 PNKD Polyclonal Antibody |
|
ABP59960-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human PNKD protein at amino acid sequence of 140-220
- Applications tips:
|
|
Description: A polyclonal antibody for detection of PNKD from Human, Mouse. This PNKD antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PNKD protein at amino acid sequence of 140-220 |
PNKD Polyclonal Antibody |
|
ES10050-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against PNKD from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA |
PNKD Polyclonal Antibody |
|
ES10050-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against PNKD from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA |
 PNKD Rabbit pAb |
|
A8203-100ul |
Abclonal |
100 ul |
EUR 308 |
PNKD Rabbit pAb |
|
A8203-200ul |
Abclonal |
200 ul |
EUR 459 |
PNKD Rabbit pAb |
|
A8203-20ul |
Abclonal |
20 ul |
EUR 183 |
PNKD Rabbit pAb |
|
A8203-50ul |
Abclonal |
50 ul |
EUR 223 |
 PNKD Polyclonal Conjugated Antibody |
|
C31468 |
SAB |
100ul |
EUR 397 |
 Antibody) Probable Hydrolase PNKD (PNKD) Antibody |
|
abx026892-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
Probable Hydrolase PNKD (PNKD) Antibody |
|
abx026892-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
Probable Hydrolase PNKD (PNKD) Antibody |
|
abx036151-100ug |
Abbexa |
100 ug |
EUR 391 |
- Shipped within 5-10 working days.
|
Probable Hydrolase PNKD (PNKD) Antibody |
|
abx236582-100ug |
Abbexa |
100 ug |
EUR 481 |
- Shipped within 5-12 working days.
|
Probable Hydrolase PNKD (PNKD) Antibody |
|
20-abx318048 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
 PNKD antibody |
|
70R-19375 |
Fitzgerald |
50 ul |
EUR 435 |
|
Description: Rabbit polyclonal PNKD antibody |
 PNKD Antibody |
|
39834-100ul |
SAB |
100ul |
EUR 390 |
PNKD Antibody |
|
1-CSB-PA843154LA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
|
|
Description: A polyclonal antibody against PNKD. Recognizes PNKD from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB; Recommended dilution: WB:1:500-1:5000 |
PNKD Antibody |
|
1-CSB-PA018260GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
|
|
Description: A polyclonal antibody against PNKD. Recognizes PNKD from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC |
PNKD antibody |
|
70R-35856 |
Fitzgerald |
100 ug |
EUR 349 |
|
Description: Rabbit polyclonal PNKD antibody |
 Pnkd antibody |
|
70R-8613 |
Fitzgerald |
50 ug |
EUR 467 |
|
Description: Affinity purified rabbit polyclonal Pnkd antibody |
 Antibody (HRP)) Probable Hydrolase PNKD (PNKD) Antibody (HRP) |
|
20-abx315475 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
 Antibody (FITC)) Probable Hydrolase PNKD (PNKD) Antibody (FITC) |
|
20-abx315476 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
 Antibody (Biotin)) Probable Hydrolase PNKD (PNKD) Antibody (Biotin) |
|
20-abx315477 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
 anti- PNKD antibody |
|
FNab06582 |
FN Test |
100µg |
EUR 505.25 |
- Immunogen: paroxysmal nonkinesigenic dyskinesia
- Uniprot ID: Q8N490
- Gene ID: 25953
- Research Area: Cardiovascular, Metabolism
|
|
Description: Antibody raised against PNKD |
 Anti-PNKD antibody |
|
STJ117854 |
St John's Laboratory |
100 µl |
EUR 277 |
|
Description: This gene is thought to play a role in the regulation of myofibrillogenesis. Mutations in this gene have been associated with the movement disorder paroxysmal non-kinesigenic dyskinesia. Alternative splicing results in multiple transcript variants. |
Anti-PNKD antibody |
|
STJ191208 |
St John's Laboratory |
200 µl |
EUR 197 |
|
Description: Unconjugated Rabbit polyclonal to PNKD |
 PNKD siRNA |
|
20-abx929060 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
PNKD siRNA |
|
