PLS3 Rabbit Polyclonal Antibody

PLS3 Polyclonal Antibody
ES10004-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against PLS3 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

Human Plastin-3 (PLS3) ELISA Kit
DLR-PLS3-Hu-48T	DL Develop	48T	EUR 517
Should the Human Plastin-3 (PLS3) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A competitive inhibition quantitative ELISA assay kit for detection of Human Plastin-3 (PLS3) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human Plastin-3 (PLS3) ELISA Kit
DLR-PLS3-Hu-96T	DL Develop	96T	EUR 673
Should the Human Plastin-3 (PLS3) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A competitive inhibition quantitative ELISA assay kit for detection of Human Plastin-3 (PLS3) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human Plastin-3 (PLS3) ELISA Kit
RDR-PLS3-Hu-48Tests	Reddot Biotech	48 Tests	EUR 544

Human Plastin-3 (PLS3) ELISA Kit
RDR-PLS3-Hu-96Tests	Reddot Biotech	96 Tests	EUR 756

Human Plastin-3 (PLS3) ELISA Kit
RD-PLS3-Hu-48Tests	Reddot Biotech	48 Tests	EUR 521

Human Plastin-3 (PLS3) ELISA Kit
RD-PLS3-Hu-96Tests	Reddot Biotech	96 Tests	EUR 723

PLS3 Rabbit pAb
A3627-100ul	Abclonal	100 ul	EUR 308

PLS3 Rabbit pAb
A3627-200ul	Abclonal	200 ul	EUR 459

PLS3 Rabbit pAb
A3627-20ul	Abclonal	20 ul	EUR 183

PLS3 Rabbit pAb
A3627-50ul	Abclonal	50 ul	EUR 223

PLS3 antibody
70R-19357	Fitzgerald	50 ul	EUR 435
Description: Rabbit polyclonal PLS3 antibody

PLS3 Antibody
36696-100ul	SAB	100ul	EUR 252

PLS3 Antibody
1-CSB-PA077979	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against PLS3. Recognizes PLS3 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:5000, WB:1:500-1:2000, IHC:1:50-1:200

PLS3 Antibody
1-CSB-PA018206GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against PLS3. Recognizes PLS3 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

PLS3 Antibody
1-CSB-PA018206LA01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PLS3. Recognizes PLS3 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:500-1:5000, IHC:1:20-1:200, IF:1:50-1:200

PLS3 Antibody
1-CSB-PA241730	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against PLS3. Recognizes PLS3 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:2000, WB:1:500-1:2000, IHC:1:25-1:100

PLS3 antibody
70R-35965	Fitzgerald	100 ug	EUR 349
Description: Rabbit polyclonal PLS3 antibody

Polyclonal PLS3 antibody - middle region
AMM07255G	Leading Biology	0.05mg	EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human PLS3 - middle region. This antibody is tested and proven to work in the following applications:

Plastin 3 (PLS3) Polyclonal Antibody (Human)
4-PAH365Hu02	Cloud-Clone	EUR 247.00 EUR 2510.00 EUR 625.00 EUR 310.00 EUR 214.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PLS3 (Ala379~Val630) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Plastin 3 (PLS3)

Plastin 3 (PLS3) Polyclonal Antibody (Human)
4-PAH365Hu03	Cloud-Clone	EUR 247.00 EUR 2510.00 EUR 625.00 EUR 310.00 EUR 214.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PLS3 (Ile234~Lys475) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human Plastin 3 (PLS3)

[KO Validated] PLS3 Rabbit pAb
A19956-100ul	Abclonal	100 ul	EUR 410

[KO Validated] PLS3 Rabbit pAb
A19956-200ul	Abclonal	200 ul	EUR 571

[KO Validated] PLS3 Rabbit pAb
A19956-20ul	Abclonal	20 ul	EUR 221

[KO Validated] PLS3 Rabbit pAb
A19956-50ul	Abclonal	50 ul	EUR 287

PLS3 Conjugated Antibody
C36696	SAB	100ul	EUR 397

anti- PLS3 antibody
FNab06558	FN Test	100µg	EUR 505.25
Recommended dilution: WB: 1:500 - 1:2000 IHC: 1:50 - 1:200 IF: 1:50 - 1:200 Immunogen: plastin 3 (T isoform) Uniprot ID: P13797 Gene ID: 5358 Research Area: Signal Transduction
Description: Antibody raised against PLS3

anti- PLS3 antibody
FNab06559	FN Test	100µg	EUR 548.75
Immunogen: plastin 3(T isoform) Uniprot ID: P13797 Gene ID: 5358 Research Area: Signal Transduction
Description: Antibody raised against PLS3

