 PIGA Rabbit pAb |
|
A6236-100ul |
Abclonal |
100 ul |
EUR 308 |
PIGA Rabbit pAb |
|
A6236-200ul |
Abclonal |
200 ul |
EUR 459 |
PIGA Rabbit pAb |
|
A6236-20ul |
Abclonal |
20 ul |
EUR 183 |
PIGA Rabbit pAb |
|
A6236-50ul |
Abclonal |
50 ul |
EUR 223 |
 PIGA antibody |
|
70R-6607 |
Fitzgerald |
50 ug |
EUR 467 |
|
Description: Rabbit polyclonal PIGA antibody raised against the middle region of PIGA |
PIGA antibody |
|
70R-8625 |
Fitzgerald |
50 ug |
EUR 467 |
|
Description: Affinity purified rabbit polyclonal PIGA antibody |
 PIGA Antibody |
|
46125-100ul |
SAB |
100ul |
EUR 252 |
PIGA Antibody |
|
46125-50ul |
SAB |
50ul |
EUR 187 |
PIGA antibody |
|
70R-19281 |
Fitzgerald |
50 ul |
EUR 435 |
|
Description: Rabbit polyclonal PIGA antibody |
PIGA Antibody |
|
DF9742 |
Affbiotech |
200ul |
EUR 304 |
|
Description: PIGA Antibody detects endogenous levels of total PIGA. |
PIGA Antibody |
|
1-CSB-PA017965GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
|
|
Description: A polyclonal antibody against PIGA. Recognizes PIGA from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB |
PIGA Antibody |
|
1-CSB-PA017965LA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
|
|
Description: A polyclonal antibody against PIGA. Recognizes PIGA from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:20-1:200, IF:1:50-1:200 |
) Polyclonal PIGA Antibody (C-term) |
|
APR03682G |
Leading Biology |
0.1ml |
EUR 484 |
|
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human PIGA (C-term). This antibody is tested and proven to work in the following applications: |
 PIGA Conjugated Antibody |
|
C46125 |
SAB |
100ul |
EUR 397 |
 anti- PIGA antibody |
|
FNab06438 |
FN Test |
100µg |
EUR 548.75 |
- Immunogen: phosphatidylinositol glycan anchor biosynthesis, class A
- Uniprot ID: P37287
- Gene ID: 5277
- Research Area: Cardiovascular, Metabolism
|
|
Description: Antibody raised against PIGA |
 Anti-PIGA antibody |
|
STJ27992 |
St John's Laboratory |
100 µl |
EUR 277 |
|
Description: This gene encodes a protein required for synthesis of N-acetylglucosaminyl phosphatidylinositol (GlcNAc-PI), the first intermediate in the biosynthetic pathway of GPI anchor. The GPI anchor is a glycolipid found on many blood cells and which serves to anchor proteins to the cell surface. Paroxysmal nocturnal hemoglobinuria, an acquired hematologic disorder, has been shown to result from mutations in this gene. Alternate splice variants have been characterized. A related pseudogene is located on chromosome 12. |
Anti-PIGA antibody |
|
STJ191147 |
St John's Laboratory |
200 µl |
EUR 197 |
|
Description: Unconjugated Rabbit polyclonal to PIGA |
 PIGA siRNA |
|
20-abx928557 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
PIGA siRNA |
|
20-abx928558 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
 PIGA Antibody, HRP conjugated |
|
1-CSB-PA017965LB01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
|
|
Description: A polyclonal antibody against PIGA. Recognizes PIGA from Human. This antibody is HRP conjugated. Tested in the following application: ELISA |
 PIGA Antibody, FITC conjugated |
|
1-CSB-PA017965LC01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
|
|
Description: A polyclonal antibody against PIGA. Recognizes PIGA from Human. This antibody is FITC conjugated. Tested in the following application: ELISA |
 PIGA Antibody, Biotin conjugated |
|
1-CSB-PA017965LD01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
|
|
Description: A polyclonal antibody against PIGA. Recognizes PIGA from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA |
 PIGA cloning plasmid |
|
CSB-CL017965HU-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1455
- Sequence: atggcctgtagaggaggagctgggaatggccaccgtgcctcagctacactctctcgggttagccctggaagtctttacacatgtagaacccgtacccataatatatgcatggtatctgactttttctacccaaatatgggaggcgtggaaagccacatttaccagctctctcagt
- Show more
|
|
Description: A cloning plasmid for the PIGA gene. |
 PIGA Blocking Peptide |
|
33R-8916 |
Fitzgerald |
100 ug |
EUR 180 |
|
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of PIGA antibody, catalog no. 70R-6607 |
PIGA Blocking Peptide |
|
DF9742-BP |
Affbiotech |
1mg |
EUR 195 |
 Human PIGA shRNA Plasmid |
|
20-abx953526 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
 Mouse PIGA shRNA Plasmid |
|
20-abx972029 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
) PIGA Recombinant Protein (Human) |
|
