PNKD Rabbit Polyclonal Antibody

PNKD Polyclonal Antibody

ABP59960-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human PNKD protein at amino acid sequence of 140-220
  • Applications tips:
Description: A polyclonal antibody for detection of PNKD from Human, Mouse. This PNKD antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PNKD protein at amino acid sequence of 140-220

PNKD Polyclonal Antibody

31468-100ul 100ul
EUR 252

PNKD Polyclonal Antibody

31468-50ul 50ul
EUR 187

PNKD Rabbit pAb

A8203-100ul 100 ul
EUR 308

PNKD Rabbit pAb

A8203-200ul 200 ul
EUR 459

PNKD Rabbit pAb

A8203-20ul 20 ul
EUR 183

PNKD Rabbit pAb

A8203-50ul 50 ul
EUR 223

PNKD Polyclonal Conjugated Antibody

C31468 100ul
EUR 397

Probable Hydrolase PNKD (PNKD) Antibody

abx036151-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Probable Hydrolase PNKD (PNKD) Antibody

abx026892-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Probable Hydrolase PNKD (PNKD) Antibody

abx026892-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Probable Hydrolase PNKD (PNKD) Antibody

20-abx318048
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Probable Hydrolase PNKD (PNKD) Antibody

abx236582-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

PNKD antibody

70R-35856 100 ug
EUR 349
Description: Rabbit polyclonal PNKD antibody

Pnkd antibody

70R-8613 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal Pnkd antibody

PNKD Antibody

39834-100ul 100ul
EUR 390

PNKD antibody

70R-19375 50 ul
EUR 435
Description: Rabbit polyclonal PNKD antibody

PNKD Antibody

1-CSB-PA843154LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PNKD. Recognizes PNKD from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB; Recommended dilution: WB:1:500-1:5000

PNKD Antibody

1-CSB-PA018260GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against PNKD. Recognizes PNKD from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC

Probable Hydrolase PNKD (PNKD) Antibody (HRP)

20-abx315475
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Probable Hydrolase PNKD (PNKD) Antibody (FITC)

20-abx315476
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Probable Hydrolase PNKD (PNKD) Antibody (Biotin)

20-abx315477
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

anti- PNKD antibody

FNab06582 100µg
EUR 505.25
  • Immunogen: paroxysmal nonkinesigenic dyskinesia
  • Uniprot ID: Q8N490
  • Gene ID: 25953
  • Research Area: Cardiovascular, Metabolism
Description: Antibody raised against PNKD

Anti-PNKD antibody

PAab06582 100 ug
EUR 355

Anti-PNKD antibody

STJ117854 100 µl
EUR 277
Description: This gene is thought to play a role in the regulation of myofibrillogenesis. Mutations in this gene have been associated with the movement disorder paroxysmal non-kinesigenic dyskinesia. Alternative splicing results in multiple transcript variants.

Anti-PNKD antibody

STJ191208 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to PNKD

PNKD siRNA

20-abx929060
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

PNKD siRNA

20-abx929061
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

anti-PNKD

YF-PA27528 50 ug
EUR 363
Description: Mouse polyclonal to PNKD

PNKD Antibody, HRP conjugated

1-CSB-PA843154LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PNKD. Recognizes PNKD from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

PNKD Antibody, FITC conjugated

1-CSB-PA843154LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PNKD. Recognizes PNKD from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

PNKD Antibody, Biotin conjugated

1-CSB-PA843154LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PNKD. Recognizes PNKD from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Human Probable hydrolase PNKD, PNKD ELISA KIT

ELI-36132h 96 Tests
EUR 824

Bovine Probable hydrolase PNKD, PNKD ELISA KIT

ELI-43539b 96 Tests
EUR 928

Mouse Probable hydrolase PNKD, Pnkd ELISA KIT

ELI-43540m 96 Tests
EUR 865

Human Probable hydrolase PNKD (PNKD) ELISA Kit

abx382321-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Mouse Probable hydrolase PNKD (PNKD) ELISA Kit

abx390160-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Pnkd Blocking Peptide

33R-5615 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of Pnkd antibody, catalog no. 70R-8613

PNKD cloning plasmid

CSB-CL843154HU1-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1086
  • Sequence: atggcttggcagggctggcccgcggcgtggcagtgggtcgccggctgctggctcctcctcgtccttgtcctcgtcctacttgtgagcccccgcggctgccgagcgcggcggggcctccgcggtctgctcatggcgcacagccagcggctgctcttccgaatcgggtacagcctgt
  • Show more
Description: A cloning plasmid for the PNKD gene.