20-abx929061 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
 anti-PNKD |
|
YF-PA27528 |
Abfrontier |
50 ug |
EUR 363 |
|
Description: Mouse polyclonal to PNKD |
 PNKD Antibody, HRP conjugated |
|
1-CSB-PA843154LB01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
|
|
Description: A polyclonal antibody against PNKD. Recognizes PNKD from Human. This antibody is HRP conjugated. Tested in the following application: ELISA |
 PNKD Antibody, FITC conjugated |
|
1-CSB-PA843154LC01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
|
|
Description: A polyclonal antibody against PNKD. Recognizes PNKD from Human. This antibody is FITC conjugated. Tested in the following application: ELISA |
 PNKD Antibody, Biotin conjugated |
|
1-CSB-PA843154LD01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
|
|
Description: A polyclonal antibody against PNKD. Recognizes PNKD from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA |
 Bovine Probable hydrolase PNKD, PNKD ELISA KIT |
|
ELI-43539b |
Lifescience Market |
96 Tests |
EUR 928 |
 Mouse Probable hydrolase PNKD, Pnkd ELISA KIT |
|
ELI-43540m |
Lifescience Market |
96 Tests |
EUR 865 |
 ELISA Kit) Human Probable hydrolase PNKD (PNKD) ELISA Kit |
|
abx382321-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
 ELISA Kit) Mouse Probable hydrolase PNKD (PNKD) ELISA Kit |
|
abx390160-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
 Human Probable hydrolase PNKD, PNKD ELISA KIT |
|
ELI-36132h |
Lifescience Market |
96 Tests |
EUR 824 |
 Pnkd Blocking Peptide |
|
33R-5615 |
Fitzgerald |
100 ug |
EUR 180 |
|
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of Pnkd antibody, catalog no. 70R-8613 |
 PNKD cloning plasmid |
|
CSB-CL843154HU1-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1086
- Sequence: atggcttggcagggctggcccgcggcgtggcagtgggtcgccggctgctggctcctcctcgtccttgtcctcgtcctacttgtgagcccccgcggctgccgagcgcggcggggcctccgcggtctgctcatggcgcacagccagcggctgctcttccgaatcgggtacagcctgt
- Show more
|
|
Description: A cloning plasmid for the PNKD gene. |
PNKD cloning plasmid |
|
CSB-CL843154HU2-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1158
- Sequence: atggcggcggtggtagctgctacggcgctgaagagccggggggcgagaaatgcccgcgtcctccgggggattctcgcaggagccacagctaacaaggtttctcataacaggacccgggccctgcaaagccacagctcctcagagggcaaggaggaacctgaacccctatccccgg
- Show more
|
|
Description: A cloning plasmid for the PNKD gene. |
PNKD cloning plasmid |
|
CSB-CL843154HU3-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 429
- Sequence: atggcggcggtggtagctgctacggcgctgaagggccggggggcgagaaatgcccgcgtcctccgggggattctcgcaggagccacagctaacaaggcttctcataacaggacccgggccctgcaaagccacagctccccagagggcaaggaggaacctgaacccctatccccgga
- Show more
|
|
Description: A cloning plasmid for the PNKD gene. |
 Pnkd ELISA Kit| Mouse Probable hydrolase PNKD ELISA Kit |
|
EF015799 |
Lifescience Market |
96 Tests |
EUR 689 |
 PNKD ELISA Kit| Bovine Probable hydrolase PNKD ELISA Kit |
|
EF011715 |
Lifescience Market |
96 Tests |
EUR 689 |
 Mouse PNKD shRNA Plasmid |
|
20-abx974862 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
 Human PNKD shRNA Plasmid |
|
20-abx958613 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
) PNKD Recombinant Protein (Human) |
|
RP023923 |
ABM |
100 ug |
Ask for price |
PNKD Recombinant Protein (Human) |
|
RP023926 |
ABM |
100 ug |
Ask for price |
PNKD Recombinant Protein (Human) |
|
RP023929 |
ABM |
100 ug |
Ask for price |
) PNKD Recombinant Protein (Mouse) |
|
RP163112 |
ABM |
100 ug |
Ask for price |
PNKD Recombinant Protein (Mouse) |
|
RP163115 |
ABM |
100 ug |
Ask for price |
PNKD Recombinant Protein (Mouse) |
|
RP163118 |
ABM |
100 ug |
Ask for price |
) PNKD Recombinant Protein (Rat) |
|
RP221156 |
ABM |
100 ug |
Ask for price |
