PLK4 Rabbit Polyclonal Antibody

PLK4 Polyclonal Antibody

ES10211-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against PLK4 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

PLK4 Polyclonal Antibody

ES10211-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against PLK4 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

PLK4 Rabbit pAb

A9863-100ul 100 ul
EUR 308

PLK4 Rabbit pAb

A9863-200ul 200 ul
EUR 459

PLK4 Rabbit pAb

A9863-20ul 20 ul
EUR 183

PLK4 Rabbit pAb

A9863-50ul 50 ul
EUR 223

PLK4 antibody

70R-19350 50 ul
EUR 435
Description: Rabbit polyclonal PLK4 antibody

PLK4 Antibody

43523-100ul 100ul
EUR 252

PLK4 Antibody

DF8120 200ul
EUR 304
Description: PLK4 Antibody detects endogenous levels of total PLK4.

PLK4 Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against PLK4. Recognizes PLK4 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

PLK4 Antibody

ABD8120 100 ug
EUR 438

Polyclonal PLK4 Antibody (C-Term)

APR04894G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human PLK4 (C-Term). This antibody is tested and proven to work in the following applications:

Serine/Threonine-Protein Kinase PLK4 (PLK4) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Serine/Threonine-Protein Kinase PLK4 (PLK4) Antibody

abx236550-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

Plk4/ Rat Plk4 ELISA Kit

ELI-19658r 96 Tests
EUR 886

PLK4 Conjugated Antibody

C43523 100ul
EUR 397

anti- PLK4 antibody

FNab06550 100µg
EUR 505.25
  • Recommended dilution: WB: 1:200 - 1:2000
  • IHC: 1:50 - 1:100
  • Immunogen: polo-like kinase 4 (Drosophila)
  • Uniprot ID: O00444
  • Gene ID: 10733
  • Research Area: Metabolism, Developmental biology
Description: Antibody raised against PLK4

Anti-PLK4 antibody

PAab06550 100 ug
EUR 355

Anti-PLK4 antibody

STJ111905 100 µl
EUR 277
Description: This gene encodes a member of the polo family of serine/threonine protein kinases. The protein localizes to centrioles, complex microtubule-based structures found in centrosomes, and regulates centriole duplication during the cell cycle. Three alternatively spliced transcript variants that encode different protein isoforms have been found for this gene.

Anti-PLK4 antibody

STJ191369 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to PLK4


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


YF-PA17180 50 ug
EUR 363
Description: Mouse polyclonal to PLK4


YF-PA17181 100 ul
EUR 403
Description: Rabbit polyclonal to PLK4

Polyclonal Goat Anti-Sak / STK18 / PLK4 Antibody

APG00293G 0.1mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human Goat Anti-Sak / STK18 / PLK4 . This antibody is tested and proven to work in the following applications:

PLK4 Blocking Peptide

DF8120-BP 1mg
EUR 195

PLK4 cloning plasmid

CSB-CL018196HU-10ug 10ug
EUR 926
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2913
  • Sequence: atggcgacctgcatcggggagaagatcgaggattttaaagttggaaatctgcttggtaaaggatcatttgctggtgtctacagagctgagtccattcacactggtttggaagttgcaatcaaaatgatagataagaaagccatgtacaaagcaggaatggtacagagagtccaaa
  • Show more
Description: A cloning plasmid for the PLK4 gene.

Anti-PLK4 (1C8)

YF-MA11310 100 ug
EUR 363
Description: Mouse monoclonal to PLK4

Anti-Sak / STK18 / PLK4 antibody

STJ70130 100 µg
EUR 359

Mouse Serine/threonine- protein kinase PLK4, Plk4 ELISA KIT

ELI-15337m 96 Tests
EUR 865

Bovine Serine/threonine- protein kinase PLK4, PLK4 ELISA KIT

ELI-16326b 96 Tests
EUR 928

Human Serine/threonine- protein kinase PLK4, PLK4 ELISA KIT

ELI-23052h 96 Tests
EUR 824

Human Serine/Threonine-Protein Kinase PLK4 (PLK4) ELISA Kit

abx382296-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.