RP023434 |
ABM |
100 ug |
Ask for price |
) PIGA Recombinant Protein (Rat) |
|
RP220463 |
ABM |
100 ug |
Ask for price |
) PIGA Recombinant Protein (Mouse) |
|
RP162014 |
ABM |
100 ug |
Ask for price |
 (pORF)) PIGA ORF Vector (Human) (pORF) |
|
ORF007812 |
ABM |
1.0 ug DNA |
EUR 95 |
 (pORF)) Piga ORF Vector (Rat) (pORF) |
|
ORF073489 |
ABM |
1.0 ug DNA |
EUR 506 |
 (pORF)) Piga ORF Vector (Mouse) (pORF) |
|
ORF054006 |
ABM |
1.0 ug DNA |
EUR 506 |
 Antibody) Phosphatidylinositol Glycan Anchor Biosynthesis Class A (Piga) Antibody |
|
20-abx114440 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
 Antibody) Phosphatidylinositol Glycan Anchor Biosynthesis Class A (PIGA) Antibody |
|
20-abx006618 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
Phosphatidylinositol Glycan Anchor Biosynthesis Class A (PIGA) Antibody |
|
abx026766-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
Phosphatidylinositol Glycan Anchor Biosynthesis Class A (PIGA) Antibody |
|
abx026766-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
Phosphatidylinositol Glycan Anchor Biosynthesis Class A (PIGA) Antibody |
|
20-abx217763 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Phosphatidylinositol Glycan Anchor Biosynthesis Class A (PIGA) Antibody |
|
20-abx333889 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Phosphatidylinositol Glycan Anchor Biosynthesis Class A (PIGA) Antibody |
|
abx236438-100ug |
Abbexa |
100 ug |
EUR 509 |
- Shipped within 5-12 working days.
|
) PIGA sgRNA CRISPR Lentivector set (Human) |
|
K1646601 |
ABM |
3 x 1.0 ug |
EUR 339 |
) Piga sgRNA CRISPR Lentivector set (Mouse) |
|
K4985401 |
ABM |
3 x 1.0 ug |
EUR 339 |
) Piga sgRNA CRISPR Lentivector set (Rat) |
|
K6656901 |
ABM |
3 x 1.0 ug |
EUR 339 |
 Antibody (HRP)) Phosphatidylinositol Glycan Anchor Biosynthesis Class A (PIGA) Antibody (HRP) |
|
20-abx337009 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
 Antibody (FITC)) Phosphatidylinositol Glycan Anchor Biosynthesis Class A (PIGA) Antibody (FITC) |
|
20-abx337010 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
 Antibody (Biotin)) Phosphatidylinositol Glycan Anchor Biosynthesis Class A (PIGA) Antibody (Biotin) |
|
20-abx337011 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
 (Target 1)) PIGA sgRNA CRISPR Lentivector (Human) (Target 1) |
|
K1646602 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 2)) PIGA sgRNA CRISPR Lentivector (Human) (Target 2) |
|
K1646603 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 3)) PIGA sgRNA CRISPR Lentivector (Human) (Target 3) |
|
K1646604 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 1)) Piga sgRNA CRISPR Lentivector (Mouse) (Target 1) |
|
K4985402 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 2)) Piga sgRNA CRISPR Lentivector (Mouse) (Target 2) |
|
K4985403 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 3)) Piga sgRNA CRISPR Lentivector (Mouse) (Target 3) |
|
K4985404 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 1)) Piga sgRNA CRISPR Lentivector (Rat) (Target 1) |
|
K6656902 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 2)) Piga sgRNA CRISPR Lentivector (Rat) (Target 2) |
|
K6656903 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 3)) Piga sgRNA CRISPR Lentivector (Rat) (Target 3) |
|
K6656904 |
ABM |
1.0 ug DNA |
EUR 154 |
 (pPB-C-His)) PIGA Protein Vector (Human) (pPB-C-His) |
|
PV031245 |
ABM |
500 ng |
EUR 329 |
 (pPB-N-His)) PIGA Protein Vector (Human) (pPB-N-His) |
|
PV031246 |
ABM |
500 ng |
EUR 329 |
 (pPM-C-HA)) PIGA Protein Vector (Human) (pPM-C-HA) |
|
PV031247 |
ABM |
500 ng |
EUR 329 |
 (pPM-C-His)) PIGA Protein Vector (Human) (pPM-C-His) |
|
PV031248 |
ABM |
500 ng |
EUR 329 |
 (pPB-C-His)) PIGA Protein Vector (Mouse) (pPB-C-His) |
|
PV216022 |
ABM |
500 ng |
EUR 603 |
 (pPB-N-His)) PIGA Protein Vector (Mouse) (pPB-N-His) |
|
PV216023 |
ABM |
500 ng |
EUR 603 |
 (pPM-C-HA)) PIGA Protein Vector (Mouse) (pPM-C-HA) |
|
PV216024 |
ABM |
500 ng |
EUR 603 |
 (pPM-C-His)) PIGA Protein Vector (Mouse) (pPM-C-His) |
|
PV216025 |
ABM |
500 ng |
EUR 603 |
 (pPB-C-His)) PIGA Protein Vector (Rat) (pPB-C-His) |
|
PV293954 |
ABM |
500 ng |
EUR 603 |
 (pPB-N-His)) PIGA Protein Vector (Rat) (pPB-N-His) |
|
PV293955 |
ABM |
500 ng |
EUR 603 |
 (pPM-C-HA)) PIGA Protein Vector (Rat) (pPM-C-HA) |
|
PV293956 |
ABM |
500 ng |
EUR 603 |
 (pPM-C-His)) PIGA Protein Vector (Rat) (pPM-C-His) |
|
PV293957 |
ABM |
500 ng |