PNKD Recombinant Protein (Rat) |
|
RP221159 |
ABM |
100 ug |
Ask for price |
PNKD Recombinant Protein (Rat) |
|
RP221162 |
ABM |
100 ug |
Ask for price |
 (pORF)) Pnkd ORF Vector (Rat) (pORF) |
|
ORF073720 |
ABM |
1.0 ug DNA |
EUR 506 |
Pnkd ORF Vector (Rat) (pORF) |
|
ORF073721 |
ABM |
1.0 ug DNA |
EUR 506 |
Pnkd ORF Vector (Rat) (pORF) |
|
ORF073722 |
ABM |
1.0 ug DNA |
EUR 506 |
 (pORF)) PNKD ORF Vector (Human) (pORF) |
|
ORF007975 |
ABM |
1.0 ug DNA |
EUR 95 |
PNKD ORF Vector (Human) (pORF) |
|
ORF007976 |
ABM |
1.0 ug DNA |
EUR 95 |
PNKD ORF Vector (Human) (pORF) |
|
ORF007977 |
ABM |
1.0 ug DNA |
EUR 95 |
 (pORF)) Pnkd ORF Vector (Mouse) (pORF) |
|
ORF054372 |
ABM |
1.0 ug DNA |
EUR 506 |
Pnkd ORF Vector (Mouse) (pORF) |
|
ORF054373 |
ABM |
1.0 ug DNA |
EUR 506 |
Pnkd ORF Vector (Mouse) (pORF) |
|
ORF054374 |
ABM |
1.0 ug DNA |
EUR 506 |
) Pnkd sgRNA CRISPR Lentivector set (Mouse) |
|
K4860101 |
ABM |
3 x 1.0 ug |
EUR 339 |
) Pnkd sgRNA CRISPR Lentivector set (Rat) |
|
K7520901 |
ABM |
3 x 1.0 ug |
EUR 339 |
) PNKD sgRNA CRISPR Lentivector set (Human) |
|
K1675901 |
ABM |
3 x 1.0 ug |
EUR 339 |
 (Target 1)) Pnkd sgRNA CRISPR Lentivector (Mouse) (Target 1) |
|
K4860102 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 2)) Pnkd sgRNA CRISPR Lentivector (Mouse) (Target 2) |
|
K4860103 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 3)) Pnkd sgRNA CRISPR Lentivector (Mouse) (Target 3) |
|
K4860104 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 1)) Pnkd sgRNA CRISPR Lentivector (Rat) (Target 1) |
|
K7520902 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 2)) Pnkd sgRNA CRISPR Lentivector (Rat) (Target 2) |
|
K7520903 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 3)) Pnkd sgRNA CRISPR Lentivector (Rat) (Target 3) |
|
K7520904 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 1)) PNKD sgRNA CRISPR Lentivector (Human) (Target 1) |
|
K1675902 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 2)) PNKD sgRNA CRISPR Lentivector (Human) (Target 2) |
|
K1675903 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 3)) PNKD sgRNA CRISPR Lentivector (Human) (Target 3) |
|
K1675904 |
ABM |
1.0 ug DNA |
EUR 154 |
 (pPB-C-His)) PNKD Protein Vector (Rat) (pPB-C-His) |
|
PV294878 |
ABM |
500 ng |
EUR 603 |
 (pPB-N-His)) PNKD Protein Vector (Rat) (pPB-N-His) |
|
PV294879 |
ABM |
500 ng |
EUR 603 |
 (pPM-C-HA)) PNKD Protein Vector (Rat) (pPM-C-HA) |
|
PV294880 |
ABM |
500 ng |
EUR 603 |
 (pPM-C-His)) PNKD Protein Vector (Rat) (pPM-C-His) |
|
PV294881 |
ABM |
500 ng |
EUR 603 |
PNKD Protein Vector (Rat) (pPB-C-His) |
|
PV294882 |
ABM |
500 ng |
EUR 603 |
PNKD Protein Vector (Rat) (pPB-N-His) |
|
PV294883 |
ABM |
500 ng |
EUR 603 |
PNKD Protein Vector (Rat) (pPM-C-HA) |
|
PV294884 |
ABM |
500 ng |
EUR 603 |
PNKD Protein Vector (Rat) (pPM-C-His) |
|
PV294885 |
ABM |
500 ng |
EUR 603 |
PNKD Protein Vector (Rat) (pPB-C-His) |
|
PV294886 |
ABM |
500 ng |
EUR 603 |
PNKD Protein Vector (Rat) (pPB-N-His) |
|
PV294887 |
ABM |
500 ng |
EUR 603 |
PNKD Protein Vector (Rat) (pPM-C-HA) |
|
PV294888 |
ABM |
500 ng |
EUR 603 |
PNKD Protein Vector (Rat) (pPM-C-His) |
|
PV294889 |
ABM |
500 ng |
EUR 603 |
 (pPB-C-His)) PNKD Protein Vector (Human) (pPB-C-His) |
|
PV031897 |
ABM |
500 ng |
EUR 329 |
 (pPB-N-His)) PNKD Protein Vector (Human) (pPB-N-His) |
|
PV031898 |
ABM |
500 ng |
EUR 329 |
 (pPM-C-HA)) PNKD Protein Vector (Human) (pPM-C-HA) |
|
PV031899 |
ABM |
500 ng |
EUR 329 |
 (pPM-C-His)) PNKD Protein Vector (Human) (pPM-C-His) |
|
PV031900 |
ABM |
500 ng |
EUR 329 |
PNKD Protein Vector (Human) (pPB-C-His) |
|
PV031901 |
ABM |
500 ng |
EUR 329 |
PNKD Protein Vector (Human) (pPB-N-His) |
|
PV031902 |
ABM |
500 ng |
EUR 329 |
PNKD Protein Vector (Human) (pPM-C-HA) |
