006438 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
Peroxisomal Trans-2-Enoyl-CoA Reductase (PECR) Antibody |
20-abx320845 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Peroxisomal Trans-2-Enoyl-CoA Reductase (PECR) Antibody |
20-abx321842 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Peroxisomal Trans-2-Enoyl-CoA Reductase (PECR) Antibody |
abx236300-100ug |
Abbexa |
100 ug |
EUR 509 |
- Shipped within 5-12 working days.
|
Peroxisomal Trans-2-Enoyl-CoA Reductase (PECR) Antibody |
20-abx304789 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
PECR sgRNA CRISPR Lentivector set (Human) |
K1626201 |
ABM |
3 x 1.0 ug |
EUR 339 |
Pecr sgRNA CRISPR Lentivector set (Mouse) |
K4951401 |
ABM |
3 x 1.0 ug |
EUR 339 |
Pecr sgRNA CRISPR Lentivector set (Rat) |
K7028401 |
ABM |
3 x 1.0 ug |
EUR 339 |
Peroxisomal Trans-2-Enoyl-CoA Reductase (PECR) Antibody (HRP) |
20-abx304790 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Peroxisomal Trans-2-Enoyl-CoA Reductase (PECR) Antibody (FITC) |
20-abx304791 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Peroxisomal Trans-2-Enoyl-CoA Reductase (PECR) Antibody (Biotin) |
20-abx304792 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
PECR sgRNA CRISPR Lentivector (Human) (Target 1) |
K1626202 |
ABM |
1.0 ug DNA |
EUR 154 |
PECR sgRNA CRISPR Lentivector (Human) (Target 2) |
K1626203 |
ABM |
1.0 ug DNA |
EUR 154 |
PECR sgRNA CRISPR Lentivector (Human) (Target 3) |
K1626204 |
ABM |
1.0 ug DNA |
EUR 154 |
Pecr sgRNA CRISPR Lentivector (Mouse) (Target 1) |
K4951402 |
ABM |
1.0 ug DNA |
EUR 154 |
Pecr sgRNA CRISPR Lentivector (Mouse) (Target 2) |
K4951403 |
ABM |
1.0 ug DNA |
EUR 154 |
Pecr sgRNA CRISPR Lentivector (Mouse) (Target 3) |
K4951404 |
ABM |
1.0 ug DNA |
EUR 154 |
Pecr sgRNA CRISPR Lentivector (Rat) (Target 1) |
K7028402 |
ABM |
1.0 ug DNA |
EUR 154 |
Pecr sgRNA CRISPR Lentivector (Rat) (Target 2) |
K7028403 |
ABM |
1.0 ug DNA |
EUR 154 |
Pecr sgRNA CRISPR Lentivector (Rat) (Target 3) |
K7028404 |
ABM |
1.0 ug DNA |
EUR 154 |
Recombinant Human PECR Protein, His, E.coli-1mg |
QP13004-1mg |
EnQuireBio |
1mg |
EUR 2757 |
Recombinant Human PECR Protein, His, E.coli-20ug |
QP13004-20ug |
EnQuireBio |
20ug |
EUR 201 |
Recombinant Human PECR Protein, His, E.coli-5ug |
QP13004-5ug |
EnQuireBio |
5ug |
EUR 155 |
PECR Protein Vector (Human) (pPB-C-His) |
PV030737 |
ABM |
500 ng |
EUR 329 |
PECR Protein Vector (Human) (pPB-N-His) |
PV030738 |
ABM |
500 ng |
EUR 329 |
PECR Protein Vector (Human) (pPM-C-HA) |
PV030739 |
ABM |
500 ng |
EUR 329 |
PECR Protein Vector (Human) (pPM-C-His) |
PV030740 |
ABM |
500 ng |
EUR 329 |
PECR Protein Vector (Mouse) (pPB-C-His) |
PV215054 |
ABM |
500 ng |
EUR 603 |
PECR Protein Vector (Mouse) (pPB-N-His) |
PV215055 |
ABM |
500 ng |
EUR 603 |
PECR Protein Vector (Mouse) (pPM-C-HA) |
PV215056 |
ABM |
500 ng |
EUR 603 |
PECR Protein Vector (Mouse) (pPM-C-His) |
PV215057 |
ABM |
500 ng |
EUR 603 |
PECR Protein Vector (Rat) (pPB-C-His) |
PV293350 |
ABM |
500 ng |
EUR 603 |
PECR Protein Vector (Rat) (pPB-N-His) |
PV293351 |
ABM |
500 ng |
EUR 603 |
PECR Protein Vector (Rat) (pPM-C-HA) |
PV293352 |
ABM |
500 ng |
EUR 603 |
PECR Protein Vector (Rat) (pPM-C-His) |
PV293353 |
ABM |
500 ng |
EUR 603 |
Pecr 3'UTR GFP Stable Cell Line |
TU166181 |
ABM |
1.0 ml |
Ask for price |
PECR 3'UTR Luciferase Stable Cell Line |
TU017719 |
ABM |
1.0 ml |
EUR 1394 |
Pecr 3'UTR Luciferase Stable Cell Line |
TU116181 |
ABM |
1.0 ml |
Ask for price |
PECR 3'UTR GFP Stable Cell Line |
TU067719 |
ABM |
1.0 ml |
EUR 1394 |
Pecr 3'UTR GFP Stable Cell Line |
TU266068 |
ABM |
1.0 ml |
Ask for price |
Pecr 3'UTR Luciferase Stable Cell Line |
TU216068 |
ABM |
1.0 ml |
Ask for price |
PECR Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV) |
LV666409 |
ABM |
1.0 ug DNA |
EUR 514 |
PECR Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC) |
LV666413 |
ABM |
1.0 ug DNA |
EUR 514 |
PECR Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a) |
LV666414 |
ABM |
1.0 ug DNA |
EUR 514 |
VEGF Rabbit Polyclonal Antibody |
ES8453-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
VEGF Rabbit Polyclonal Antibody |
ES8453-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
CD10 Rabbit Polyclonal Antibody |
ES8454-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
CD10 Rabbit Polyclonal Antibody |
ES8454-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NM23A Rabbit Polyclonal Antibody |
ES8455-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NM23A Rabbit Polyclonal Antibody |
ES8455-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8456-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8456-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8457-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8457-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
HSC70 Rabbit Polyclonal Antibody |
ES8558-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSC70 Rabbit Polyclonal Antibody |
ES8558-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSP40 Rabbit Polyclonal Antibody |
ES8559-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
PECR Rabbit Polyclonal Antibody