Biocat Net

Amine biocat 3.0

PLS3 Rabbit Polyclonal Antibody

PLS3 Polyclonal Antibody

ABP59947-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human PLS3 protein at amino acid sequence of 180-260
  • Applications tips:
Description: A polyclonal antibody for detection of PLS3 from Human, Mouse, Rat. This PLS3 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PLS3 protein at amino acid sequence of 180-260

Human Plastin-3 (PLS3) ELISA Kit

DLR-PLS3-Hu-48T 48T
EUR 517
  • Should the Human Plastin-3 (PLS3) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A competitive inhibition quantitative ELISA assay kit for detection of Human Plastin-3 (PLS3) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human Plastin-3 (PLS3) ELISA Kit

DLR-PLS3-Hu-96T 96T
EUR 673
  • Should the Human Plastin-3 (PLS3) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A competitive inhibition quantitative ELISA assay kit for detection of Human Plastin-3 (PLS3) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human Plastin-3 (PLS3) ELISA Kit

RD-PLS3-Hu-48Tests 48 Tests
EUR 521

Human Plastin-3 (PLS3) ELISA Kit

RD-PLS3-Hu-96Tests 96 Tests
EUR 723

Human Plastin-3 (PLS3) ELISA Kit

RDR-PLS3-Hu-48Tests 48 Tests
EUR 544

Human Plastin-3 (PLS3) ELISA Kit

RDR-PLS3-Hu-96Tests 96 Tests
EUR 756

PLS3 Rabbit pAb

A3627-100ul 100 ul
EUR 308

PLS3 Rabbit pAb

A3627-200ul 200 ul
EUR 459

PLS3 Rabbit pAb

A3627-20ul 20 ul
EUR 183

PLS3 Rabbit pAb

A3627-50ul 50 ul
EUR 223

PLS3 antibody

70R-35965 100 ug
EUR 349
Description: Rabbit polyclonal PLS3 antibody

PLS3 Antibody

36696-100ul 100ul
EUR 252

PLS3 antibody

70R-19357 50 ul
EUR 435
Description: Rabbit polyclonal PLS3 antibody

PLS3 Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against PLS3. Recognizes PLS3 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:2000, WB:1:500-1:2000, IHC:1:25-1:100

PLS3 Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against PLS3. Recognizes PLS3 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:5000, WB:1:500-1:2000, IHC:1:50-1:200

PLS3 Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against PLS3. Recognizes PLS3 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

PLS3 Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PLS3. Recognizes PLS3 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:500-1:5000, IHC:1:20-1:200, IF:1:50-1:200

Polyclonal PLS3 antibody - middle region

AMM07255G 0.05mg
EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human PLS3 - middle region. This antibody is tested and proven to work in the following applications:

Plastin 3 (PLS3) Polyclonal Antibody (Human)

  • EUR 247.00
  • EUR 2510.00
  • EUR 625.00
  • EUR 310.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PLS3 (Ala379~Val630)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Plastin 3 (PLS3)

Plastin 3 (PLS3) Polyclonal Antibody (Human)

  • EUR 247.00
  • EUR 2510.00
  • EUR 625.00
  • EUR 310.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PLS3 (Ile234~Lys475)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human Plastin 3 (PLS3)

[KO Validated] PLS3 Rabbit pAb

A19956-100ul 100 ul
EUR 410

[KO Validated] PLS3 Rabbit pAb

A19956-200ul 200 ul
EUR 571

[KO Validated] PLS3 Rabbit pAb

A19956-20ul 20 ul
EUR 221

[KO Validated] PLS3 Rabbit pAb

A19956-50ul 50 ul
EUR 287

PLS3 Conjugated Antibody

C36696 100ul
EUR 397

anti- PLS3 antibody

FNab06558 100µg
EUR 505.25
  • Recommended dilution: WB: 1:500 - 1:2000
  • IHC: 1:50 - 1:200
  • IF: 1:50 - 1:200
  • Immunogen: plastin 3 (T isoform)
  • Uniprot ID: P13797
  • Gene ID: 5358
  • Research Area: Signal Transduction
Description: Antibody raised against PLS3

anti- PLS3 antibody

FNab06559 100µg
EUR 548.75
  • Immunogen: plastin 3(T isoform)
  • Uniprot ID: P13797
  • Gene ID: 5358
  • Research Area: Signal Transduction
Description: Antibody raised against PLS3