|
PV031903 |
ABM |
500 ng |
EUR 329 |
PNKD Protein Vector (Human) (pPM-C-His) |
|
PV031904 |
ABM |
500 ng |
EUR 329 |
PNKD Protein Vector (Human) (pPB-C-His) |
|
PV031905 |
ABM |
500 ng |
EUR 329 |
PNKD Protein Vector (Human) (pPB-N-His) |
|
PV031906 |
ABM |
500 ng |
EUR 329 |
PNKD Protein Vector (Human) (pPM-C-HA) |
|
PV031907 |
ABM |
500 ng |
EUR 329 |
PNKD Protein Vector (Human) (pPM-C-His) |
|
PV031908 |
ABM |
500 ng |
EUR 329 |
 (pPB-C-His)) PNKD Protein Vector (Mouse) (pPB-C-His) |
|
PV217486 |
ABM |
500 ng |
EUR 1065 |
 (pPB-N-His)) PNKD Protein Vector (Mouse) (pPB-N-His) |
|
PV217487 |
ABM |
500 ng |
EUR 1065 |
 (pPM-C-HA)) PNKD Protein Vector (Mouse) (pPM-C-HA) |
|
PV217488 |
ABM |
500 ng |
EUR 1065 |
 (pPM-C-His)) PNKD Protein Vector (Mouse) (pPM-C-His) |
|
PV217489 |
ABM |
500 ng |
EUR 1065 |
PNKD Protein Vector (Mouse) (pPB-C-His) |
|
PV217490 |
ABM |
500 ng |
EUR 603 |
PNKD Protein Vector (Mouse) (pPB-N-His) |
|
PV217491 |
ABM |
500 ng |
EUR 603 |
PNKD Protein Vector (Mouse) (pPM-C-HA) |
|
PV217492 |
ABM |
500 ng |
EUR 603 |
PNKD Protein Vector (Mouse) (pPM-C-His) |
|
PV217493 |
ABM |
500 ng |
EUR 603 |
PNKD Protein Vector (Mouse) (pPB-C-His) |
|
PV217494 |
ABM |
500 ng |
EUR 1065 |
PNKD Protein Vector (Mouse) (pPB-N-His) |
|
PV217495 |
ABM |
500 ng |
EUR 1065 |
PNKD Protein Vector (Mouse) (pPM-C-HA) |
|
PV217496 |
ABM |
500 ng |
EUR 1065 |
PNKD Protein Vector (Mouse) (pPM-C-His) |
|
PV217497 |
ABM |
500 ng |
EUR 1065 |
 Pnkd 3'UTR Luciferase Stable Cell Line |
|
TU116611 |
ABM |
1.0 ml |
Ask for price |
 Pnkd 3'UTR GFP Stable Cell Line |
|
TU166611 |
ABM |
1.0 ml |
Ask for price |
Pnkd 3'UTR Luciferase Stable Cell Line |
|
TU216465 |
ABM |
1.0 ml |
Ask for price |
Pnkd 3'UTR GFP Stable Cell Line |
|
TU266465 |
ABM |
1.0 ml |
Ask for price |
 PNKD 3'UTR GFP Stable Cell Line |
|
TU068346 |
ABM |
1.0 ml |
EUR 1521 |
 PNKD 3'UTR Luciferase Stable Cell Line |
|
TU018346 |
ABM |
1.0 ml |
EUR 1521 |
 GAPDH Rabbit Polyclonal Antibody |
|
37985-100ul |
SAB |
100ul |
EUR 252 |
GAPDH Rabbit Polyclonal Antibody |
|
37985-50ul |
SAB |
50ul |
EUR 187 |
 EFHD1 Rabbit Polyclonal Antibody |
|
38001-100ul |
SAB |
100ul |
EUR 252 |
EFHD1 Rabbit Polyclonal Antibody |
|
38001-50ul |
SAB |
50ul |
EUR 187 |
 Alliinase Rabbit Polyclonal Antibody |
|
38042-100ul |
SAB |
100ul |
EUR 252 |
Alliinase Rabbit Polyclonal Antibody |
|
38042-50ul |
SAB |
50ul |
EUR 187 |
 ECFP Rabbit Polyclonal Antibody |
|
38077-100ul |
SAB |
100ul |
EUR 252 |
ECFP Rabbit Polyclonal Antibody |
|
38077-50ul |
SAB |
50ul |
EUR 187 |
 EYFP Rabbit Polyclonal Antibody |
|
38078-100ul |
SAB |
100ul |
EUR 252 |
EYFP Rabbit Polyclonal Antibody |
|
38078-50ul |
SAB |
50ul |
EUR 187 |
 mOrange Rabbit Polyclonal Antibody |
|
38079-100ul |
SAB |
100ul |
EUR 252 |
mOrange Rabbit Polyclonal Antibody |
|
38079-50ul |
SAB |
50ul |
EUR 187 |
 mStrawberry Rabbit Polyclonal Antibody |
|
38083-100ul |
SAB |
100ul |
EUR 252 |
mStrawberry Rabbit Polyclonal Antibody |
|
38083-50ul |
SAB |
50ul |
EUR 187 |
 AmCyan Rabbit Polyclonal Antibody |
|
38086-100ul |
SAB |
100ul |
EUR 252 |
AmCyan Rabbit Polyclonal Antibody |
|
38086-50ul |
SAB |
50ul |
EUR 187 |
 EBFP Rabbit Polyclonal Antibody |
|
38087-100ul |
SAB |
100ul |
EUR 252 |
EBFP Rabbit Polyclonal Antibody |
|
38087-50ul |
SAB |
50ul |
EUR 187 |
 Vimentin Rabbit Polyclonal Antibody |
|
38104-100ul |
SAB |
100ul |
EUR 252 |
Vimentin Rabbit Polyclonal Antibody |
|
38104-50ul |
SAB |
50ul |
EUR 187 |
 LDHD Rabbit Polyclonal Antibody |
|
38105-100ul |
SAB |
100ul |
EUR 252 |
LDHD Rabbit Polyclonal Antibody |
|
38105-50ul |
SAB |
50ul |
EUR 187 |
GAPDH Rabbit Polyclonal Antibody |
|
A01021-005ml |
Abbkine |
0.05ml |
EUR 147 |
- Immunogen information: Recombinant Protein
- Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
- Show more
|
|
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein |
GAPDH Rabbit Polyclonal Antibody |
|
A01021-02ml |
Abbkine |
0.2ml |
EUR 332 |
- Immunogen information: Recombinant Protein
- Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
- Show more
|
|
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein |
GAPDH Rabbit Polyclonal Antibody |
|
A01021-02ml5 |
Abbkine |
0.2ml×5 |
EUR 920 |
- Immunogen information: Recombinant Protein
- Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
- Show more
|
|
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein |
 Rabbit Hemoglobin Polyclonal Antibody |
|
A53073 |
EpiGentek |
100 µg |
EUR 570.55 |
|
Description: The best epigenetics products |
 Met Rabbit Polyclonal Antibody |
|
ABP57458-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
Met Rabbit Polyclonal Antibody |
|
ABP57458-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
Met Rabbit Polyclonal Antibody |
|
ABP57458-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
 VEGF Rabbit Polyclonal Antibody |
|
ABP57460-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
VEGF Rabbit Polyclonal Antibody |
|
ABP57460-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
VEGF Rabbit Polyclonal Antibody |
|
ABP57460-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
 CD10 Rabbit Polyclonal Antibody |
|
ABP57461-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of CD10 of MME
- Applications tips:
|
|
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME |
CD10 Rabbit Polyclonal Antibody |
|
ABP57461-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of CD10 of MME
- Applications tips:
|
|
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME |
CD10 Rabbit Polyclonal Antibody |
|
ABP57461-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of CD10 of MME
- Applications tips:
|
|
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME |
 NM23A Rabbit Polyclonal Antibody |
|
ABP57462-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of NM23A of NME1
- Applications tips:
|
|
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1 |
NM23A Rabbit Polyclonal Antibody |
|
ABP57462-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of NM23A of NME1
- Applications tips:
|
|
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1 |
NM23A Rabbit Polyclonal Antibody |
|
ABP57462-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of NM23A of NME1
- Applications tips:
|
|
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1 |
 ATM Rabbit Polyclonal Antibody |
|
ABP57463-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
ATM Rabbit Polyclonal Antibody |
|
ABP57463-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
ATM Rabbit Polyclonal Antibody |
|
ABP57463-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
ATM Rabbit Polyclonal Antibody |
|
ABP57464-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
ATM Rabbit Polyclonal Antibody |
|
ABP57464-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
ATM Rabbit Polyclonal Antibody |
|
ABP57464-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
 HSC70 Rabbit Polyclonal Antibody |
|
ABP57565-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
- Applications tips:
|
|
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8) |
HSC70 Rabbit Polyclonal Antibody |
|
ABP57565-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
- Applications tips:
|
|
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8) |
HSC70 Rabbit Polyclonal Antibody |
|
ABP57565-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
- Applications tips:
|
|
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8) |
 HSP40 Rabbit Polyclonal Antibody |