Anti-PLS3 antibody
PAab06558	Lifescience Market	100 ug	EUR 355

Anti-PLS3 antibody
PAab06559	Lifescience Market	100 ug	EUR 386

Anti-PLS3 antibody
STJ11100832	St John's Laboratory	100 µl	EUR 413
Description: Plastins are a family of actin-binding proteins that are conserved throughout eukaryote evolution and expressed in most tissues of higher eukaryotes. In humans, two ubiquitous plastin isoforms (L and T) have been identified. Plastin 1 (otherwise known as Fimbrin) is a third distinct plastin isoform which is specifically expressed at high levels in the small intestine. The L isoform is expressed only in hemopoietic cell lineages, while the T isoform has been found in all other normal cells of solid tissues that have replicative potential (fibroblasts, endothelial cells, epithelial cells, melanocytes, etc.). The C-terminal 570 amino acids of the T-plastin and L-plastin proteins are 83% identical. It contains a potential calcium-binding site near the N terminus. Alternate splicing results in multiple transcript variants.

Anti-PLS3 antibody
STJ25032	St John's Laboratory	100 µl	EUR 277
Description: Plastins are a family of actin-binding proteins that are conserved throughout eukaryote evolution and expressed in most tissues of higher eukaryotes. In humans, two ubiquitous plastin isoforms (L and T) have been identified. Plastin 1 (otherwise known as Fimbrin) is a third distinct plastin isoform which is specifically expressed at high levels in the small intestine. The L isoform is expressed only in hemopoietic cell lineages, while the T isoform has been found in all other normal cells of solid tissues that have replicative potential (fibroblasts, endothelial cells, epithelial cells, melanocytes, etc.). The C-terminal 570 amino acids of the T-plastin and L-plastin proteins are 83% identical. It contains a potential calcium-binding site near the N terminus. Alternate splicing results in multiple transcript variants.

Anti-PLS3 antibody
STJ191162	St John's Laboratory	200 µl	EUR 197
Description: Unconjugated Rabbit polyclonal to PLS3

Pls3/ Rat Pls3 ELISA Kit
ELI-16334r	Lifescience Market	96 Tests	EUR 886

Plastin 3 (PLS3) Polyclonal Antibody (Human), APC
4-PAH365Hu02-APC	Cloud-Clone	EUR 345.00 EUR 3275.00 EUR 912.00 EUR 440.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PLS3 (Ala379~Val630) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Plastin 3 (PLS3). This antibody is labeled with APC.

Plastin 3 (PLS3) Polyclonal Antibody (Human), Biotinylated
4-PAH365Hu02-Biotin	Cloud-Clone	EUR 311.00 EUR 2460.00 EUR 727.00 EUR 381.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PLS3 (Ala379~Val630) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Plastin 3 (PLS3). This antibody is labeled with Biotin.

Plastin 3 (PLS3) Polyclonal Antibody (Human), Cy3
4-PAH365Hu02-Cy3	Cloud-Clone	EUR 419.00 EUR 4325.00 EUR 1175.00 EUR 545.00 EUR 251.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PLS3 (Ala379~Val630) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Plastin 3 (PLS3). This antibody is labeled with Cy3.

Plastin 3 (PLS3) Polyclonal Antibody (Human), FITC
4-PAH365Hu02-FITC	Cloud-Clone	EUR 296.00 EUR 2640.00 EUR 750.00 EUR 372.00 EUR 195.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PLS3 (Ala379~Val630) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Plastin 3 (PLS3). This antibody is labeled with FITC.