Anti-PLS3 antibody

PAab06558 100 ug
EUR 355

Anti-PLS3 antibody

PAab06559 100 ug
EUR 386

Anti-PLS3 antibody

STJ11100832 100 µl
EUR 413
Description: Plastins are a family of actin-binding proteins that are conserved throughout eukaryote evolution and expressed in most tissues of higher eukaryotes. In humans, two ubiquitous plastin isoforms (L and T) have been identified. Plastin 1 (otherwise known as Fimbrin) is a third distinct plastin isoform which is specifically expressed at high levels in the small intestine. The L isoform is expressed only in hemopoietic cell lineages, while the T isoform has been found in all other normal cells of solid tissues that have replicative potential (fibroblasts, endothelial cells, epithelial cells, melanocytes, etc.). The C-terminal 570 amino acids of the T-plastin and L-plastin proteins are 83% identical. It contains a potential calcium-binding site near the N terminus. Alternate splicing results in multiple transcript variants.

Anti-PLS3 antibody

STJ25032 100 µl
EUR 277
Description: Plastins are a family of actin-binding proteins that are conserved throughout eukaryote evolution and expressed in most tissues of higher eukaryotes. In humans, two ubiquitous plastin isoforms (L and T) have been identified. Plastin 1 (otherwise known as Fimbrin) is a third distinct plastin isoform which is specifically expressed at high levels in the small intestine. The L isoform is expressed only in hemopoietic cell lineages, while the T isoform has been found in all other normal cells of solid tissues that have replicative potential (fibroblasts, endothelial cells, epithelial cells, melanocytes, etc.). The C-terminal 570 amino acids of the T-plastin and L-plastin proteins are 83% identical. It contains a potential calcium-binding site near the N terminus. Alternate splicing results in multiple transcript variants.

Anti-PLS3 antibody

STJ191162 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to PLS3

Pls3/ Rat Pls3 ELISA Kit

ELI-16334r 96 Tests
EUR 886

Plastin 3 (PLS3) Polyclonal Antibody (Human), APC

  • EUR 345.00
  • EUR 3275.00
  • EUR 912.00
  • EUR 440.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PLS3 (Ala379~Val630)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Plastin 3 (PLS3). This antibody is labeled with APC.

Plastin 3 (PLS3) Polyclonal Antibody (Human), Biotinylated

  • EUR 311.00
  • EUR 2460.00
  • EUR 727.00
  • EUR 381.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PLS3 (Ala379~Val630)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Plastin 3 (PLS3). This antibody is labeled with Biotin.

Plastin 3 (PLS3) Polyclonal Antibody (Human), Cy3

  • EUR 419.00
  • EUR 4325.00
  • EUR 1175.00
  • EUR 545.00
  • EUR 251.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PLS3 (Ala379~Val630)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Plastin 3 (PLS3). This antibody is labeled with Cy3.

Plastin 3 (PLS3) Polyclonal Antibody (Human), FITC

  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PLS3 (Ala379~Val630)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Plastin 3 (PLS3). This antibody is labeled with FITC.

Plastin 3 (PLS3) Polyclonal Antibody (Human), HRP

  • EUR 316.00
  • EUR 2855.00
  • EUR 807.00
  • EUR 398.00
  • EUR 206.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PLS3 (Ala379~Val630)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Plastin 3 (PLS3). This antibody is labeled with HRP.

Plastin 3 (PLS3) Polyclonal Antibody (Human), PE

  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PLS3 (Ala379~Val630)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Plastin 3 (PLS3). This antibody is labeled with PE.

Plastin 3 (PLS3) Polyclonal Antibody (Human), APC

  • EUR 345.00
  • EUR 3275.00
  • EUR 912.00
  • EUR 440.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PLS3 (Ile234~Lys475)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human Plastin 3 (PLS3). This antibody is labeled with APC.

