PLK4 Polyclonal Antibody |
ES10211-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against PLK4 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA |
PLK4 Polyclonal Antibody |
ES10211-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against PLK4 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA |
PLK4 Rabbit pAb |
A9863-100ul |
Abclonal |
100 ul |
EUR 308 |
PLK4 Rabbit pAb |
A9863-200ul |
Abclonal |
200 ul |
EUR 459 |
PLK4 Rabbit pAb |
A9863-20ul |
Abclonal |
20 ul |
EUR 183 |
PLK4 Rabbit pAb |
A9863-50ul |
Abclonal |
50 ul |
EUR 223 |
PLK4 antibody |
70R-19350 |
Fitzgerald |
50 ul |
EUR 435 |
Description: Rabbit polyclonal PLK4 antibody |
PLK4 Antibody |
43523-100ul |
SAB |
100ul |
EUR 252 |
PLK4 Antibody |
DF8120 |
Affbiotech |
200ul |
EUR 304 |
Description: PLK4 Antibody detects endogenous levels of total PLK4. |
PLK4 Antibody |
1-CSB-PA018196GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
|
Description: A polyclonal antibody against PLK4. Recognizes PLK4 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC |
Polyclonal PLK4 Antibody (C-Term) |
APR04894G |
Leading Biology |
0.1ml |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human PLK4 (C-Term). This antibody is tested and proven to work in the following applications: |
Serine/Threonine-Protein Kinase PLK4 (PLK4) Antibody |
20-abx135807 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
Serine/Threonine-Protein Kinase PLK4 (PLK4) Antibody |
abx236550-100ug |
Abbexa |
100 ug |
EUR 481 |
- Shipped within 5-12 working days.
|
PLK4 Conjugated Antibody |
C43523 |
SAB |
100ul |
EUR 397 |
anti- PLK4 antibody |
FNab06550 |
FN Test |
100µg |
EUR 505.25 |
- Recommended dilution: WB: 1:200 - 1:2000
- IHC: 1:50 - 1:100
- Immunogen: polo-like kinase 4 (Drosophila)
- Uniprot ID: O00444
- Gene ID: 10733
- Research Area: Metabolism, Developmental biology
|
Description: Antibody raised against PLK4 |
Anti-PLK4 antibody |
STJ111905 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: This gene encodes a member of the polo family of serine/threonine protein kinases. The protein localizes to centrioles, complex microtubule-based structures found in centrosomes, and regulates centriole duplication during the cell cycle. Three alternatively spliced transcript variants that encode different protein isoforms have been found for this gene. |
Anti-PLK4 antibody |
STJ191369 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to PLK4 |
PLK4 siRNA |
20-abx904088 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
PLK4 siRNA |
20-abx928966 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
PLK4 siRNA |
20-abx928967 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
anti-PLK4 |
YF-PA17180 |
Abfrontier |
50 ug |
EUR 363 |
Description: Mouse polyclonal to PLK4 |
anti-PLK4 |
YF-PA17181 |
Abfrontier |
100 ul |
EUR 403 |
Description: Rabbit polyclonal to PLK4 |
Polyclonal Goat Anti-Sak / STK18 / PLK4 Antibody |
APG00293G |
Leading Biology |
0.1mg |
EUR 484 |
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human Goat Anti-Sak / STK18 / PLK4 . This antibody is tested and proven to work in the following applications: |
PLK4 Blocking Peptide |
DF8120-BP |
Affbiotech |
1mg |
EUR 195 |
PLK4 cloning plasmid |
CSB-CL018196HU-10ug |
Cusabio |
10ug |
EUR 926 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 2913
- Sequence: atggcgacctgcatcggggagaagatcgaggattttaaagttggaaatctgcttggtaaaggatcatttgctggtgtctacagagctgagtccattcacactggtttggaagttgcaatcaaaatgatagataagaaagccatgtacaaagcaggaatggtacagagagtccaaa
- Show more
|
Description: A cloning plasmid for the PLK4 gene. |
Anti-PLK4 (1C8) |
YF-MA11310 |
Abfrontier |
100 ug |
EUR 363 |
Description: Mouse monoclonal to PLK4 |
Mouse Serine/threonine- protein kinase PLK4, Plk4 ELISA KIT |
ELI-15337m |
Lifescience Market |
96 Tests |
EUR 865 |
Bovine Serine/threonine- protein kinase PLK4, PLK4 ELISA KIT |
ELI-16326b |
Lifescience Market |
96 Tests |
EUR 928 |
Human Serine/threonine- protein kinase PLK4, PLK4 ELISA KIT |
ELI-23052h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Serine/Threonine-Protein Kinase PLK4 (PLK4) ELISA Kit |
abx382296-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
Rat PLK4 shRNA Plasmid |
20-abx989599 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Mouse PLK4 shRNA Plasmid |
20-abx972923 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Human PLK4 shRNA Plasmid |
20-abx957312 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Polo Like Kinase 4 (PLK4) Antibody |
abx430040-200ul |
Abbexa |
200 ul |
EUR 384 |
- Shipped within 1-3 working days.
