PLS1 Polyclonal Antibody |
ABP59945-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Synthesized peptide derived from part region of human PLS1 protein at amino acid sequence of 170-250
- Applications tips:
|
Description: A polyclonal antibody for detection of PLS1 from Human. This PLS1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PLS1 protein at amino acid sequence of 170-250 |
PLS1 Polyclonal Antibody |
ABP59945-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from part region of human PLS1 protein at amino acid sequence of 170-250
- Applications tips:
|
Description: A polyclonal antibody for detection of PLS1 from Human. This PLS1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PLS1 protein at amino acid sequence of 170-250 |
PLS1 Polyclonal Antibody |
ABP59945-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human PLS1 protein at amino acid sequence of 170-250
- Applications tips:
|
Description: A polyclonal antibody for detection of PLS1 from Human. This PLS1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PLS1 protein at amino acid sequence of 170-250 |
PLS1 Polyclonal Antibody |
ES10002-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against PLS1 from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA |
PLS1 Polyclonal Antibody |
ES10002-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against PLS1 from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA |
Human Plastin 1 (PLS1) ELISA Kit |
DLR-PLS1-Hu-48T |
DL Develop |
48T |
EUR 517 |
- Should the Human Plastin 1 (PLS1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Plastin 1 (PLS1) in samples from tissue homogenates or other biological fluids. |
Human Plastin 1 (PLS1) ELISA Kit |
DLR-PLS1-Hu-96T |
DL Develop |
96T |
EUR 673 |
- Should the Human Plastin 1 (PLS1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Plastin 1 (PLS1) in samples from tissue homogenates or other biological fluids. |
Human Plastin 1 (PLS1) ELISA Kit |
RDR-PLS1-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 544 |
Human Plastin 1 (PLS1) ELISA Kit |
RDR-PLS1-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 756 |
Human Plastin 1 (PLS1) ELISA Kit |
RD-PLS1-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 521 |
Human Plastin 1 (PLS1) ELISA Kit |
RD-PLS1-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 723 |
PLS1 Rabbit pAb |
A15303-100ul |
Abclonal |
100 ul |
EUR 308 |
PLS1 Rabbit pAb |
A15303-200ul |
Abclonal |
200 ul |
EUR 459 |
PLS1 Rabbit pAb |
A15303-20ul |
Abclonal |
20 ul |
EUR 183 |
PLS1 Rabbit pAb |
A15303-50ul |
Abclonal |
50 ul |
EUR 223 |
PLS1 Rabbit pAb |
A3626-100ul |
Abclonal |
100 ul |
EUR 308 |
PLS1 Rabbit pAb |
A3626-200ul |
Abclonal |
200 ul |
EUR 459 |
PLS1 Rabbit pAb |
A3626-20ul |
Abclonal |
20 ul |
Ask for price |
PLS1 Rabbit pAb |
A3626-50ul |
Abclonal |
50 ul |
Ask for price |
PLS1 Polyclonal Conjugated Antibody |
C28906 |
SAB |
100ul |
EUR 397 |
PLS1 antibody |
70R-19356 |
Fitzgerald |
50 ul |
EUR 435 |
Description: Rabbit polyclonal PLS1 antibody |
PLS1 Antibody |
1-CSB-PA623928LA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against PLS1. Recognizes PLS1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF, IP; Recommended dilution: WB:1:500-1:5000, IHC:1:200-1:500, IF:1:50-1:200, IP:1:200-1:2000 |
PLS1 Antibody |
1-CSB-PA018205GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
|
Description: A polyclonal antibody against PLS1. Recognizes PLS1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB |
Polyclonal PLS1 Antibody (C-term) |
APR14377G |
Leading Biology |
0.1ml |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human PLS1 (C-term). This antibody is tested and proven to work in the following applications: |
anti- PLS1 antibody |
FNab06557 |
FN Test |
100µg |
EUR 548.75 |
- Immunogen: plastin 1(I isoform)
- Uniprot ID: Q14651
- Gene ID: 5357
- Research Area: Signal Transduction
|
Description: Antibody raised against PLS1 |
Anti-PLS1 antibody |