Plastin 3 (PLS3) Polyclonal Antibody (Human), Biotinylated

  • EUR 311.00
  • EUR 2460.00
  • EUR 727.00
  • EUR 381.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PLS3 (Ile234~Lys475)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human Plastin 3 (PLS3). This antibody is labeled with Biotin.

Plastin 3 (PLS3) Polyclonal Antibody (Human), Cy3

  • EUR 419.00
  • EUR 4325.00
  • EUR 1175.00
  • EUR 545.00
  • EUR 251.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PLS3 (Ile234~Lys475)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human Plastin 3 (PLS3). This antibody is labeled with Cy3.

Plastin 3 (PLS3) Polyclonal Antibody (Human), FITC

  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PLS3 (Ile234~Lys475)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human Plastin 3 (PLS3). This antibody is labeled with FITC.

Plastin 3 (PLS3) Polyclonal Antibody (Human), HRP

  • EUR 316.00
  • EUR 2855.00
  • EUR 807.00
  • EUR 398.00
  • EUR 206.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PLS3 (Ile234~Lys475)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human Plastin 3 (PLS3). This antibody is labeled with HRP.

Plastin 3 (PLS3) Polyclonal Antibody (Human), PE

  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PLS3 (Ile234~Lys475)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human Plastin 3 (PLS3). This antibody is labeled with PE.

Plastin 3 (PLS3) Polyclonal Antibody (Human, Mouse)

  • EUR 251.00
  • EUR 2576.00
  • EUR 640.00
  • EUR 316.00
  • EUR 215.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PLS3 (Ala5~Leu251)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Plastin 3 (PLS3)


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

Plastin-3 (PLS3) Antibody

  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Plastin 3 (PLS3) Antibody

  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Plastin-3 (PLS3) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Plastin-3 (PLS3) Antibody

abx036842-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Plastin 3 (PLS3) Antibody

  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Plastin 3 (PLS3) Antibody

  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-12 working days.

Plastin 3 (PLS3) Antibody

  • EUR 439.00
  • EUR 133.00
  • EUR 1233.00
  • EUR 592.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Plastin 3 (PLS3) Antibody

  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Plastin-3 (PLS3) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Plastin 3 (PLS3) Antibody

  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Plastin-3 (PLS3) Antibody

abx236558-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

Plastin-3 (PLS3) Antibody

abx236559-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

PLS3 Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PLS3. Recognizes PLS3 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

PLS3 Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PLS3. Recognizes PLS3 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

PLS3 Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PLS3. Recognizes PLS3 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Plastin 3 (PLS3) Polyclonal Antibody (Human, Mouse, Pig)

  • EUR 247.00
  • EUR 2510.00
  • EUR 625.00
  • EUR 310.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PLS3 (Ala379~Val630)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse, Pig Plastin 3 (PLS3)

Plastin 3 (PLS3) Polyclonal Antibody (Human), APC-Cy7

  • EUR 571.00
  • EUR 6430.00
  • EUR 1705.00
  • EUR 760.00
  • EUR 319.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PLS3 (Ala379~Val630)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Plastin 3 (PLS3). This antibody is labeled with APC-Cy7.

Plastin 3 (PLS3) Polyclonal Antibody (Human), APC-Cy7

  • EUR 571.00
  • EUR 6430.00
  • EUR 1705.00
  • EUR 760.00
  • EUR 319.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PLS3 (Ile234~Lys475)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human Plastin 3 (PLS3). This antibody is labeled with APC-Cy7.

Plastin 3 (PLS3) Polyclonal Antibody (Human, Mouse), APC

  • EUR 351.00
  • EUR 3365.00
  • EUR 935.00
  • EUR 449.00
  • EUR 222.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PLS3 (Ala5~Leu251)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Plastin 3 (PLS3). This antibody is labeled with APC.