|
Plk4 ORF Vector (Rat) (pORF) |
ORF073674 |
ABM |
1.0 ug DNA |
EUR 506 |
h PLK4 inducible lentiviral particles |
LVP226 |
GenTarget |
1x107 IFU/ml x 200ul |
EUR 451 |
Description: Pre-made tet-inducible lentiviral particles expressing a human gene with a Blasticidin-RFP fusion marker (Dual selection). The expressed human gene, PLK4, is fully sequence verified and matched to NCBI accession ID: NM_014264.3 |
PLK4 ORF Vector (Human) (pORF) |
ORF007939 |
ABM |
1.0 ug DNA |
EUR 95 |
Plk4 ORF Vector (Mouse) (pORF) |
ORF054310 |
ABM |
1.0 ug DNA |
EUR 506 |
Plk4 ORF Vector (Mouse) (pORF) |
ORF054311 |
ABM |
1.0 ug DNA |
EUR 506 |
Plk4 sgRNA CRISPR Lentivector set (Rat) |
K7603601 |
ABM |
3 x 1.0 ug |
EUR 339 |
Plk4 sgRNA CRISPR Lentivector set (Mouse) |
K3975401 |
ABM |
3 x 1.0 ug |
EUR 339 |
PLK4 sgRNA CRISPR Lentivector set (Human) |
K1669401 |
ABM |
3 x 1.0 ug |
EUR 339 |
Plk4 sgRNA CRISPR Lentivector (Rat) (Target 1) |
K7603602 |
ABM |
1.0 ug DNA |
EUR 154 |
Plk4 sgRNA CRISPR Lentivector (Rat) (Target 2) |
K7603603 |
ABM |
1.0 ug DNA |
EUR 154 |
Plk4 sgRNA CRISPR Lentivector (Rat) (Target 3) |
K7603604 |
ABM |
1.0 ug DNA |
EUR 154 |
Plk4 sgRNA CRISPR Lentivector (Mouse) (Target 1) |
K3975402 |
ABM |
1.0 ug DNA |
EUR 154 |
Plk4 sgRNA CRISPR Lentivector (Mouse) (Target 2) |
K3975403 |
ABM |
1.0 ug DNA |
EUR 154 |
Plk4 sgRNA CRISPR Lentivector (Mouse) (Target 3) |
K3975404 |
ABM |
1.0 ug DNA |
EUR 154 |
PLK4 sgRNA CRISPR Lentivector (Human) (Target 1) |
K1669402 |
ABM |
1.0 ug DNA |
EUR 154 |
PLK4 sgRNA CRISPR Lentivector (Human) (Target 2) |
K1669403 |
ABM |
1.0 ug DNA |
EUR 154 |
PLK4 sgRNA CRISPR Lentivector (Human) (Target 3) |
K1669404 |
ABM |
1.0 ug DNA |
EUR 154 |
PLK4 Protein Vector (Rat) (pPB-C-His) |
PV294694 |
ABM |
500 ng |
EUR 1166 |
PLK4 Protein Vector (Rat) (pPB-N-His) |
PV294695 |
ABM |
500 ng |
EUR 1166 |
PLK4 Protein Vector (Rat) (pPM-C-HA) |
PV294696 |
ABM |
500 ng |
EUR 1166 |
PLK4 Protein Vector (Rat) (pPM-C-His) |
PV294697 |
ABM |
500 ng |
EUR 1166 |
PLK4 Protein Vector (Human) (pPB-C-His) |
PV031753 |
ABM |
500 ng |
EUR 329 |
PLK4 Protein Vector (Human) (pPB-N-His) |
PV031754 |
ABM |
500 ng |
EUR 329 |
PLK4 Protein Vector (Human) (pPM-C-HA) |
PV031755 |
ABM |
500 ng |
EUR 329 |
PLK4 Protein Vector (Human) (pPM-C-His) |
PV031756 |
ABM |
500 ng |
EUR 329 |
PLK4 Protein Vector (Mouse) (pPB-C-His) |
PV217238 |
ABM |
500 ng |
EUR 1065 |
PLK4 Protein Vector (Mouse) (pPB-N-His) |
PV217239 |
ABM |
500 ng |
EUR 1065 |
PLK4 Protein Vector (Mouse) (pPM-C-HA) |
PV217240 |
ABM |
500 ng |
EUR 1065 |
PLK4 Protein Vector (Mouse) (pPM-C-His) |
PV217241 |
ABM |
500 ng |
EUR 1065 |
PLK4 Protein Vector (Mouse) (pPB-C-His) |
PV217242 |
ABM |
500 ng |
EUR 1065 |
PLK4 Protein Vector (Mouse) (pPB-N-His) |
PV217243 |
ABM |
500 ng |
EUR 1065 |
PLK4 Protein Vector (Mouse) (pPM-C-HA) |
PV217244 |
ABM |
500 ng |
EUR 1065 |
PLK4 Protein Vector (Mouse) (pPM-C-His) |
PV217245 |
ABM |
500 ng |
EUR 1065 |
Plk4 3'UTR Luciferase Stable Cell Line |
TU116562 |
ABM |
1.0 ml |
Ask for price |
Plk4 3'UTR GFP Stable Cell Line |
TU166562 |
ABM |
1.0 ml |
Ask for price |
Plk4 3'UTR Luciferase Stable Cell Line |
TU216419 |
ABM |
1.0 ml |
Ask for price |
Plk4 3'UTR GFP Stable Cell Line |
TU266419 |
ABM |
1.0 ml |
Ask for price |
PLK4 3'UTR GFP Stable Cell Line |
TU068280 |
ABM |
1.0 ml |
EUR 1394 |
PLK4 3'UTR Luciferase Stable Cell Line |
TU018280 |
ABM |
1.0 ml |
EUR 1394 |