STJ26429 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: Plastins are a family of actin-binding proteins that are conserved throughout eukaryote evolution and expressed in most tissues of higher eukaryotes. In humans, two ubiquitous plastin isoforms (L and T) have been identified. The protein encoded by this gene is a third distinct plastin isoform, which is specifically expressed at high levels in the small intestine. Alternatively spliced transcript variants varying in the 5' UTR, but encoding the same protein, have been found for this gene. A pseudogene of this gene is found on chromosome 11. |
Anti-PLS1 antibody |
STJ117498 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: Plastins are a family of actin-binding proteins that are conserved throughout eukaryote evolution and expressed in most tissues of higher eukaryotes. In humans, two ubiquitous plastin isoforms (L and T) have been identified. The protein encoded by this gene is a third distinct plastin isoform, which is specifically expressed at high levels in the small intestine. Alternatively spliced transcript variants varying in the 5' UTR, but encoding the same protein, have been found for this gene. A pseudogene of this gene is found on chromosome 11. |
Anti-PLS1 antibody |
STJ191160 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to PLS1 |
PLS1 siRNA |
20-abx928986 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
PLS1 siRNA |
20-abx928987 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
PLS1 Antibody, HRP conjugated |
1-CSB-PA623928LB01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against PLS1. Recognizes PLS1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA |
PLS1 Antibody, FITC conjugated |
1-CSB-PA623928LC01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against PLS1. Recognizes PLS1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA |
PLS1 Antibody, Biotin conjugated |
1-CSB-PA623928LD01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against PLS1. Recognizes PLS1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA |
Plastin-1 (PLS1) Antibody |
abx027237-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
Plastin-1 (PLS1) Antibody |
abx027237-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
Plastin 1 (PLS1) Antibody |
20-abx178040 |
Abbexa |
|
|
|
Plastin 1 (PLS1) Antibody |
20-abx174093 |
Abbexa |
|
|
|
Plastin-1 (PLS1) Antibody |
abx236557-100ug |
Abbexa |
100 ug |
EUR 509 |
- Shipped within 5-12 working days.
|
Plastin-1 (PLS1) Antibody |
20-abx002618 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
PLS1 cloning plasmid |
CSB-CL623928HU-10ug |
Cusabio |
10ug |
EUR 639 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1890
- Sequence: atggaaaacagtactactaccatttctcgggaggagcttgaagaactacaagaggcatttaataaaatagatattgacaatagtgggtatgtcagtgactatgaacttcaagacctgtttaaggaagcaagccttcctctgcctggctacaaggtgcgcgagattgtggagaaaa
- Show more
|
Description: A cloning plasmid for the PLS1 gene. |
Anti-PLS1 (3G10) |
YF-MA10706 |
Abfrontier |
100 ug |
EUR 363 |
Description: Mouse monoclonal to PLS1 |
Human PLS1 shRNA Plasmid |
20-abx953595 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Mouse PLS1 shRNA Plasmid |
20-abx979545 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
PLS1 Recombinant Protein (Human) |
RP023836 |
ABM |
100 ug |
Ask for price |
PLS1 Recombinant Protein (Mouse) |
RP162965 |
ABM |
100 ug |
Ask for price |
PLS1 Recombinant Protein (Rat) |
RP221051 |
ABM |
100 ug |
Ask for price |
Monoclonal PLS1 Antibody (monoclonal) (M04), Clone: 3G10 |
AMM07254G |
Leading Biology |
0.1mg |
EUR 484 |
Description: A Monoclonal antibody against Human PLS1 (monoclonal) (M04). The antibodies are raised in mouse and are from clone 3G10. This antibody is applicable in WB, E |
Human Plastin 1 (PLS1) Protein |
20-abx654755 |
Abbexa |
-
EUR 578.00
-
EUR 258.00
-
EUR 1720.00
-
EUR 690.00
-
EUR 425.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-15 working days.