Plastin 3 (PLS3) Polyclonal Antibody (Human, Mouse), Biotinylated

  • EUR 316.00
  • EUR 2526.00
  • EUR 744.00
  • EUR 387.00
  • EUR 221.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PLS3 (Ala5~Leu251)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Plastin 3 (PLS3). This antibody is labeled with Biotin.

Plastin 3 (PLS3) Polyclonal Antibody (Human, Mouse), Cy3

  • EUR 427.00
  • EUR 4445.00
  • EUR 1205.00
  • EUR 557.00
  • EUR 254.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PLS3 (Ala5~Leu251)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Plastin 3 (PLS3). This antibody is labeled with Cy3.

Plastin 3 (PLS3) Polyclonal Antibody (Human, Mouse), FITC

  • EUR 301.00
  • EUR 2712.00
  • EUR 768.00
  • EUR 379.00
  • EUR 197.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PLS3 (Ala5~Leu251)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Plastin 3 (PLS3). This antibody is labeled with FITC.

Plastin 3 (PLS3) Polyclonal Antibody (Human, Mouse), HRP

  • EUR 321.00
  • EUR 2933.00
  • EUR 827.00
  • EUR 405.00
  • EUR 209.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PLS3 (Ala5~Leu251)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Plastin 3 (PLS3). This antibody is labeled with HRP.

Plastin 3 (PLS3) Polyclonal Antibody (Human, Mouse), PE

  • EUR 301.00
  • EUR 2712.00
  • EUR 768.00
  • EUR 379.00
  • EUR 197.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PLS3 (Ala5~Leu251)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Plastin 3 (PLS3). This antibody is labeled with PE.

PLS3 cloning plasmid

CSB-CL018206HU-10ug 10ug
EUR 376
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1893
  • Sequence: atggatgagatggctaccactcagatttccaaagatgagcttgatgaactcaaagaggcctttgcaaaagttgatctcaacagcaacggattcatttgtgactatgaacttcatgagctcttcaaggaagctaatatgccattaccaggatataaagtgagagaaattattcaga
  • Show more
Description: A cloning plasmid for the PLS3 gene.

Recombinant human PLS3

P1108 100ug Ask for price
  • Uniprot ID: Q9NRY6
  • Reconstitution: Metal affinity chromatography on Fn Super Capacity Column (Nickel)
Description: Recombinant protein for human PLS3

Anti-PLS3 (5B9)

YF-MA20392 100 ug
EUR 363
Description: Mouse monoclonal to PLS3

Plastin-3 (PLS3) Antibody (HRP)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Plastin-3 (PLS3) Antibody (FITC)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Plastin-3 (PLS3) Antibody (Biotin)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Plastin 3 (PLS3) Antibody (FITC)

  • EUR 481.00
  • EUR 244.00
  • EUR 1414.00
  • EUR 662.00
  • EUR 356.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Plastin 3 (PLS3) Antibody (Biotin)

  • EUR 453.00
  • EUR 244.00
  • EUR 1316.00
  • EUR 620.00
  • EUR 342.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Plastin 3 (PLS3) Polyclonal Antibody (Human, Mouse, Pig), APC

  • EUR 345.00
  • EUR 3275.00
  • EUR 912.00
  • EUR 440.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PLS3 (Ala379~Val630)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse, Pig Plastin 3 (PLS3). This antibody is labeled with APC.

Plastin 3 (PLS3) Polyclonal Antibody (Human, Mouse, Pig), Biotinylated

  • EUR 311.00
  • EUR 2460.00
  • EUR 727.00
  • EUR 381.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PLS3 (Ala379~Val630)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse, Pig Plastin 3 (PLS3). This antibody is labeled with Biotin.

Plastin 3 (PLS3) Polyclonal Antibody (Human, Mouse, Pig), Cy3

  • EUR 419.00
  • EUR 4325.00
  • EUR 1175.00
  • EUR 545.00
  • EUR 251.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PLS3 (Ala379~Val630)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse, Pig Plastin 3 (PLS3). This antibody is labeled with Cy3.

Plastin 3 (PLS3) Polyclonal Antibody (Human, Mouse, Pig), FITC

  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PLS3 (Ala379~Val630)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse, Pig Plastin 3 (PLS3). This antibody is labeled with FITC.