EUR 603 |
 Piga 3'UTR GFP Stable Cell Line |
|
TU166345 |
ABM |
1.0 ml |
Ask for price |
 PIGA 3'UTR Luciferase Stable Cell Line |
|
TU017926 |
ABM |
1.0 ml |
EUR 4617 |
 Piga 3'UTR Luciferase Stable Cell Line |
|
TU116345 |
ABM |
1.0 ml |
Ask for price |
 PIGA 3'UTR GFP Stable Cell Line |
|
TU067926 |
ABM |
1.0 ml |
EUR 4617 |
Piga 3'UTR GFP Stable Cell Line |
|
TU266224 |
ABM |
1.0 ml |
Ask for price |
Piga 3'UTR Luciferase Stable Cell Line |
|
TU216224 |
ABM |
1.0 ml |
Ask for price |
 (CMV) (pLenti-GIII-CMV)) PIGA Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV) |
|
LV622225 |
ABM |
1.0 ug DNA |
EUR 514 |
 (UbC) (pLenti-GIII-UbC)) PIGA Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC) |
|
LV622229 |
ABM |
1.0 ug DNA |
EUR 514 |
 (EF1a) (pLenti-GIII-EF1a)) PIGA Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a) |
|
LV622230 |
ABM |
1.0 ug DNA |
EUR 514 |
 VEGF Rabbit Polyclonal Antibody |
|
ES8453-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
VEGF Rabbit Polyclonal Antibody |
|
ES8453-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 CD10 Rabbit Polyclonal Antibody |
|
ES8454-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
CD10 Rabbit Polyclonal Antibody |
|
ES8454-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 NM23A Rabbit Polyclonal Antibody |
|
ES8455-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NM23A Rabbit Polyclonal Antibody |
|
ES8455-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 ATM Rabbit Polyclonal Antibody |
|
ES8456-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
|
ES8456-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
|
ES8457-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
|
ES8457-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 HSC70 Rabbit Polyclonal Antibody |
|
ES8558-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSC70 Rabbit Polyclonal Antibody |
|
ES8558-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
 HSP40 Rabbit Polyclonal Antibody |
|
ES8559-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSP40 Rabbit Polyclonal Antibody |
|
ES8559-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
 HSP90? Rabbit Polyclonal Antibody |
|
ES8560-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
HSP90? Rabbit Polyclonal Antibody |
|
ES8560-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 IkB ? Rabbit Polyclonal Antibody |
|
ES8561-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
IkB ? Rabbit Polyclonal Antibody |
|
ES8561-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
 JAK1 Rabbit Polyclonal Antibody |
|
ES8562-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JAK1 Rabbit Polyclonal Antibody |
|
ES8562-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 JAK2 Rabbit Polyclonal Antibody |
|
ES8563-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JAK2 Rabbit Polyclonal Antibody |
|
ES8563-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 JNK2 Rabbit Polyclonal Antibody |
|
ES8564-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
JNK2 Rabbit Polyclonal Antibody |
|
ES8564-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
 JNK3 Rabbit Polyclonal Antibody |
|
ES8565-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JNK3 Rabbit Polyclonal Antibody |
|
ES8565-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 MEK2 Rabbit Polyclonal Antibody |
|
ES8566-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC |
MEK2 Rabbit Polyclonal Antibody |
|
ES8566-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC |
 MEK3 Rabbit Polyclonal Antibody |
|
ES8567-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
MEK3 Rabbit Polyclonal Antibody |
|
ES8567-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 Nrf2 Rabbit Polyclonal Antibody |
|
ES8568-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
Nrf2 Rabbit Polyclonal Antibody |
|
ES8568-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 ATG4a Rabbit Polyclonal Antibody |
|
ES8569-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4a Rabbit Polyclonal Antibody |
|
ES8569-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 ATG4b Rabbit Polyclonal Antibody |
|
ES8570-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4b Rabbit Polyclonal Antibody |
|
ES8570-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 ATG4c Rabbit Polyclonal Antibody |
|
ES8571-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
PIGA Rabbit Polyclonal Antibody