PLK4 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV) |
LV664903 |
ABM |
1.0 ug DNA |
EUR 1355 |
PLK4 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC) |
LV664907 |
ABM |
1.0 ug DNA |
EUR 1355 |
PLK4 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a) |
LV664908 |
ABM |
1.0 ug DNA |
EUR 1355 |
GAPDH Rabbit Polyclonal Antibody |
37985-100ul |
SAB |
100ul |
EUR 252 |
GAPDH Rabbit Polyclonal Antibody |
37985-50ul |
SAB |
50ul |
EUR 187 |
EFHD1 Rabbit Polyclonal Antibody |
38001-100ul |
SAB |
100ul |
EUR 252 |
EFHD1 Rabbit Polyclonal Antibody |
38001-50ul |
SAB |
50ul |
EUR 187 |
Alliinase Rabbit Polyclonal Antibody |
38042-100ul |
SAB |
100ul |
EUR 252 |
Alliinase Rabbit Polyclonal Antibody |
38042-50ul |
SAB |
50ul |
EUR 187 |
ECFP Rabbit Polyclonal Antibody |
38077-100ul |
SAB |
100ul |
EUR 252 |
ECFP Rabbit Polyclonal Antibody |
38077-50ul |
SAB |
50ul |
EUR 187 |
EYFP Rabbit Polyclonal Antibody |
38078-100ul |
SAB |
100ul |
EUR 252 |
EYFP Rabbit Polyclonal Antibody |
38078-50ul |
SAB |
50ul |
EUR 187 |
mOrange Rabbit Polyclonal Antibody |
38079-100ul |
SAB |
100ul |
EUR 252 |
mOrange Rabbit Polyclonal Antibody |
38079-50ul |
SAB |
50ul |
EUR 187 |
mStrawberry Rabbit Polyclonal Antibody |
38083-100ul |
SAB |
100ul |
EUR 252 |
mStrawberry Rabbit Polyclonal Antibody |
38083-50ul |
SAB |
50ul |
EUR 187 |
AmCyan Rabbit Polyclonal Antibody |
38086-100ul |
SAB |
100ul |
EUR 252 |
AmCyan Rabbit Polyclonal Antibody |
38086-50ul |
SAB |
50ul |
EUR 187 |
EBFP Rabbit Polyclonal Antibody |
38087-100ul |
SAB |
100ul |
EUR 252 |
EBFP Rabbit Polyclonal Antibody |
38087-50ul |
SAB |
50ul |
EUR 187 |
Vimentin Rabbit Polyclonal Antibody |
38104-100ul |
SAB |
100ul |
EUR 252 |
Vimentin Rabbit Polyclonal Antibody |
38104-50ul |
SAB |
50ul |
EUR 187 |
LDHD Rabbit Polyclonal Antibody |
38105-100ul |
SAB |
100ul |
EUR 252 |
LDHD Rabbit Polyclonal Antibody |
38105-50ul |
SAB |
50ul |
EUR 187 |
GAPDH Rabbit Polyclonal Antibody |
A01021-005ml |
Abbkine |
0.05ml |
EUR 147 |
- Immunogen information: Recombinant Protein
- Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
- Show more
|
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein |
GAPDH Rabbit Polyclonal Antibody |
A01021-02ml |
Abbkine |
0.2ml |
EUR 332 |
- Immunogen information: Recombinant Protein
- Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
- Show more
|
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein |
GAPDH Rabbit Polyclonal Antibody |
A01021-02ml5 |
Abbkine |
0.2ml×5 |
EUR 920 |
- Immunogen information: Recombinant Protein
- Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
- Show more
|
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein |
Rabbit Hemoglobin Polyclonal Antibody |
A53073 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: The best epigenetics products |
Met Rabbit Polyclonal Antibody |
ABP57458-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
Met Rabbit Polyclonal Antibody |
ABP57458-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
Met Rabbit Polyclonal Antibody |
ABP57458-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
VEGF Rabbit Polyclonal Antibody |
ABP57460-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
VEGF Rabbit Polyclonal Antibody |
ABP57460-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
VEGF Rabbit Polyclonal Antibody |
ABP57460-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
PLK4 Rabbit Polyclonal Antibody