Plastin 3 (PLS3) Polyclonal Antibody (Human, Mouse, Pig), HRP

  • EUR 316.00
  • EUR 2855.00
  • EUR 807.00
  • EUR 398.00
  • EUR 206.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PLS3 (Ala379~Val630)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse, Pig Plastin 3 (PLS3). This antibody is labeled with HRP.

Plastin 3 (PLS3) Polyclonal Antibody (Human, Mouse, Pig), PE

  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PLS3 (Ala379~Val630)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse, Pig Plastin 3 (PLS3). This antibody is labeled with PE.

Plastin 3 (PLS3) Polyclonal Antibody (Human, Mouse), APC-Cy7

  • EUR 583.00
  • EUR 6610.00
  • EUR 1750.00
  • EUR 778.00
  • EUR 324.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PLS3 (Ala5~Leu251)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Plastin 3 (PLS3). This antibody is labeled with APC-Cy7.

Plastin 3 (PLS3) Polyclonal Antibody (Human, Mouse, Pig), APC-Cy7

  • EUR 571.00
  • EUR 6430.00
  • EUR 1705.00
  • EUR 760.00
  • EUR 319.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PLS3 (Ala379~Val630)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse, Pig Plastin 3 (PLS3). This antibody is labeled with APC-Cy7.

Mouse PLS3 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.


EF001871 96 Tests
EUR 689

Human PLS3 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Recombinant Plastin 3 (PLS3)

  • EUR 508.58
  • EUR 239.00
  • EUR 1632.16
  • EUR 610.72
  • EUR 1121.44
  • EUR 403.00
  • EUR 3930.40
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P13797
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 29.8kDa
  • Isoelectric Point: Inquire
Description: Recombinant Human Plastin 3 expressed in: E.coli

Recombinant Plastin 3 (PLS3)

  • EUR 508.58
  • EUR 239.00
  • EUR 1632.16
  • EUR 610.72
  • EUR 1121.44
  • EUR 403.00
  • EUR 3930.40
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P13797
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 55.4kDa
  • Isoelectric Point: Inquire
Description: Recombinant Human Plastin 3 expressed in: E.coli

Recombinant Plastin 3 (PLS3)

  • EUR 508.58
  • EUR 239.00
  • EUR 1632.16
  • EUR 610.72
  • EUR 1121.44
  • EUR 403.00
  • EUR 3930.40
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P13797
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 29.1kDa
  • Isoelectric Point: Inquire
Description: Recombinant Human Plastin 3 expressed in: E.coli

Recombinant Plastin 3 (PLS3)

  • EUR 530.08
  • EUR 245.00
  • EUR 1712.80
  • EUR 637.60
  • EUR 1175.20
  • EUR 418.00
  • EUR 4132.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q99K51
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 29.2kDa
  • Isoelectric Point: Inquire
Description: Recombinant Mouse Plastin 3 expressed in: E.coli

PLS3 Recombinant Protein (Human)

RP023839 100 ug Ask for price

PLS3 Recombinant Protein (Rat)

RP221054 100 ug Ask for price

PLS3 Recombinant Protein (Mouse)

RP162968 100 ug Ask for price

PLS3 Recombinant Protein (Mouse)

RP162971 100 ug Ask for price

PLS3 Recombinant Protein (Mouse)

RP162974 100 ug Ask for price

Human Plastin 3 (PLS3) Protein

  • EUR 704.00
  • EUR 286.00
  • EUR 2193.00
  • EUR 843.00
  • EUR 509.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Human Plastin 3 (PLS3) Protein

  • EUR 704.00
  • EUR 286.00
  • EUR 2193.00
  • EUR 843.00
  • EUR 509.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-12 working days.

Human Plastin 3 (PLS3) Protein

  • EUR 704.00
  • EUR 286.00
  • EUR 2193.00
  • EUR 843.00
  • EUR 509.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-12 working days.