PNKD cloning plasmid

CSB-CL843154HU2-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1158
  • Sequence: atggcggcggtggtagctgctacggcgctgaagagccggggggcgagaaatgcccgcgtcctccgggggattctcgcaggagccacagctaacaaggtttctcataacaggacccgggccctgcaaagccacagctcctcagagggcaaggaggaacctgaacccctatccccgg
  • Show more
Description: A cloning plasmid for the PNKD gene.

PNKD cloning plasmid

CSB-CL843154HU3-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 429
  • Sequence: atggcggcggtggtagctgctacggcgctgaagggccggggggcgagaaatgcccgcgtcctccgggggattctcgcaggagccacagctaacaaggcttctcataacaggacccgggccctgcaaagccacagctccccagagggcaaggaggaacctgaacccctatccccgga
  • Show more
Description: A cloning plasmid for the PNKD gene.

Pnkd ELISA Kit| Mouse Probable hydrolase PNKD ELISA Kit

EF015799 96 Tests
EUR 689

PNKD ELISA Kit| Bovine Probable hydrolase PNKD ELISA Kit

EF011715 96 Tests
EUR 689

Mouse PNKD shRNA Plasmid

20-abx974862
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

PNKD ELISA KIT|Human

EF001893 96 Tests
EUR 689

Human PNKD shRNA Plasmid

20-abx958613
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

PNKD Recombinant Protein (Human)

RP023923 100 ug Ask for price

PNKD Recombinant Protein (Human)

RP023926 100 ug Ask for price

PNKD Recombinant Protein (Human)

RP023929 100 ug Ask for price

PNKD Recombinant Protein (Rat)

RP221156 100 ug Ask for price

PNKD Recombinant Protein (Rat)

RP221159 100 ug Ask for price

PNKD Recombinant Protein (Rat)

RP221162 100 ug Ask for price

PNKD Recombinant Protein (Mouse)

RP163112 100 ug Ask for price

PNKD Recombinant Protein (Mouse)

RP163115 100 ug Ask for price

PNKD Recombinant Protein (Mouse)

RP163118 100 ug Ask for price

PNKD ORF Vector (Human) (pORF)

ORF007975 1.0 ug DNA
EUR 95

PNKD ORF Vector (Human) (pORF)

ORF007976 1.0 ug DNA
EUR 95

PNKD ORF Vector (Human) (pORF)

ORF007977 1.0 ug DNA
EUR 95

Pnkd ORF Vector (Rat) (pORF)

ORF073720 1.0 ug DNA
EUR 506

Pnkd ORF Vector (Rat) (pORF)

ORF073721 1.0 ug DNA
EUR 506

Pnkd ORF Vector (Rat) (pORF)

ORF073722 1.0 ug DNA
EUR 506

Pnkd ORF Vector (Mouse) (pORF)

ORF054372 1.0 ug DNA
EUR 506

Pnkd ORF Vector (Mouse) (pORF)

ORF054373 1.0 ug DNA
EUR 506

Pnkd ORF Vector (Mouse) (pORF)

ORF054374 1.0 ug DNA
EUR 506

PNKD sgRNA CRISPR Lentivector set (Human)

K1675901 3 x 1.0 ug
EUR 339

Pnkd sgRNA CRISPR Lentivector set (Mouse)

K4860101 3 x 1.0 ug
EUR 339

Pnkd sgRNA CRISPR Lentivector set (Rat)

K7520901 3 x 1.0 ug
EUR 339

PNKD sgRNA CRISPR Lentivector (Human) (Target 1)

K1675902 1.0 ug DNA
EUR 154

PNKD sgRNA CRISPR Lentivector (Human) (Target 2)

K1675903 1.0 ug DNA
EUR 154

PNKD sgRNA CRISPR Lentivector (Human) (Target 3)

K1675904 1.0 ug DNA
EUR 154

Pnkd sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4860102 1.0 ug DNA
EUR 154

Pnkd sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4860103 1.0 ug DNA
EUR 154