|
Pls1 ORF Vector (Rat) (pORF) |
ORF073685 |
ABM |
1.0 ug DNA |
EUR 506 |
PLS1 ORF Vector (Human) (pORF) |
ORF007946 |
ABM |
1.0 ug DNA |
EUR 95 |
Pls1 ORF Vector (Mouse) (pORF) |
ORF054323 |
ABM |
1.0 ug DNA |
EUR 506 |
Human Plastin 1 (PLS1) ELISA Kit |
20-abx152772 |
Abbexa |
-
EUR 7378.00
-
EUR 3933.00
-
EUR 911.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Human Plastin 1 (PLS1) CLIA Kit |
20-abx495444 |
Abbexa |
-
EUR 7973.00
-
EUR 4246.00
-
EUR 981.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
|
Mouse Plastin-1 (PLS1) ELISA Kit |
abx390256-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
Pls1 sgRNA CRISPR Lentivector set (Rat) |
K7573101 |
ABM |
3 x 1.0 ug |
EUR 339 |
Pls1 sgRNA CRISPR Lentivector set (Mouse) |
K3561201 |
ABM |
3 x 1.0 ug |
EUR 339 |
PLS1 sgRNA CRISPR Lentivector set (Human) |
K1670401 |
ABM |
3 x 1.0 ug |
EUR 339 |
PLS1-AS1 ORF Vector (Human) (pORF) |
ORF027978 |
ABM |
1.0 ug DNA |
Ask for price |
Human Plastin 1 (PLS1) ELISA Kit |
SEH366Hu-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 4731.5 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Plastin 1 (PLS1) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Plastin 1 (PLS1) in Tissue homogenates and other biological fluids. |
Human Plastin 1 (PLS1) ELISA Kit |
SEH366Hu-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 477.3 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Plastin 1 (PLS1) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Plastin 1 (PLS1) in Tissue homogenates and other biological fluids. |
Human Plastin 1 (PLS1) ELISA Kit |
SEH366Hu-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 639 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Plastin 1 (PLS1) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Plastin 1 (PLS1) in Tissue homogenates and other biological fluids. |
Human Plastin 1 (PLS1) ELISA Kit |
SEH366Hu-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 2575.5 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Plastin 1 (PLS1) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Plastin 1 (PLS1) in Tissue homogenates and other biological fluids. |
Human Plastin 1 (PLS1) ELISA Kit |
4-SEH366Hu |
Cloud-Clone |
-
EUR 4782.00
-
EUR 2526.00
-
EUR 640.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as Plastin 1 elisa. Alternative names of the recognized antigen: I-plastin
- Fimbrin
- Intestine-specific plastin
|
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Plastin 1 (PLS1) in samples from Tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species. |
ELISA kit for Human PLS1 (Plastin 1) |
ELK4168 |
ELK Biotech |
1 plate of 96 wells |
EUR 432 |
- The microtiter plate provided in this kit has been pre-coated with an antibody specific to Plastin 1 (PLS1). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Plastin 1 (PLS1).
