Biocat Net

Amine biocat 3.0

PIGP Rabbit Polyclonal Antibody

PIGP Polyclonal Antibody

ES9991-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against PIGP from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

PIGP Polyclonal Antibody

ES9991-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against PIGP from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

PIGP Rabbit pAb

A15446-100ul 100 ul
EUR 308

PIGP Rabbit pAb

A15446-200ul 200 ul
EUR 459

PIGP Rabbit pAb

A15446-20ul 20 ul
EUR 183

PIGP Rabbit pAb

A15446-50ul 50 ul
EUR 223

PIGP Antibody

46127-100ul 100ul
EUR 252

PIGP Antibody

46127-50ul 50ul
EUR 187

PIGP Antibody

DF9744 200ul
EUR 304
Description: PIGP Antibody detects endogenous levels of total PIGP.

PIGP Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PIGP. Recognizes PIGP from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:20-1:200, IF:1:50-1:200

PIGP Antibody

ABD9744 100 ug
EUR 438

PIGP Conjugated Antibody

C46127 100ul
EUR 397

anti- PIGP antibody

FNab06444 100µg
EUR 548.75
  • Immunogen: phosphatidylinositol glycan anchor biosynthesis, class P
  • Uniprot ID: P57054
  • Gene ID: 51227
  • Research Area: Metabolism
Description: Antibody raised against PIGP

Anti-PIGP antibody

PAab06444 100 ug
EUR 386

Anti-PIGP antibody

STJ117641 100 µl
EUR 277
Description: This gene encodes an enzyme involved in the first step of glycosylphosphatidylinositol (GPI)-anchor biosynthesis. The GPI-anchor is a glycolipid found on many blood cells that serves to anchor proteins to the cell surface. The encoded protein is a component of the GPI-N-acetylglucosaminyltransferase complex that catalyzes the transfer of N-acetylglucosamine (GlcNAc) from UDP-GlcNAc to phosphatidylinositol (PI). This gene is located in the Down Syndrome critical region on chromosome 21 and is a candidate for the pathogenesis of Down syndrome. This gene has multiple pseudogenes and is a member of the phosphatidylinositol glycan anchor biosynthesis gene family. Alternatively spliced transcript variants encoding different isoforms have been described.

Anti-PIGP antibody

STJ191149 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to PIGP


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

PIGP Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PIGP. Recognizes PIGP from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

PIGP Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PIGP. Recognizes PIGP from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

PIGP Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PIGP. Recognizes PIGP from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

PIGP Blocking Peptide

DF9744-BP 1mg
EUR 195

PIGP cloning plasmid

CSB-CL017979HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 405
  • Sequence: atggtggaaaattcaccgtcgccattgccagaaagagcgatttatggctttgttcttttcttaagctcccaatttggcttcatactttacctcgtgtgggcctttattcctgaatcttggctaaactctttaggtttaacctattggcctcaaaaatattgggcagttgcattacc
  • Show more
Description: A cloning plasmid for the PIGP gene.

Anti-PIGP (2E7)

YF-MA18446 100 ug
EUR 363
Description: Mouse monoclonal to PIGP

Mouse Pigp ELISA KIT

ELI-22729m 96 Tests
EUR 865


EF001781 96 Tests
EUR 689


ELI-43654h 96 Tests
EUR 824

Mouse PIGP shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human PIGP shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

PIGP Recombinant Protein (Human)

RP023473 100 ug Ask for price

PIGP Recombinant Protein (Mouse)

RP162053 100 ug Ask for price

PIGP Recombinant Protein (Mouse)

RP162056 100 ug Ask for price

PIGP Recombinant Protein (Mouse)

RP162059 100 ug Ask for price

PIGP Recombinant Protein (Mouse)

RP162062 100 ug Ask for price

PIGP Recombinant Protein (Mouse)

RP162065 100 ug Ask for price

PIGP Recombinant Protein (Mouse)

RP162068 100 ug Ask for price

PIGP Recombinant Protein (Rat)

RP220487 100 ug Ask for price

Pigp ORF Vector (Rat) (pORF)

ORF073497 1.0 ug DNA
EUR 506

PIGP ORF Vector (Human) (pORF)

ORF007825 1.0 ug DNA
EUR 95

Pigp ORF Vector (Mouse) (pORF)

