PECR Rabbit Polyclonal Antibody

PECR Polyclonal Antibody
ABP59875-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Synthesized peptide derived from part region of human PECR protein at amino acid sequence of 40-120 Applications tips:
Description: A polyclonal antibody for detection of PECR from Human, Mouse, Rat. This PECR antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PECR protein at amino acid sequence of 40-120

PECR Polyclonal Antibody
ABP59875-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Synthesized peptide derived from part region of human PECR protein at amino acid sequence of 40-120 Applications tips:
Description: A polyclonal antibody for detection of PECR from Human, Mouse, Rat. This PECR antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PECR protein at amino acid sequence of 40-120

PECR Polyclonal Antibody
ABP59875-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Synthesized peptide derived from part region of human PECR protein at amino acid sequence of 40-120 Applications tips:
Description: A polyclonal antibody for detection of PECR from Human, Mouse, Rat. This PECR antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PECR protein at amino acid sequence of 40-120

PECR Polyclonal Antibody
ES9983-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against PECR from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

PECR Polyclonal Antibody
ES9983-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against PECR from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

PECR Rabbit pAb
A7206-100ul	Abclonal	100 ul	EUR 308

PECR Rabbit pAb
A7206-200ul	Abclonal	200 ul	EUR 459

PECR Rabbit pAb
A7206-20ul	Abclonal	20 ul	EUR 183

PECR Rabbit pAb
A7206-50ul	Abclonal	50 ul	EUR 223

PECR Polyclonal Conjugated Antibody
C30855	SAB	100ul	EUR 397

PECR antibody
22145-100ul	SAB	100ul	EUR 390

PECR antibody
70R-19207	Fitzgerald	50 ul	EUR 435
Description: Rabbit polyclonal PECR antibody

PECR antibody
70R-13465	Fitzgerald	100 ul	EUR 457
Description: Affinity purified Rabbit polyclonal PECR antibody

PECR antibody
10R-5232	Fitzgerald	100 ul	EUR 726
Description: Mouse monoclonal PECR antibody

PECR antibody
10R-5233	Fitzgerald	100 ul	EUR 691
Description: Mouse monoclonal PECR antibody

PECR antibody
10R-5235	Fitzgerald	100 ul	EUR 691
Description: Mouse monoclonal PECR antibody

PECR Antibody
1-CSB-PA017769ESR1HU	Cusabio	EUR 222.00 EUR 335.00	100ul 50ul
Form: Liquid Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against PECR. Recognizes PECR from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200

PECR Antibody
1-CSB-PA017769ESR2HU	Cusabio	EUR 222.00 EUR 335.00	100ul 50ul
Form: Liquid Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against PECR. Recognizes PECR from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

PECR Antibody
1-CSB-PA017769GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against PECR. Recognizes PECR from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

PECR Antibody
1-CSB-PA017769LA01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PECR. Recognizes PECR from Human. This antibody is Unconjugated. Tested in the following application: ELISA

PECR Polyclonal Antibody, Biotin Conjugated
A60227	EpiGentek	100 µg	EUR 570.55
Description: fast delivery possible

PECR Polyclonal Antibody, FITC Conjugated
A60228	EpiGentek	100 µg	EUR 570.55
Description: reagents widely cited

PECR Polyclonal Antibody, HRP Conjugated
A60229	EpiGentek	100 µg	EUR 570.55
Description: Ask the seller for details

Polyclonal PECR antibody - C-terminal region
APR09035G	Leading Biology	0.05mg	EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human PECR - C-terminal region. This antibody is tested and proven to work in the following applications:

Pecr/ Rat Pecr ELISA Kit
ELI-37732r	Lifescience Market	96 Tests	EUR 886

Human PECR Antibody
33241-05111	AssayPro	150 ug	EUR 261

anti- PECR antibody
FNab06300	FN Test	100µg	EUR 548.75
Immunogen: peroxisomal trans-2-enoyl-CoA reductase Uniprot ID: Q9BY49 Gene ID: 55825 Research Area: Metabolism
Description: Antibody raised against PECR

Anti-PECR antibody
PAab06300	Lifescience Market	100 ug	EUR 386

Anti-PECR antibody
STJ29286	St John's Laboratory	100 µl	EUR 277

Anti-PECR antibody
STJ191141	St John's Laboratory	200 µl	EUR 197
Description: Unconjugated Rabbit polyclonal to PECR

PECR siRNA
20-abx903934	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

PECR siRNA
20-abx928223	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

PECR siRNA
20-abx928224	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

pOTB7-PECR
PVT18639	Lifescience Market	2 ug	EUR 231

PECR Antibody, HRP conjugated
1-CSB-PA017769LB01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PECR. Recognizes PECR from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