Plastin 3 (PLS3) Polyclonal Antibody (Human), HRP
4-PAH365Hu02-HRP	Cloud-Clone	EUR 316.00 EUR 2855.00 EUR 807.00 EUR 398.00 EUR 206.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PLS3 (Ala379~Val630) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Plastin 3 (PLS3). This antibody is labeled with HRP.

Plastin 3 (PLS3) Polyclonal Antibody (Human), PE
4-PAH365Hu02-PE	Cloud-Clone	EUR 296.00 EUR 2640.00 EUR 750.00 EUR 372.00 EUR 195.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PLS3 (Ala379~Val630) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Plastin 3 (PLS3). This antibody is labeled with PE.

Plastin 3 (PLS3) Polyclonal Antibody (Human), APC
4-PAH365Hu03-APC	Cloud-Clone	EUR 345.00 EUR 3275.00 EUR 912.00 EUR 440.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PLS3 (Ile234~Lys475) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human Plastin 3 (PLS3). This antibody is labeled with APC.

Plastin 3 (PLS3) Polyclonal Antibody (Human), Biotinylated
4-PAH365Hu03-Biotin	Cloud-Clone	EUR 311.00 EUR 2460.00 EUR 727.00 EUR 381.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PLS3 (Ile234~Lys475) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human Plastin 3 (PLS3). This antibody is labeled with Biotin.

Plastin 3 (PLS3) Polyclonal Antibody (Human), Cy3
4-PAH365Hu03-Cy3	Cloud-Clone	EUR 419.00 EUR 4325.00 EUR 1175.00 EUR 545.00 EUR 251.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PLS3 (Ile234~Lys475) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human Plastin 3 (PLS3). This antibody is labeled with Cy3.

Plastin 3 (PLS3) Polyclonal Antibody (Human), FITC
4-PAH365Hu03-FITC	Cloud-Clone	EUR 296.00 EUR 2640.00 EUR 750.00 EUR 372.00 EUR 195.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PLS3 (Ile234~Lys475) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human Plastin 3 (PLS3). This antibody is labeled with FITC.

Plastin 3 (PLS3) Polyclonal Antibody (Human), HRP
4-PAH365Hu03-HRP	Cloud-Clone	EUR 316.00 EUR 2855.00 EUR 807.00 EUR 398.00 EUR 206.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PLS3 (Ile234~Lys475) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human Plastin 3 (PLS3). This antibody is labeled with HRP.

Plastin 3 (PLS3) Polyclonal Antibody (Human), PE
4-PAH365Hu03-PE	Cloud-Clone	EUR 296.00 EUR 2640.00 EUR 750.00 EUR 372.00 EUR 195.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PLS3 (Ile234~Lys475) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human Plastin 3 (PLS3). This antibody is labeled with PE.

Plastin 3 (PLS3) Polyclonal Antibody (Human, Mouse)
4-PAH365Mu01	Cloud-Clone	EUR 251.00 EUR 2576.00 EUR 640.00 EUR 316.00 EUR 215.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PLS3 (Ala5~Leu251) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Plastin 3 (PLS3)

PLS3 siRNA
20-abx928988	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

PLS3 siRNA
20-abx928989	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

PLS3 Antibody, HRP conjugated
1-CSB-PA018206LB01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PLS3. Recognizes PLS3 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

PLS3 Antibody, FITC conjugated
1-CSB-PA018206LC01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PLS3. Recognizes PLS3 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

PLS3 Antibody, Biotin conjugated
1-CSB-PA018206LD01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PLS3. Recognizes PLS3 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Plastin 3 (PLS3) Antibody
20-abx214414	Abbexa	EUR 411.00 EUR 300.00	100 ul 50 ul
Shipped within 5-10 working days.

Plastin 3 (PLS3) Antibody
20-abx100393	Abbexa	EUR 425.00 EUR 133.00 EUR 1205.00 EUR 578.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Plastin 3 (PLS3) Antibody
20-abx100394	Abbexa	EUR 425.00 EUR 133.00 EUR 1205.00 EUR 578.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-12 working days.