EF001865 96 Tests
EUR 689

Rat PLK4 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse PLK4 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human PLK4 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

pECMV- 3*Flag- pLK4

PVT10280 2 ug
EUR 266

Polo Like Kinase 4 (PLK4) Antibody

abx430040-200ul 200 ul
EUR 384
  • Shipped within 1-3 working days.

Plk4 ORF Vector (Rat) (pORF)

ORF073674 1.0 ug DNA
EUR 506

h PLK4 inducible lentiviral particles

LVP226 1x107 IFU/ml x 200ul
EUR 451
Description: Pre-made tet-inducible lentiviral particles expressing a human gene with a Blasticidin-RFP fusion marker (Dual selection). The expressed human gene, PLK4, is fully sequence verified and matched to NCBI accession ID: NM_014264.3

PLK4 ORF Vector (Human) (pORF)

ORF007939 1.0 ug DNA
EUR 95

Plk4 ORF Vector (Mouse) (pORF)

ORF054310 1.0 ug DNA
EUR 506

Plk4 ORF Vector (Mouse) (pORF)

ORF054311 1.0 ug DNA
EUR 506

Plk4 sgRNA CRISPR Lentivector set (Rat)

K7603601 3 x 1.0 ug
EUR 339

Plk4 sgRNA CRISPR Lentivector set (Mouse)

K3975401 3 x 1.0 ug
EUR 339

PLK4 sgRNA CRISPR Lentivector set (Human)

K1669401 3 x 1.0 ug
EUR 339

Plk4 sgRNA CRISPR Lentivector (Rat) (Target 1)

K7603602 1.0 ug DNA
EUR 154

Plk4 sgRNA CRISPR Lentivector (Rat) (Target 2)

K7603603 1.0 ug DNA
EUR 154

Plk4 sgRNA CRISPR Lentivector (Rat) (Target 3)

K7603604 1.0 ug DNA
EUR 154

Plk4 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3975402 1.0 ug DNA
EUR 154

Plk4 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3975403 1.0 ug DNA
EUR 154

Plk4 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3975404 1.0 ug DNA
EUR 154

PLK4 sgRNA CRISPR Lentivector (Human) (Target 1)

K1669402 1.0 ug DNA
EUR 154

PLK4 sgRNA CRISPR Lentivector (Human) (Target 2)

K1669403 1.0 ug DNA
EUR 154

PLK4 sgRNA CRISPR Lentivector (Human) (Target 3)

K1669404 1.0 ug DNA
EUR 154

PLK4 Protein Vector (Rat) (pPB-C-His)

PV294694 500 ng
EUR 1166

PLK4 Protein Vector (Rat) (pPB-N-His)

PV294695 500 ng
EUR 1166

PLK4 Protein Vector (Rat) (pPM-C-HA)

PV294696 500 ng
EUR 1166

PLK4 Protein Vector (Rat) (pPM-C-His)

PV294697 500 ng
EUR 1166

PLK4 Protein Vector (Human) (pPB-C-His)

PV031753 500 ng
EUR 329

PLK4 Protein Vector (Human) (pPB-N-His)

PV031754 500 ng
EUR 329

PLK4 Protein Vector (Human) (pPM-C-HA)

PV031755 500 ng
EUR 329

PLK4 Protein Vector (Human) (pPM-C-His)

PV031756 500 ng
EUR 329

PLK4 Protein Vector (Mouse) (pPB-C-His)

PV217238 500 ng
EUR 1065

PLK4 Protein Vector (Mouse) (pPB-N-His)

PV217239 500 ng
EUR 1065

PLK4 Protein Vector (Mouse) (pPM-C-HA)

PV217240 500 ng
EUR 1065

PLK4 Protein Vector (Mouse) (pPM-C-His)

PV217241 500 ng
EUR 1065

PLK4 Protein Vector (Mouse) (pPB-C-His)

PV217242 500 ng
EUR 1065

PLK4 Protein Vector (Mouse) (pPB-N-His)

PV217243 500 ng
EUR 1065

PLK4 Protein Vector (Mouse) (pPM-C-HA)