- Show more
|
Description: A sandwich ELISA kit for detection of Plastin 1 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids. |
Pls1 sgRNA CRISPR Lentivector (Rat) (Target 1) |
K7573102 |
ABM |
1.0 ug DNA |
EUR 154 |
Pls1 sgRNA CRISPR Lentivector (Rat) (Target 2) |
K7573103 |
ABM |
1.0 ug DNA |
EUR 154 |
Pls1 sgRNA CRISPR Lentivector (Rat) (Target 3) |
K7573104 |
ABM |
1.0 ug DNA |
EUR 154 |
Pls1 sgRNA CRISPR Lentivector (Mouse) (Target 1) |
K3561202 |
ABM |
1.0 ug DNA |
EUR 154 |
Pls1 sgRNA CRISPR Lentivector (Mouse) (Target 2) |
K3561203 |
ABM |
1.0 ug DNA |
EUR 154 |
Pls1 sgRNA CRISPR Lentivector (Mouse) (Target 3) |
K3561204 |
ABM |
1.0 ug DNA |
EUR 154 |
PLS1 sgRNA CRISPR Lentivector (Human) (Target 1) |
K1670402 |
ABM |
1.0 ug DNA |
EUR 154 |
PLS1 sgRNA CRISPR Lentivector (Human) (Target 2) |
K1670403 |
ABM |
1.0 ug DNA |
EUR 154 |
PLS1 sgRNA CRISPR Lentivector (Human) (Target 3) |
K1670404 |
ABM |
1.0 ug DNA |
EUR 154 |
ELISA kit for Mouse Plastin-1 (PLS1) |
KTE70725-48T |
Abbkine |
48T |
EUR 332 |
- Plastins are a family of actin-binding proteins that are conserved throughout eukaryote evolution and expressed in most tissues of higher eukaryotes. In humans, two ubiquitous plastin isoforms (L and T) have been identified. The protein encoded by th
- Show more
|
Description: Quantitative sandwich ELISA for measuring Mouse Plastin-1 (PLS1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Mouse Plastin-1 (PLS1) |
KTE70725-5platesof96wells |
Abbkine |
5 plates of 96 wells |
EUR 2115 |
- Plastins are a family of actin-binding proteins that are conserved throughout eukaryote evolution and expressed in most tissues of higher eukaryotes. In humans, two ubiquitous plastin isoforms (L and T) have been identified. The protein encoded by th
- Show more
|
Description: Quantitative sandwich ELISA for measuring Mouse Plastin-1 (PLS1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Mouse Plastin-1 (PLS1) |
KTE70725-96T |
Abbkine |
96T |
EUR 539 |
- Plastins are a family of actin-binding proteins that are conserved throughout eukaryote evolution and expressed in most tissues of higher eukaryotes. In humans, two ubiquitous plastin isoforms (L and T) have been identified. The protein encoded by th
- Show more
|
Description: Quantitative sandwich ELISA for measuring Mouse Plastin-1 (PLS1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
PLS1 Protein Vector (Rat) (pPB-C-His) |
PV294738 |
ABM |
500 ng |
EUR 603 |
PLS1 Protein Vector (Rat) (pPB-N-His) |
PV294739 |
ABM |
500 ng |
EUR 603 |
PLS1 Protein Vector (Rat) (pPM-C-HA) |
PV294740 |
ABM |
500 ng |
EUR 603 |
PLS1 Protein Vector (Rat) (pPM-C-His) |
PV294741 |
ABM |
500 ng |
EUR 603 |
PLS1 Protein Vector (Human) (pPB-C-His) |
PV031781 |
ABM |
500 ng |
EUR 329 |
PLS1 Protein Vector (Human) (pPB-N-His) |
PV031782 |
ABM |
500 ng |
EUR 329 |
PLS1 Protein Vector (Human) (pPM-C-HA) |
PV031783 |
ABM |
500 ng |
EUR 329 |
PLS1 Protein Vector (Human) (pPM-C-His) |
PV031784 |
ABM |
500 ng |
EUR 329 |
PLS1 Protein Vector (Mouse) (pPB-C-His) |
PV217290 |
ABM |
500 ng |
EUR 603 |
PLS1 Protein Vector (Mouse) (pPB-N-His) |