PECR Antibody, FITC conjugated
1-CSB-PA017769LC01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PECR. Recognizes PECR from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

PECR Antibody, Biotin conjugated
1-CSB-PA017769LD01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PECR. Recognizes PECR from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

PECR cloning plasmid
CSB-CL017769HU-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 912 Sequence: atggcctcctgggctaagggcaggagctacctggcgcctggtttgctgcagggccaagtggccatcgtcaccggcggggccacgggcatcggaaaagccatcgtgaaggagctcctggagctggggagtaatgtggtcattgcatcccgtaagttggagagattgaagtctgcggc Show more
Description: A cloning plasmid for the PECR gene.

Anti-PECR (2F10)
YF-MA18843	Abfrontier	200 ul	EUR 363
Description: Mouse monoclonal to PECR

Human PECR Antibody (Biotin Conjugate)
33241-05121	AssayPro	150 ug	EUR 369

PECR protein (His tag)
80R-1994	Fitzgerald	100 ug	EUR 322
Description: Recombinant human PECR protein (His tag)

PECR ELISA KIT|Human
EF001670	Lifescience Market	96 Tests	EUR 689

Rat PECR shRNA Plasmid
20-abx987129	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Human PECR shRNA Plasmid
20-abx960951	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Mouse PECR shRNA Plasmid
20-abx980128	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

PECR Recombinant Protein (Human)
RP023053	ABM	100 ug	Ask for price

PECR Recombinant Protein (Mouse)
RP161288	ABM	100 ug	Ask for price

PECR Recombinant Protein (Rat)
RP220010	ABM	100 ug	Ask for price

Human PECR AssayLite Antibody (FITC Conjugate)
33241-05141	AssayPro	150 ug	EUR 428

Human PECR AssayLite Antibody (RPE Conjugate)
33241-05151	AssayPro	150 ug	EUR 428

Human PECR AssayLite Antibody (APC Conjugate)
33241-05161	AssayPro	150 ug	EUR 428

Human PECR AssayLite Antibody (PerCP Conjugate)
33241-05171	AssayPro	150 ug	EUR 471

Pecr ORF Vector (Rat) (pORF)
ORF073338	ABM	1.0 ug DNA	EUR 506

PECR ORF Vector (Human) (pORF)
ORF007685	ABM	1.0 ug DNA	EUR 95

Pecr ORF Vector (Mouse) (pORF)
ORF053764	ABM	1.0 ug DNA	EUR 506

Peroxisomal Trans-2-Enoyl-CoA Reductase (PECR) Antibody
20-abx006438	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

Peroxisomal Trans-2-Enoyl-CoA Reductase (PECR) Antibody
20-abx320845	Abbexa	EUR 439.00 EUR 328.00	100 ul 50 ul
Shipped within 5-10 working days.

Peroxisomal Trans-2-Enoyl-CoA Reductase (PECR) Antibody
abx236300-100ug	Abbexa	100 ug	EUR 509
Shipped within 5-12 working days.

Peroxisomal Trans-2-Enoyl-CoA Reductase (PECR) Antibody
20-abx321842	Abbexa	EUR 439.00 EUR 328.00	100 ul 50 ul
Shipped within 5-10 working days.

Peroxisomal Trans-2-Enoyl-CoA Reductase (PECR) Antibody
20-abx304789	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Pecr sgRNA CRISPR Lentivector set (Mouse)
K4951401	ABM	3 x 1.0 ug	EUR 339

Pecr sgRNA CRISPR Lentivector set (Rat)
K7028401	ABM	3 x 1.0 ug	EUR 339

PECR sgRNA CRISPR Lentivector set (Human)
K1626201	ABM	3 x 1.0 ug	EUR 339

Peroxisomal Trans-2-Enoyl-CoA Reductase (PECR) Antibody (HRP)
20-abx304790	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Peroxisomal Trans-2-Enoyl-CoA Reductase (PECR) Antibody (FITC)
20-abx304791	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Peroxisomal Trans-2-Enoyl-CoA Reductase (PECR) Antibody (Biotin)
20-abx304792	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Pecr sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4951402	ABM	1.0 ug DNA	EUR 154

Pecr sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4951403	ABM	1.0 ug DNA	EUR 154

Pecr sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4951404	ABM	1.0 ug DNA	EUR 154