|
ABP57566-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of HSP40
- Applications tips:
|
|
Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40 |
HSP40 Rabbit Polyclonal Antibody |
|
ABP57566-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of HSP40
- Applications tips:
|
|
Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40 |
HSP40 Rabbit Polyclonal Antibody |
|
ABP57566-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of HSP40
- Applications tips:
|
|
Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40 |
 HSP90Alpha Rabbit Polyclonal Antibody |
|
ABP57567-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of HSP90?
- Applications tips:
|
|
Description: A polyclonal antibody for detection of HSP90Alpha from Human, Mouse, Rat. This HSP90Alpha antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP90? |
HSP90Alpha Rabbit Polyclonal Antibody |
|
ABP57567-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of HSP90?
- Applications tips:
|
|
Description: A polyclonal antibody for detection of HSP90Alpha from Human, Mouse, Rat. This HSP90Alpha antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP90? |
HSP90Alpha Rabbit Polyclonal Antibody |
|
ABP57567-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of HSP90?
- Applications tips:
|
|
Description: A polyclonal antibody for detection of HSP90Alpha from Human, Mouse, Rat. This HSP90Alpha antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP90? |
 JAK1 Rabbit Polyclonal Antibody |
|
ABP57569-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of JAK1
- Applications tips:
|
|
Description: A polyclonal antibody for detection of JAK1 from Human, Mouse, Rat. This JAK1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK1 |
JAK1 Rabbit Polyclonal Antibody |
|
ABP57569-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of JAK1
- Applications tips:
|
|
Description: A polyclonal antibody for detection of JAK1 from Human, Mouse, Rat. This JAK1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK1 |
JAK1 Rabbit Polyclonal Antibody |
|
ABP57569-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of JAK1
- Applications tips:
|
|
Description: A polyclonal antibody for detection of JAK1 from Human, Mouse, Rat. This JAK1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK1 |
 JAK2 Rabbit Polyclonal Antibody |
|
ABP57570-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of JAK2
- Applications tips:
|
|
Description: A polyclonal antibody for detection of JAK2 from Human, Mouse, Rat. This JAK2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK2 |
JAK2 Rabbit Polyclonal Antibody |
|
ABP57570-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of JAK2
- Applications tips:
|
|
Description: A polyclonal antibody for detection of JAK2 from Human, Mouse, Rat. This JAK2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK2 |
JAK2 Rabbit Polyclonal Antibody |
|
ABP57570-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of JAK2
- Applications tips:
|
|
Description: A polyclonal antibody for detection of JAK2 from Human, Mouse, Rat. This JAK2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK2 |
 JNK2 Rabbit Polyclonal Antibody |
|
ABP57571-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of JNK2
- Applications tips:
|
|
Description: A polyclonal antibody for detection of JNK2 from Human, Mouse, Rat. This JNK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK2 |
JNK2 Rabbit Polyclonal Antibody |
|
ABP57571-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of JNK2
- Applications tips:
|
|
Description: A polyclonal antibody for detection of JNK2 from Human, Mouse, Rat. This JNK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK2 |
PNKD Rabbit Polyclonal Antibody