PV217244 500 ng
EUR 1065

PLK4 Protein Vector (Mouse) (pPM-C-His)

PV217245 500 ng
EUR 1065

Plk4 3'UTR Luciferase Stable Cell Line

TU116562 1.0 ml Ask for price

Plk4 3'UTR GFP Stable Cell Line

TU166562 1.0 ml Ask for price

Plk4 3'UTR Luciferase Stable Cell Line

TU216419 1.0 ml Ask for price

Plk4 3'UTR GFP Stable Cell Line

TU266419 1.0 ml Ask for price

PLK4 3'UTR GFP Stable Cell Line

TU068280 1.0 ml
EUR 1394

PLK4 3'UTR Luciferase Stable Cell Line

TU018280 1.0 ml
EUR 1394

PLK4 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)

LV664903 1.0 ug DNA
EUR 1355

PLK4 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)

LV664907 1.0 ug DNA
EUR 1355

PLK4 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)

LV664908 1.0 ug DNA
EUR 1355

GAPDH Rabbit Polyclonal Antibody

37985-100ul 100ul
EUR 252

GAPDH Rabbit Polyclonal Antibody

37985-50ul 50ul
EUR 187

EFHD1 Rabbit Polyclonal Antibody

38001-100ul 100ul
EUR 252

EFHD1 Rabbit Polyclonal Antibody

38001-50ul 50ul
EUR 187

Alliinase Rabbit Polyclonal Antibody

38042-100ul 100ul
EUR 252

Alliinase Rabbit Polyclonal Antibody

38042-50ul 50ul
EUR 187

ECFP Rabbit Polyclonal Antibody

38077-100ul 100ul
EUR 252

ECFP Rabbit Polyclonal Antibody

38077-50ul 50ul
EUR 187

EYFP Rabbit Polyclonal Antibody

38078-100ul 100ul
EUR 252

EYFP Rabbit Polyclonal Antibody

38078-50ul 50ul
EUR 187

mOrange Rabbit Polyclonal Antibody

38079-100ul 100ul
EUR 252

mOrange Rabbit Polyclonal Antibody

38079-50ul 50ul
EUR 187

mStrawberry Rabbit Polyclonal Antibody

38083-100ul 100ul
EUR 252

mStrawberry Rabbit Polyclonal Antibody

38083-50ul 50ul
EUR 187

AmCyan Rabbit Polyclonal Antibody

38086-100ul 100ul
EUR 252

AmCyan Rabbit Polyclonal Antibody

38086-50ul 50ul
EUR 187

EBFP Rabbit Polyclonal Antibody

38087-100ul 100ul
EUR 252

EBFP Rabbit Polyclonal Antibody

38087-50ul 50ul
EUR 187

Vimentin Rabbit Polyclonal Antibody

38104-100ul 100ul
EUR 252

Vimentin Rabbit Polyclonal Antibody

38104-50ul 50ul
EUR 187

LDHD Rabbit Polyclonal Antibody

38105-100ul 100ul
EUR 252

LDHD Rabbit Polyclonal Antibody

38105-50ul 50ul
EUR 187

GAPDH Rabbit Polyclonal Antibody

A01021-005ml 0.05ml
EUR 147
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

GAPDH Rabbit Polyclonal Antibody

A01021-02ml 0.2ml
EUR 332
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

GAPDH Rabbit Polyclonal Antibody

A01021-02ml5 0.2ml×5
EUR 920
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

Rabbit Hemoglobin Polyclonal Antibody

A53073 100 µg
EUR 570.55
Description: The best epigenetics products

Met Rabbit Polyclonal Antibody

ABP57458-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

Met Rabbit Polyclonal Antibody

ABP57458-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

Met Rabbit Polyclonal Antibody

ABP57458-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

VEGF Rabbit Polyclonal Antibody

ABP57460-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

VEGF Rabbit Polyclonal Antibody

ABP57460-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

VEGF Rabbit Polyclonal Antibody

ABP57460-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

PLK4 Rabbit Polyclonal Antibody