Plastin 3 (PLS3) Antibody
20-abx100395	Abbexa	EUR 439.00 EUR 133.00 EUR 1233.00 EUR 592.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Plastin-3 (PLS3) Antibody
20-abx116894	Abbexa	EUR 732.00 EUR 398.00	150 ul 50 ul
Shipped within 5-10 working days.

Plastin-3 (PLS3) Antibody
abx036842-100ug	Abbexa	100 ug	EUR 391
Shipped within 5-10 working days.

Plastin 3 (PLS3) Antibody
20-abx128645	Abbexa	EUR 425.00 EUR 133.00 EUR 1205.00 EUR 578.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Plastin 3 (PLS3) Antibody
20-abx242170	Abbexa	EUR 411.00 EUR 300.00	100 ul 50 ul
Shipped within 5-10 working days.

Plastin-3 (PLS3) Antibody
abx236558-100ug	Abbexa	100 ug	EUR 481
Shipped within 5-12 working days.

Plastin-3 (PLS3) Antibody
abx236559-100ug	Abbexa	100 ug	EUR 509
Shipped within 5-12 working days.

Plastin-3 (PLS3) Antibody
20-abx318274	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Plastin-3 (PLS3) Antibody
20-abx002619	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

Plastin 3 (PLS3) Polyclonal Antibody (Human, Mouse, Pig)
4-PAH365Hu01	Cloud-Clone	EUR 247.00 EUR 2510.00 EUR 625.00 EUR 310.00 EUR 214.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PLS3 (Ala379~Val630) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse, Pig Plastin 3 (PLS3)

Plastin 3 (PLS3) Polyclonal Antibody (Human), APC-Cy7
4-PAH365Hu02-APC-Cy7	Cloud-Clone	EUR 571.00 EUR 6430.00 EUR 1705.00 EUR 760.00 EUR 319.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PLS3 (Ala379~Val630) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Plastin 3 (PLS3). This antibody is labeled with APC-Cy7.

Plastin 3 (PLS3) Polyclonal Antibody (Human), APC-Cy7
4-PAH365Hu03-APC-Cy7	Cloud-Clone	EUR 571.00 EUR 6430.00 EUR 1705.00 EUR 760.00 EUR 319.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PLS3 (Ile234~Lys475) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human Plastin 3 (PLS3). This antibody is labeled with APC-Cy7.

Plastin 3 (PLS3) Polyclonal Antibody (Human, Mouse), APC
4-PAH365Mu01-APC	Cloud-Clone	EUR 351.00 EUR 3365.00 EUR 935.00 EUR 449.00 EUR 222.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PLS3 (Ala5~Leu251) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Plastin 3 (PLS3). This antibody is labeled with APC.

Plastin 3 (PLS3) Polyclonal Antibody (Human, Mouse), Biotinylated
4-PAH365Mu01-Biotin	Cloud-Clone	EUR 316.00 EUR 2526.00 EUR 744.00 EUR 387.00 EUR 221.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PLS3 (Ala5~Leu251) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Plastin 3 (PLS3). This antibody is labeled with Biotin.

Plastin 3 (PLS3) Polyclonal Antibody (Human, Mouse), Cy3
4-PAH365Mu01-Cy3	Cloud-Clone	EUR 427.00 EUR 4445.00 EUR 1205.00 EUR 557.00 EUR 254.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PLS3 (Ala5~Leu251) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Plastin 3 (PLS3). This antibody is labeled with Cy3.

Plastin 3 (PLS3) Polyclonal Antibody (Human, Mouse), FITC
4-PAH365Mu01-FITC	Cloud-Clone	EUR 301.00 EUR 2712.00 EUR 768.00 EUR 379.00 EUR 197.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PLS3 (Ala5~Leu251) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Plastin 3 (PLS3). This antibody is labeled with FITC.

Plastin 3 (PLS3) Polyclonal Antibody (Human, Mouse), HRP
4-PAH365Mu01-HRP	Cloud-Clone	EUR 321.00 EUR 2933.00 EUR 827.00 EUR 405.00 EUR 209.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PLS3 (Ala5~Leu251) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Plastin 3 (PLS3). This antibody is labeled with HRP.