ORF054019 1.0 ug DNA
EUR 506

Pigp ORF Vector (Mouse) (pORF)

ORF054020 1.0 ug DNA
EUR 506

Pigp ORF Vector (Mouse) (pORF)

ORF054021 1.0 ug DNA
EUR 506

Pigp ORF Vector (Mouse) (pORF)

ORF054022 1.0 ug DNA
EUR 506

Pigp ORF Vector (Mouse) (pORF)

ORF054023 1.0 ug DNA
EUR 506

Pigp ORF Vector (Mouse) (pORF)

ORF054024 1.0 ug DNA
EUR 506

Phosphatidylinositol Glycan Anchor Biosynthesis Class P (PIGP) Antibody

  • EUR 425.00
  • EUR 342.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Phosphatidylinositol Glycan Anchor Biosynthesis Class P (PIGP) Antibody

abx029081-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Phosphatidylinositol Glycan Anchor Biosynthesis Class P (PIGP) Antibody

abx029081-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Phosphatidylinositol Glycan Anchor Biosynthesis Class P (PIGP) Antibody

abx236444-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

Phosphatidylinositol Glycan Anchor Biosynthesis Class P (PIGP) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Pigp sgRNA CRISPR Lentivector set (Rat)

K6548601 3 x 1.0 ug
EUR 339

Pigp sgRNA CRISPR Lentivector set (Mouse)

K3106601 3 x 1.0 ug
EUR 339

PIGP sgRNA CRISPR Lentivector set (Human)

K1648001 3 x 1.0 ug
EUR 339

Phosphatidylinositol Glycan Anchor Biosynthesis Class P (PIGP) Antibody (HRP)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Phosphatidylinositol Glycan Anchor Biosynthesis Class P (PIGP) Antibody (FITC)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Phosphatidylinositol Glycan Anchor Biosynthesis Class P (PIGP) Antibody (Biotin)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Pigp sgRNA CRISPR Lentivector (Rat) (Target 1)

K6548602 1.0 ug DNA
EUR 154

Pigp sgRNA CRISPR Lentivector (Rat) (Target 2)

K6548603 1.0 ug DNA
EUR 154

Pigp sgRNA CRISPR Lentivector (Rat) (Target 3)

K6548604 1.0 ug DNA
EUR 154

Pigp sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3106602 1.0 ug DNA
EUR 154

Pigp sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3106603 1.0 ug DNA
EUR 154

Pigp sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3106604 1.0 ug DNA
EUR 154

PIGP sgRNA CRISPR Lentivector (Human) (Target 1)

K1648002 1.0 ug DNA
EUR 154

PIGP sgRNA CRISPR Lentivector (Human) (Target 2)

K1648003 1.0 ug DNA
EUR 154

PIGP sgRNA CRISPR Lentivector (Human) (Target 3)

K1648004 1.0 ug DNA
EUR 154

PIGP Protein Vector (Rat) (pPB-C-His)

PV293986 500 ng
EUR 603

PIGP Protein Vector (Rat) (pPB-N-His)

PV293987 500 ng
EUR 603

PIGP Protein Vector (Rat) (pPM-C-HA)

PV293988 500 ng
EUR 603

PIGP Protein Vector (Rat) (pPM-C-His)

PV293989 500 ng
EUR 603

PIGP Protein Vector (Human) (pPB-C-His)

PV031297 500 ng
EUR 329

PIGP Protein Vector (Human) (pPB-N-His)

PV031298 500 ng
EUR 329

PIGP Protein Vector (Human) (pPM-C-HA)

PV031299 500 ng
EUR 329

PIGP Protein Vector (Human) (pPM-C-His)

PV031300 500 ng
EUR 329

PIGP Protein Vector (Mouse) (pPB-C-His)

PV216074 500 ng
EUR 603

PIGP Protein Vector (Mouse) (pPB-N-His)

PV216075 500 ng
EUR 603

PIGP Protein Vector (Mouse) (pPM-C-HA)

PV216076 500 ng
EUR 603

PIGP Protein Vector (Mouse) (pPM-C-His)

PV216077 500 ng
EUR 603

PIGP Protein Vector (Mouse) (pPB-C-His)

PV216078 500 ng
EUR 603

PIGP Protein Vector (Mouse) (pPB-N-His)