Pecr sgRNA CRISPR Lentivector (Rat) (Target 1)
K7028402	ABM	1.0 ug DNA	EUR 154

Pecr sgRNA CRISPR Lentivector (Rat) (Target 2)
K7028403	ABM	1.0 ug DNA	EUR 154

Pecr sgRNA CRISPR Lentivector (Rat) (Target 3)
K7028404	ABM	1.0 ug DNA	EUR 154

PECR sgRNA CRISPR Lentivector (Human) (Target 1)
K1626202	ABM	1.0 ug DNA	EUR 154

PECR sgRNA CRISPR Lentivector (Human) (Target 2)
K1626203	ABM	1.0 ug DNA	EUR 154

PECR sgRNA CRISPR Lentivector (Human) (Target 3)
K1626204	ABM	1.0 ug DNA	EUR 154

PECR Protein Vector (Rat) (pPB-C-His)
PV293350	ABM	500 ng	EUR 603

PECR Protein Vector (Rat) (pPB-N-His)
PV293351	ABM	500 ng	EUR 603

PECR Protein Vector (Rat) (pPM-C-HA)
PV293352	ABM	500 ng	EUR 603

PECR Protein Vector (Rat) (pPM-C-His)
PV293353	ABM	500 ng	EUR 603

PECR Protein Vector (Mouse) (pPB-C-His)
PV215054	ABM	500 ng	EUR 603

PECR Protein Vector (Mouse) (pPB-N-His)
PV215055	ABM	500 ng	EUR 603

PECR Protein Vector (Mouse) (pPM-C-HA)
PV215056	ABM	500 ng	EUR 603

PECR Protein Vector (Mouse) (pPM-C-His)
PV215057	ABM	500 ng	EUR 603

PECR Protein Vector (Human) (pPB-C-His)
PV030737	ABM	500 ng	EUR 329

PECR Protein Vector (Human) (pPB-N-His)
PV030738	ABM	500 ng	EUR 329

PECR Protein Vector (Human) (pPM-C-HA)
PV030739	ABM	500 ng	EUR 329

PECR Protein Vector (Human) (pPM-C-His)
PV030740	ABM	500 ng	EUR 329

Recombinant Human PECR Protein, His, E.coli-1mg
QP13004-1mg	EnQuireBio	1mg	EUR 2757

Recombinant Human PECR Protein, His, E.coli-20ug
QP13004-20ug	EnQuireBio	20ug	EUR 201

Recombinant Human PECR Protein, His, E.coli-5ug
QP13004-5ug	EnQuireBio	5ug	EUR 155

Pecr 3'UTR Luciferase Stable Cell Line
TU116181	ABM	1.0 ml	Ask for price

Pecr 3'UTR GFP Stable Cell Line
TU166181	ABM	1.0 ml	Ask for price

Pecr 3'UTR Luciferase Stable Cell Line
TU216068	ABM	1.0 ml	Ask for price

Pecr 3'UTR GFP Stable Cell Line
TU266068	ABM	1.0 ml	Ask for price

PECR 3'UTR GFP Stable Cell Line
TU067719	ABM	1.0 ml	EUR 1394

PECR 3'UTR Luciferase Stable Cell Line
TU017719	ABM	1.0 ml	EUR 1394

PECR Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)
LV666409	ABM	1.0 ug DNA	EUR 514

PECR Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)
LV666413	ABM	1.0 ug DNA	EUR 514

PECR Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)
LV666414	ABM	1.0 ug DNA	EUR 514

GAPDH Rabbit Polyclonal Antibody
37985-100ul	SAB	100ul	EUR 252

GAPDH Rabbit Polyclonal Antibody
37985-50ul	SAB	50ul	EUR 187

EFHD1 Rabbit Polyclonal Antibody
38001-100ul	SAB	100ul	EUR 252

EFHD1 Rabbit Polyclonal Antibody
38001-50ul	SAB	50ul	EUR 187

Alliinase Rabbit Polyclonal Antibody
38042-100ul	SAB	100ul	EUR 252

Alliinase Rabbit Polyclonal Antibody
38042-50ul	SAB	50ul	EUR 187

ECFP Rabbit Polyclonal Antibody
38077-100ul	SAB	100ul	EUR 252

ECFP Rabbit Polyclonal Antibody
38077-50ul	SAB	50ul	EUR 187

EYFP Rabbit Polyclonal Antibody
38078-100ul	SAB	100ul	EUR 252

EYFP Rabbit Polyclonal Antibody
38078-50ul	SAB	50ul	EUR 187

mOrange Rabbit Polyclonal Antibody
38079-100ul	SAB	100ul	EUR 252

mOrange Rabbit Polyclonal Antibody
38079-50ul	SAB	50ul	EUR 187

mStrawberry Rabbit Polyclonal Antibody
38083-100ul	SAB	100ul	EUR 252

PECR Rabbit Polyclonal Antibody