Plastin 3 (PLS3) Polyclonal Antibody (Human, Mouse), PE
4-PAH365Mu01-PE	Cloud-Clone	EUR 301.00 EUR 2712.00 EUR 768.00 EUR 379.00 EUR 197.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PLS3 (Ala5~Leu251) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Plastin 3 (PLS3). This antibody is labeled with PE.

PLS3 cloning plasmid
CSB-CL018206HU-10ug	Cusabio	10ug	EUR 376
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1893 Sequence: atggatgagatggctaccactcagatttccaaagatgagcttgatgaactcaaagaggcctttgcaaaagttgatctcaacagcaacggattcatttgtgactatgaacttcatgagctcttcaaggaagctaatatgccattaccaggatataaagtgagagaaattattcaga Show more
Description: A cloning plasmid for the PLS3 gene.

Recombinant human PLS3
P1108	FN Test	100ug	Ask for price
Uniprot ID: Q9NRY6 Reconstitution: Metal affinity chromatography on Fn Super Capacity Column (Nickel)
Description: Recombinant protein for human PLS3

Anti-PLS3 (5B9)
YF-MA20392	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to PLS3

Plastin 3 (PLS3) Antibody (FITC)
20-abx271102	Abbexa	EUR 481.00 EUR 244.00 EUR 1414.00 EUR 662.00 EUR 356.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-15 working days.

Plastin 3 (PLS3) Antibody (Biotin)
20-abx271368	Abbexa	EUR 453.00 EUR 244.00 EUR 1316.00 EUR 620.00 EUR 342.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-15 working days.

Plastin-3 (PLS3) Antibody (HRP)
20-abx317102	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Plastin-3 (PLS3) Antibody (FITC)
20-abx317103	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Plastin-3 (PLS3) Antibody (Biotin)
20-abx317104	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Plastin 3 (PLS3) Polyclonal Antibody (Human, Mouse, Pig), APC
4-PAH365Hu01-APC	Cloud-Clone	EUR 345.00 EUR 3275.00 EUR 912.00 EUR 440.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PLS3 (Ala379~Val630) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse, Pig Plastin 3 (PLS3). This antibody is labeled with APC.

Plastin 3 (PLS3) Polyclonal Antibody (Human, Mouse, Pig), Biotinylated
4-PAH365Hu01-Biotin	Cloud-Clone	EUR 311.00 EUR 2460.00 EUR 727.00 EUR 381.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PLS3 (Ala379~Val630) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse, Pig Plastin 3 (PLS3). This antibody is labeled with Biotin.

Plastin 3 (PLS3) Polyclonal Antibody (Human, Mouse, Pig), Cy3
4-PAH365Hu01-Cy3	Cloud-Clone	EUR 419.00 EUR 4325.00 EUR 1175.00 EUR 545.00 EUR 251.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PLS3 (Ala379~Val630) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse, Pig Plastin 3 (PLS3). This antibody is labeled with Cy3.

Plastin 3 (PLS3) Polyclonal Antibody (Human, Mouse, Pig), FITC
4-PAH365Hu01-FITC	Cloud-Clone	EUR 296.00 EUR 2640.00 EUR 750.00 EUR 372.00 EUR 195.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PLS3 (Ala379~Val630) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse, Pig Plastin 3 (PLS3). This antibody is labeled with FITC.

Plastin 3 (PLS3) Polyclonal Antibody (Human, Mouse, Pig), HRP
4-PAH365Hu01-HRP	Cloud-Clone	EUR 316.00 EUR 2855.00 EUR 807.00 EUR 398.00 EUR 206.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PLS3 (Ala379~Val630) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse, Pig Plastin 3 (PLS3). This antibody is labeled with HRP.

Plastin 3 (PLS3) Polyclonal Antibody (Human, Mouse, Pig), PE
4-PAH365Hu01-PE	Cloud-Clone	EUR 296.00 EUR 2640.00 EUR 750.00 EUR 372.00 EUR 195.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PLS3 (Ala379~Val630) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse, Pig Plastin 3 (PLS3). This antibody is labeled with PE.