Pnkd sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4860104 1.0 ug DNA
EUR 154

Pnkd sgRNA CRISPR Lentivector (Rat) (Target 1)

K7520902 1.0 ug DNA
EUR 154

Pnkd sgRNA CRISPR Lentivector (Rat) (Target 2)

K7520903 1.0 ug DNA
EUR 154

Pnkd sgRNA CRISPR Lentivector (Rat) (Target 3)

K7520904 1.0 ug DNA
EUR 154

PNKD Protein Vector (Human) (pPB-C-His)

PV031897 500 ng
EUR 329

PNKD Protein Vector (Human) (pPB-N-His)

PV031898 500 ng
EUR 329

PNKD Protein Vector (Human) (pPM-C-HA)

PV031899 500 ng
EUR 329

PNKD Protein Vector (Human) (pPM-C-His)

PV031900 500 ng
EUR 329

PNKD Protein Vector (Human) (pPB-C-His)

PV031901 500 ng
EUR 329

PNKD Protein Vector (Human) (pPB-N-His)

PV031902 500 ng
EUR 329

PNKD Protein Vector (Human) (pPM-C-HA)

PV031903 500 ng
EUR 329

PNKD Protein Vector (Human) (pPM-C-His)

PV031904 500 ng
EUR 329

PNKD Protein Vector (Human) (pPB-C-His)

PV031905 500 ng
EUR 329

PNKD Protein Vector (Human) (pPB-N-His)

PV031906 500 ng
EUR 329

PNKD Protein Vector (Human) (pPM-C-HA)

PV031907 500 ng
EUR 329

PNKD Protein Vector (Human) (pPM-C-His)

PV031908 500 ng
EUR 329

PNKD Protein Vector (Mouse) (pPB-C-His)

PV217486 500 ng
EUR 1065

PNKD Protein Vector (Mouse) (pPB-N-His)

PV217487 500 ng
EUR 1065

PNKD Protein Vector (Mouse) (pPM-C-HA)

PV217488 500 ng
EUR 1065

PNKD Protein Vector (Mouse) (pPM-C-His)

PV217489 500 ng
EUR 1065

PNKD Protein Vector (Mouse) (pPB-C-His)

PV217490 500 ng
EUR 603

PNKD Protein Vector (Mouse) (pPB-N-His)

PV217491 500 ng
EUR 603

PNKD Protein Vector (Mouse) (pPM-C-HA)

PV217492 500 ng
EUR 603

PNKD Protein Vector (Mouse) (pPM-C-His)

PV217493 500 ng
EUR 603

PNKD Protein Vector (Mouse) (pPB-C-His)

PV217494 500 ng
EUR 1065

PNKD Protein Vector (Mouse) (pPB-N-His)

PV217495 500 ng
EUR 1065

PNKD Protein Vector (Mouse) (pPM-C-HA)

PV217496 500 ng
EUR 1065

PNKD Protein Vector (Mouse) (pPM-C-His)

PV217497 500 ng
EUR 1065

PNKD Protein Vector (Rat) (pPB-C-His)

PV294878 500 ng
EUR 603

PNKD Protein Vector (Rat) (pPB-N-His)

PV294879 500 ng
EUR 603

PNKD Protein Vector (Rat) (pPM-C-HA)

PV294880 500 ng
EUR 603

PNKD Protein Vector (Rat) (pPM-C-His)

PV294881 500 ng
EUR 603

PNKD Protein Vector (Rat) (pPB-C-His)

PV294882 500 ng
EUR 603

PNKD Protein Vector (Rat) (pPB-N-His)

PV294883 500 ng
EUR 603

PNKD Protein Vector (Rat) (pPM-C-HA)

PV294884 500 ng
EUR 603

PNKD Protein Vector (Rat) (pPM-C-His)

PV294885 500 ng
EUR 603

PNKD Protein Vector (Rat) (pPB-C-His)

PV294886 500 ng
EUR 603

PNKD Protein Vector (Rat) (pPB-N-His)

PV294887 500 ng
EUR 603

PNKD Protein Vector (Rat) (pPM-C-HA)

PV294888 500 ng
EUR 603

PNKD Protein Vector (Rat) (pPM-C-His)