PV217291 |
ABM |
500 ng |
EUR 603 |
PLS1 Protein Vector (Mouse) (pPM-C-HA) |
PV217292 |
ABM |
500 ng |
EUR 603 |
PLS1 Protein Vector (Mouse) (pPM-C-His) |
PV217293 |
ABM |
500 ng |
EUR 603 |
Pls1 3'UTR Luciferase Stable Cell Line |
TU116572 |
ABM |
1.0 ml |
Ask for price |
Pls1 3'UTR GFP Stable Cell Line |
TU166572 |
ABM |
1.0 ml |
Ask for price |
Pls1 3'UTR Luciferase Stable Cell Line |
TU216429 |
ABM |
1.0 ml |
Ask for price |
Pls1 3'UTR GFP Stable Cell Line |
TU266429 |
ABM |
1.0 ml |
Ask for price |
PLS1 3'UTR GFP Stable Cell Line |
TU068290 |
ABM |
1.0 ml |
EUR 1521 |
PLS1 3'UTR Luciferase Stable Cell Line |
TU018290 |
ABM |
1.0 ml |
EUR 1521 |
PLS1 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV) |
LV639385 |
ABM |
1.0 ug DNA |
EUR 682 |
PLS1 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC) |
LV639389 |
ABM |
1.0 ug DNA |
EUR 682 |
PLS1 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a) |
LV639390 |
ABM |
1.0 ug DNA |
EUR 682 |
GAPDH Rabbit Polyclonal Antibody |
37985-100ul |
SAB |
100ul |
EUR 252 |
GAPDH Rabbit Polyclonal Antibody |
37985-50ul |
SAB |
50ul |
EUR 187 |
EFHD1 Rabbit Polyclonal Antibody |
38001-100ul |
SAB |
100ul |
EUR 252 |
EFHD1 Rabbit Polyclonal Antibody |
38001-50ul |
SAB |
50ul |
EUR 187 |
Alliinase Rabbit Polyclonal Antibody |
38042-100ul |
SAB |
100ul |
EUR 252 |
Alliinase Rabbit Polyclonal Antibody |
38042-50ul |
SAB |
50ul |
EUR 187 |
ECFP Rabbit Polyclonal Antibody |
38077-100ul |
SAB |
100ul |
EUR 252 |
ECFP Rabbit Polyclonal Antibody |
38077-50ul |
SAB |
50ul |
EUR 187 |
EYFP Rabbit Polyclonal Antibody |
38078-100ul |
SAB |
100ul |
EUR 252 |
EYFP Rabbit Polyclonal Antibody |
38078-50ul |
SAB |
50ul |
EUR 187 |
mOrange Rabbit Polyclonal Antibody |
38079-100ul |
SAB |
100ul |
EUR 252 |
mOrange Rabbit Polyclonal Antibody |
38079-50ul |
SAB |
50ul |
EUR 187 |
mStrawberry Rabbit Polyclonal Antibody |
38083-100ul |
SAB |
100ul |
EUR 252 |
mStrawberry Rabbit Polyclonal Antibody |
38083-50ul |
SAB |
50ul |
EUR 187 |
AmCyan Rabbit Polyclonal Antibody |
38086-100ul |
SAB |
100ul |
EUR 252 |
AmCyan Rabbit Polyclonal Antibody |
38086-50ul |
SAB |
50ul |
EUR 187 |
EBFP Rabbit Polyclonal Antibody |
38087-100ul |
SAB |
100ul |
EUR 252 |
EBFP Rabbit Polyclonal Antibody |
38087-50ul |
SAB |
50ul |
EUR 187 |
Vimentin Rabbit Polyclonal Antibody |
38104-100ul |
SAB |
100ul |
EUR 252 |
Vimentin Rabbit Polyclonal Antibody |
38104-50ul |
SAB |
50ul |
EUR 187 |
LDHD Rabbit Polyclonal Antibody |
38105-100ul |
SAB |
100ul |
EUR 252 |
LDHD Rabbit Polyclonal Antibody |
38105-50ul |
SAB |
50ul |
EUR 187 |
GAPDH Rabbit Polyclonal Antibody |
A01021-005ml |
Abbkine |
0.05ml |
EUR 147 |
- Immunogen information: Recombinant Protein
- Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
- Show more
|
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein |
GAPDH Rabbit Polyclonal Antibody |
A01021-02ml |
Abbkine |
0.2ml |
EUR 332 |
- Immunogen information: Recombinant Protein
- Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
- Show more
|
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein |
PLS1 Rabbit Polyclonal Antibody