Plastin 3 (PLS3) Polyclonal Antibody (Human, Mouse), APC-Cy7
4-PAH365Mu01-APC-Cy7	Cloud-Clone	EUR 583.00 EUR 6610.00 EUR 1750.00 EUR 778.00 EUR 324.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PLS3 (Ala5~Leu251) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Plastin 3 (PLS3). This antibody is labeled with APC-Cy7.

Plastin 3 (PLS3) Polyclonal Antibody (Human, Mouse, Pig), APC-Cy7
4-PAH365Hu01-APC-Cy7	Cloud-Clone	EUR 571.00 EUR 6430.00 EUR 1705.00 EUR 760.00 EUR 319.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PLS3 (Ala379~Val630) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse, Pig Plastin 3 (PLS3). This antibody is labeled with APC-Cy7.

PLS3 ELISA KIT|Human
EF001871	Lifescience Market	96 Tests	EUR 689

Human PLS3 shRNA Plasmid
20-abx953596	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Mouse PLS3 shRNA Plasmid
20-abx979562	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Recombinant Plastin 3 (PLS3)
4-RPH365Hu01	Cloud-Clone	EUR 508.58 EUR 239.00 EUR 1632.16 EUR 610.72 EUR 1121.44 EUR 403.00 EUR 3930.40	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: P13797 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 29.8kDa Isoelectric Point: Inquire
Description: Recombinant Human Plastin 3 expressed in: E.coli

Recombinant Plastin 3 (PLS3)
4-RPH365Hu02	Cloud-Clone	EUR 508.58 EUR 239.00 EUR 1632.16 EUR 610.72 EUR 1121.44 EUR 403.00 EUR 3930.40	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: P13797 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 55.4kDa Isoelectric Point: Inquire
Description: Recombinant Human Plastin 3 expressed in: E.coli

Recombinant Plastin 3 (PLS3)
4-RPH365Hu03	Cloud-Clone	EUR 508.58 EUR 239.00 EUR 1632.16 EUR 610.72 EUR 1121.44 EUR 403.00 EUR 3930.40	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: P13797 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 29.1kDa Isoelectric Point: Inquire
Description: Recombinant Human Plastin 3 expressed in: E.coli

Recombinant Plastin 3 (PLS3)
4-RPH365Mu01	Cloud-Clone	EUR 530.08 EUR 245.00 EUR 1712.80 EUR 637.60 EUR 1175.20 EUR 418.00 EUR 4132.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: Q99K51 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 29.2kDa Isoelectric Point: Inquire
Description: Recombinant Mouse Plastin 3 expressed in: E.coli

PLS3 Recombinant Protein (Human)
RP023839	ABM	100 ug	Ask for price

PLS3 Recombinant Protein (Mouse)
RP162968	ABM	100 ug	Ask for price

PLS3 Recombinant Protein (Mouse)
RP162971	ABM	100 ug	Ask for price

PLS3 Recombinant Protein (Mouse)
RP162974	ABM	100 ug	Ask for price

PLS3 Recombinant Protein (Rat)
RP221054	ABM	100 ug	Ask for price

Human Plastin 3 (PLS3) Protein
20-abx068574	Abbexa	EUR 704.00 EUR 286.00 EUR 2193.00 EUR 843.00 EUR 509.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Human Plastin 3 (PLS3) Protein
20-abx068575	Abbexa	EUR 704.00 EUR 286.00 EUR 2193.00 EUR 843.00 EUR 509.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-12 working days.

Human Plastin 3 (PLS3) Protein
20-abx068576	Abbexa	EUR 704.00 EUR 286.00 EUR 2193.00 EUR 843.00 EUR 509.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-12 working days.

Mouse Plastin 3 (PLS3) Protein
20-abx068577	Abbexa	EUR 732.00 EUR 286.00 EUR 2305.00 EUR 885.00 EUR 523.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-12 working days.