PV216079 500 ng
EUR 603

PIGP Protein Vector (Mouse) (pPM-C-HA)

PV216080 500 ng
EUR 603

PIGP Protein Vector (Mouse) (pPM-C-His)

PV216081 500 ng
EUR 603

PIGP Protein Vector (Mouse) (pPB-C-His)

PV216082 500 ng
EUR 603

PIGP Protein Vector (Mouse) (pPB-N-His)

PV216083 500 ng
EUR 603

PIGP Protein Vector (Mouse) (pPM-C-HA)

PV216084 500 ng
EUR 603

PIGP Protein Vector (Mouse) (pPM-C-His)

PV216085 500 ng
EUR 603

PIGP Protein Vector (Mouse) (pPB-C-His)

PV216086 500 ng
EUR 603

PIGP Protein Vector (Mouse) (pPB-N-His)

PV216087 500 ng
EUR 603

PIGP Protein Vector (Mouse) (pPM-C-HA)

PV216088 500 ng
EUR 603

PIGP Protein Vector (Mouse) (pPM-C-His)

PV216089 500 ng
EUR 603

PIGP Protein Vector (Mouse) (pPB-C-His)

PV216090 500 ng
EUR 603

PIGP Protein Vector (Mouse) (pPB-N-His)

PV216091 500 ng
EUR 603

PIGP Protein Vector (Mouse) (pPM-C-HA)

PV216092 500 ng
EUR 603

PIGP Protein Vector (Mouse) (pPM-C-His)

PV216093 500 ng
EUR 603

PIGP Protein Vector (Mouse) (pPB-C-His)

PV216094 500 ng
EUR 603

PIGP Protein Vector (Mouse) (pPB-N-His)

PV216095 500 ng
EUR 603

PIGP Protein Vector (Mouse) (pPM-C-HA)

PV216096 500 ng
EUR 603

PIGP Protein Vector (Mouse) (pPM-C-His)

PV216097 500 ng
EUR 603

Pigp 3'UTR Luciferase Stable Cell Line

TU116356 1.0 ml Ask for price

Pigp 3'UTR GFP Stable Cell Line

TU166356 1.0 ml Ask for price

Pigp 3'UTR Luciferase Stable Cell Line

TU216234 1.0 ml Ask for price

Pigp 3'UTR GFP Stable Cell Line

TU266234 1.0 ml Ask for price

PIGP 3'UTR GFP Stable Cell Line

TU067940 1.0 ml
EUR 1521

PIGP 3'UTR Luciferase Stable Cell Line

TU017940 1.0 ml
EUR 1521

GAPDH Rabbit Polyclonal Antibody

37985-100ul 100ul
EUR 252

GAPDH Rabbit Polyclonal Antibody

37985-50ul 50ul
EUR 187

EFHD1 Rabbit Polyclonal Antibody

38001-100ul 100ul
EUR 252

EFHD1 Rabbit Polyclonal Antibody

38001-50ul 50ul
EUR 187

Alliinase Rabbit Polyclonal Antibody

38042-100ul 100ul
EUR 252

Alliinase Rabbit Polyclonal Antibody

38042-50ul 50ul
EUR 187

ECFP Rabbit Polyclonal Antibody

38077-100ul 100ul
EUR 252

ECFP Rabbit Polyclonal Antibody

38077-50ul 50ul
EUR 187

EYFP Rabbit Polyclonal Antibody

38078-100ul 100ul
EUR 252

EYFP Rabbit Polyclonal Antibody

38078-50ul 50ul
EUR 187

mOrange Rabbit Polyclonal Antibody

38079-100ul 100ul
EUR 252

mOrange Rabbit Polyclonal Antibody

38079-50ul 50ul
EUR 187

mStrawberry Rabbit Polyclonal Antibody

38083-100ul 100ul
EUR 252

mStrawberry Rabbit Polyclonal Antibody

38083-50ul 50ul
EUR 187

AmCyan Rabbit Polyclonal Antibody

38086-100ul 100ul
EUR 252

AmCyan Rabbit Polyclonal Antibody

38086-50ul 50ul
EUR 187

EBFP Rabbit Polyclonal Antibody

38087-100ul 100ul
EUR 252

PIGP Rabbit Polyclonal Antibody