Mouse Plastin 3 (PLS3) Protein

  • EUR 732.00
  • EUR 286.00
  • EUR 2305.00
  • EUR 885.00
  • EUR 523.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-12 working days.

PLS3 ORF Vector (Human) (pORF)

ORF007947 1.0 ug DNA
EUR 95

Pls3 ORF Vector (Rat) (pORF)

ORF073686 1.0 ug DNA
EUR 506

Pls3 ORF Vector (Mouse) (pORF)

ORF054324 1.0 ug DNA
EUR 506

Pls3 ORF Vector (Mouse) (pORF)

ORF054325 1.0 ug DNA
EUR 506

Pls3 ORF Vector (Mouse) (pORF)

ORF054326 1.0 ug DNA
EUR 506

PLS3 ELISA Kit (Human) (OKEH07922)

OKEH07922 96 Wells
EUR 896
Description: Description of target: Plastins are a family of actin-binding proteins that are conserved throughout eukaryote evolution and expressed in most tissues of higher eukaryotes. In humans, two ubiquitous plastin isoforms (L and T) have been identified. Plastin 1 (otherwise known as Fimbrin) is a third distinct plastin isoform which is specifically expressed at high levels in the small intestine. The L isoform is expressed only in hemopoietic cell lineages, while the T isoform has been found in all other normal cells of solid tissues that have replicative potential (fibroblasts, endothelial cells, epithelial cells, melanocytes, etc.). The C-terminal 570 amino acids of the T-plastin and L-plastin proteins are 83% (n = 20) identical. It contains a potential calcium-binding site near the N terminus. Alternate splicing results in multiple transcript variants.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 39.6pg/mL

Human Plastin- 3, PLS3 ELISA KIT

ELI-19687h 96 Tests
EUR 824

Mouse Plastin- 3, Pls3 ELISA KIT

ELI-45233m 96 Tests
EUR 865

Bovine Plastin- 3, PLS3 ELISA KIT

ELI-45345b 96 Tests
EUR 928

Human Plastin-3 (PLS3) ELISA Kit

  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-12 working days.

PLS3 sgRNA CRISPR Lentivector set (Human)

K1670501 3 x 1.0 ug
EUR 339

Pls3 sgRNA CRISPR Lentivector set (Mouse)

K4550201 3 x 1.0 ug
EUR 339

Pls3 sgRNA CRISPR Lentivector set (Rat)

K7577901 3 x 1.0 ug
EUR 339

Human Plastin 3(PLS3)ELISA Kit

QY-E01395 96T
EUR 361

PLS3 sgRNA CRISPR Lentivector (Human) (Target 1)

K1670502 1.0 ug DNA
EUR 154

PLS3 sgRNA CRISPR Lentivector (Human) (Target 2)

K1670503 1.0 ug DNA
EUR 154

PLS3 sgRNA CRISPR Lentivector (Human) (Target 3)

K1670504 1.0 ug DNA
EUR 154

Pls3 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4550202 1.0 ug DNA
EUR 154

Pls3 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4550203 1.0 ug DNA
EUR 154

Pls3 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4550204 1.0 ug DNA
EUR 154

Pls3 sgRNA CRISPR Lentivector (Rat) (Target 1)

K7577902 1.0 ug DNA
EUR 154

Pls3 sgRNA CRISPR Lentivector (Rat) (Target 2)

K7577903 1.0 ug DNA
EUR 154

Pls3 sgRNA CRISPR Lentivector (Rat) (Target 3)

K7577904 1.0 ug DNA
EUR 154

PLS3 Protein Vector (Human) (pPB-C-His)

PV031785 500 ng
EUR 329

PLS3 Protein Vector (Human) (pPB-N-His)

PV031786 500 ng
EUR 329

PLS3 Protein Vector (Human) (pPM-C-HA)

PV031787 500 ng
EUR 329

PLS3 Protein Vector (Human) (pPM-C-His)

PV031788 500 ng
EUR 329

PLS3 Protein Vector (Mouse) (pPB-C-His)

PV217294 500 ng
EUR 603

PLS3 Rabbit Polyclonal Antibody