Pls3 ORF Vector (Rat) (pORF)
ORF073686	ABM	1.0 ug DNA	EUR 506

PLS3 ORF Vector (Human) (pORF)
ORF007947	ABM	1.0 ug DNA	EUR 95

Pls3 ORF Vector (Mouse) (pORF)
ORF054324	ABM	1.0 ug DNA	EUR 506

Pls3 ORF Vector (Mouse) (pORF)
ORF054325	ABM	1.0 ug DNA	EUR 506

Pls3 ORF Vector (Mouse) (pORF)
ORF054326	ABM	1.0 ug DNA	EUR 506

PLS3 ELISA Kit (Human) (OKEH07922)
OKEH07922	Aviva Systems Biology	96 Wells	EUR 896
Description: Description of target: Plastins are a family of actin-binding proteins that are conserved throughout eukaryote evolution and expressed in most tissues of higher eukaryotes. In humans, two ubiquitous plastin isoforms (L and T) have been identified. Plastin 1 (otherwise known as Fimbrin) is a third distinct plastin isoform which is specifically expressed at high levels in the small intestine. The L isoform is expressed only in hemopoietic cell lineages, while the T isoform has been found in all other normal cells of solid tissues that have replicative potential (fibroblasts, endothelial cells, epithelial cells, melanocytes, etc.). The C-terminal 570 amino acids of the T-plastin and L-plastin proteins are 83% (n = 20) identical. It contains a potential calcium-binding site near the N terminus. Alternate splicing results in multiple transcript variants.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 39.6pg/mL

Human Plastin- 3, PLS3 ELISA KIT
ELI-19687h	Lifescience Market	96 Tests	EUR 824

Mouse Plastin- 3, Pls3 ELISA KIT
ELI-45233m	Lifescience Market	96 Tests	EUR 865

Bovine Plastin- 3, PLS3 ELISA KIT
ELI-45345b	Lifescience Market	96 Tests	EUR 928

Human Plastin-3 (PLS3) ELISA Kit
20-abx382302	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-12 working days.

Pls3 sgRNA CRISPR Lentivector set (Rat)
K7577901	ABM	3 x 1.0 ug	EUR 339

Pls3 sgRNA CRISPR Lentivector set (Mouse)
K4550201	ABM	3 x 1.0 ug	EUR 339

PLS3 sgRNA CRISPR Lentivector set (Human)
K1670501	ABM	3 x 1.0 ug	EUR 339

Human Plastin 3(PLS3)ELISA Kit
QY-E01395	Qayee Biotechnology	96T	EUR 361

Pls3 sgRNA CRISPR Lentivector (Rat) (Target 1)
K7577902	ABM	1.0 ug DNA	EUR 154

Pls3 sgRNA CRISPR Lentivector (Rat) (Target 2)
K7577903	ABM	1.0 ug DNA	EUR 154

Pls3 sgRNA CRISPR Lentivector (Rat) (Target 3)
K7577904	ABM	1.0 ug DNA	EUR 154

Pls3 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4550202	ABM	1.0 ug DNA	EUR 154

Pls3 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4550203	ABM	1.0 ug DNA	EUR 154

Pls3 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4550204	ABM	1.0 ug DNA	EUR 154

PLS3 sgRNA CRISPR Lentivector (Human) (Target 1)
K1670502	ABM	1.0 ug DNA	EUR 154

PLS3 sgRNA CRISPR Lentivector (Human) (Target 2)
K1670503	ABM	1.0 ug DNA	EUR 154

PLS3 sgRNA CRISPR Lentivector (Human) (Target 3)
K1670504	ABM	1.0 ug DNA	EUR 154

PLS3 Protein Vector (Rat) (pPB-C-His)
PV294742	ABM	500 ng	EUR 603

PLS3 Protein Vector (Rat) (pPB-N-His)
PV294743	ABM	500 ng	EUR 603

PLS3 Protein Vector (Rat) (pPM-C-HA)
PV294744	ABM	500 ng	EUR 603

PLS3 Protein Vector (Rat) (pPM-C-His)
PV294745	ABM	500 ng	EUR 603

PLS3 Protein Vector (Human) (pPB-C-His)
PV031785	ABM	500 ng	EUR 329

PLS3 Rabbit Polyclonal Antibody