PV294889 500 ng
EUR 603

Pnkd 3'UTR GFP Stable Cell Line

TU166611 1.0 ml Ask for price

PNKD 3'UTR Luciferase Stable Cell Line

TU018346 1.0 ml
EUR 1521

Pnkd 3'UTR Luciferase Stable Cell Line

TU116611 1.0 ml Ask for price

PNKD 3'UTR GFP Stable Cell Line

TU068346 1.0 ml
EUR 1521

Pnkd 3'UTR GFP Stable Cell Line

TU266465 1.0 ml Ask for price

Pnkd 3'UTR Luciferase Stable Cell Line

TU216465 1.0 ml Ask for price

VEGF Rabbit Polyclonal Antibody

ES8453-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

VEGF Rabbit Polyclonal Antibody

ES8453-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody

ES8454-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody

ES8454-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody

ES8455-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody

ES8455-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8456-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8456-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8457-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8457-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSC70 Rabbit Polyclonal Antibody

ES8558-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSC70 Rabbit Polyclonal Antibody

ES8558-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody

ES8559-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody

ES8559-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP90? Rabbit Polyclonal Antibody

ES8560-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSP90? Rabbit Polyclonal Antibody

ES8560-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

IkB ? Rabbit Polyclonal Antibody

ES8561-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

IkB ? Rabbit Polyclonal Antibody

ES8561-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JAK1 Rabbit Polyclonal Antibody

ES8562-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK1 Rabbit Polyclonal Antibody

ES8562-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK2 Rabbit Polyclonal Antibody

ES8563-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK2 Rabbit Polyclonal Antibody

ES8563-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JNK2 Rabbit Polyclonal Antibody

ES8564-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JNK2 Rabbit Polyclonal Antibody

ES8564-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JNK3 Rabbit Polyclonal Antibody

ES8565-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JNK3 Rabbit Polyclonal Antibody

ES8565-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

MEK2 Rabbit Polyclonal Antibody

ES8566-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC

MEK2 Rabbit Polyclonal Antibody

ES8566-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC

MEK3 Rabbit Polyclonal Antibody

ES8567-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

MEK3 Rabbit Polyclonal Antibody

ES8567-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Nrf2 Rabbit Polyclonal Antibody

ES8568-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Nrf2 Rabbit Polyclonal Antibody

ES8568-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4a Rabbit Polyclonal Antibody

ES8569-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4a Rabbit Polyclonal Antibody

ES8569-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4b Rabbit Polyclonal Antibody

ES8570-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4b Rabbit Polyclonal Antibody

ES8570-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4c Rabbit Polyclonal Antibody

ES8571-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4c Rabbit Polyclonal Antibody

ES8571-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG5 Rabbit Polyclonal Antibody

ES8572-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG5 Rabbit Polyclonal Antibody

ES8572-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG7 Rabbit Polyclonal Antibody

ES8573-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG7 Rabbit Polyclonal Antibody

ES8573-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG13 Rabbit Polyclonal Antibody

ES8574-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG13 Rabbit Polyclonal Antibody

ES8574-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG13 Rabbit Polyclonal Antibody

ES8575-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG13 Rabbit Polyclonal Antibody

ES8575-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG14L Rabbit Polyclonal Antibody

ES8576-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG14L Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG14L Rabbit Polyclonal Antibody

ES8576-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG14L Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NBR1 Rabbit Polyclonal Antibody

ES8578-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NBR1 Rabbit Polyclonal Antibody

ES8578-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NBR1 Rabbit Polyclonal Antibody

ES8579-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NBR1 Rabbit Polyclonal Antibody

ES8579-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

WIPI2 Rabbit Polyclonal Antibody

ES8580-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against WIPI2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

WIPI2 Rabbit Polyclonal Antibody

ES8580-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against WIPI2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Gab1 Rabbit Polyclonal Antibody

ES8582-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against Gab1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Gab1 Rabbit Polyclonal Antibody

ES8582-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against Gab1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ERK1 Rabbit Polyclonal Antibody

ES8583-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ERK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ERK1 Rabbit Polyclonal Antibody

ES8583-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ERK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Met Rabbit Polyclonal Antibody

ABP57458-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

Met Rabbit Polyclonal Antibody

ABP57458-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

Met Rabbit Polyclonal Antibody

ABP57458-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

PNKD Rabbit Polyclonal Antibody