PNKD Polyclonal Antibody |
ABP59960-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human PNKD protein at amino acid sequence of 140-220
- Applications tips:
|
Description: A polyclonal antibody for detection of PNKD from Human, Mouse. This PNKD antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PNKD protein at amino acid sequence of 140-220 |
PNKD Polyclonal Antibody |
31468-100ul |
SAB |
100ul |
EUR 252 |
PNKD Polyclonal Antibody |
31468-50ul |
SAB |
50ul |
EUR 187 |
PNKD Rabbit pAb |
A8203-100ul |
Abclonal |
100 ul |
EUR 308 |
PNKD Rabbit pAb |
A8203-200ul |
Abclonal |
200 ul |
EUR 459 |
PNKD Rabbit pAb |
A8203-20ul |
Abclonal |
20 ul |
EUR 183 |
PNKD Rabbit pAb |
A8203-50ul |
Abclonal |
50 ul |
EUR 223 |
PNKD Polyclonal Conjugated Antibody |
C31468 |
SAB |
100ul |
EUR 397 |
Probable Hydrolase PNKD (PNKD) Antibody |
abx036151-100ug |
Abbexa |
100 ug |
EUR 391 |
- Shipped within 5-10 working days.
|
Probable Hydrolase PNKD (PNKD) Antibody |
abx026892-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
Probable Hydrolase PNKD (PNKD) Antibody |
abx026892-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
Probable Hydrolase PNKD (PNKD) Antibody |
20-abx318048 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Probable Hydrolase PNKD (PNKD) Antibody |
abx236582-100ug |
Abbexa |
100 ug |
EUR 481 |
- Shipped within 5-12 working days.
|
PNKD antibody |
70R-35856 |
Fitzgerald |
100 ug |
EUR 349 |
Description: Rabbit polyclonal PNKD antibody |
Pnkd antibody |
70R-8613 |
Fitzgerald |
50 ug |
EUR 467 |
Description: Affinity purified rabbit polyclonal Pnkd antibody |
PNKD Antibody |
39834-100ul |
SAB |
100ul |
EUR 390 |
PNKD antibody |
70R-19375 |
Fitzgerald |
50 ul |
EUR 435 |
Description: Rabbit polyclonal PNKD antibody |
PNKD Antibody |
1-CSB-PA843154LA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against PNKD. Recognizes PNKD from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB; Recommended dilution: WB:1:500-1:5000 |
PNKD Antibody |
1-CSB-PA018260GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
|
Description: A polyclonal antibody against PNKD. Recognizes PNKD from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC |
Probable Hydrolase PNKD (PNKD) Antibody (HRP) |
20-abx315475 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Probable Hydrolase PNKD (PNKD) Antibody (FITC) |
20-abx315476 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Probable Hydrolase PNKD (PNKD) Antibody (Biotin) |
20-abx315477 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
anti- PNKD antibody |
FNab06582 |
FN Test |
100µg |
EUR 505.25 |
- Immunogen: paroxysmal nonkinesigenic dyskinesia
- Uniprot ID: Q8N490
- Gene ID: 25953
- Research Area: Cardiovascular, Metabolism
|
Description: Antibody raised against PNKD |
Anti-PNKD antibody |
STJ117854 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: This gene is thought to play a role in the regulation of myofibrillogenesis. Mutations in this gene have been associated with the movement disorder paroxysmal non-kinesigenic dyskinesia. Alternative splicing results in multiple transcript variants. |
Anti-PNKD antibody |
STJ191208 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to PNKD |
PNKD siRNA |
20-abx929060 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
PNKD siRNA |
20-abx929061 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
anti-PNKD |
YF-PA27528 |
Abfrontier |
50 ug |
EUR 363 |
Description: Mouse polyclonal to PNKD |
PNKD Antibody, HRP conjugated |
1-CSB-PA843154LB01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against PNKD. Recognizes PNKD from Human. This antibody is HRP conjugated. Tested in the following application: ELISA |
PNKD Antibody, FITC conjugated |
1-CSB-PA843154LC01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against PNKD. Recognizes PNKD from Human. This antibody is FITC conjugated. Tested in the following application: ELISA |
PNKD Antibody, Biotin conjugated |
1-CSB-PA843154LD01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against PNKD. Recognizes PNKD from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA |
Human Probable hydrolase PNKD, PNKD ELISA KIT |
ELI-36132h |
Lifescience Market |
96 Tests |
EUR 824 |
Bovine Probable hydrolase PNKD, PNKD ELISA KIT |
ELI-43539b |
Lifescience Market |
96 Tests |
EUR 928 |
Mouse Probable hydrolase PNKD, Pnkd ELISA KIT |
ELI-43540m |
Lifescience Market |
96 Tests |
EUR 865 |
Human Probable hydrolase PNKD (PNKD) ELISA Kit |
abx382321-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
Mouse Probable hydrolase PNKD (PNKD) ELISA Kit |
abx390160-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
Pnkd Blocking Peptide |
33R-5615 |
Fitzgerald |
100 ug |
EUR 180 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of Pnkd antibody, catalog no. 70R-8613 |
PNKD cloning plasmid |
CSB-CL843154HU1-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1086
- Sequence: atggcttggcagggctggcccgcggcgtggcagtgggtcgccggctgctggctcctcctcgtccttgtcctcgtcctacttgtgagcccccgcggctgccgagcgcggcggggcctccgcggtctgctcatggcgcacagccagcggctgctcttccgaatcgggtacagcctgt
- Show more
|
Description: A cloning plasmid for the PNKD gene. |
PNKD cloning plasmid |
CSB-CL843154HU2-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1158
- Sequence: atggcggcggtggtagctgctacggcgctgaagagccggggggcgagaaatgcccgcgtcctccgggggattctcgcaggagccacagctaacaaggtttctcataacaggacccgggccctgcaaagccacagctcctcagagggcaaggaggaacctgaacccctatccccgg
- Show more
|
Description: A cloning plasmid for the PNKD gene. |
PNKD cloning plasmid |
CSB-CL843154HU3-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 429
- Sequence: atggcggcggtggtagctgctacggcgctgaagggccggggggcgagaaatgcccgcgtcctccgggggattctcgcaggagccacagctaacaaggcttctcataacaggacccgggccctgcaaagccacagctccccagagggcaaggaggaacctgaacccctatccccgga
- Show more
|
Description: A cloning plasmid for the PNKD gene. |
Pnkd ELISA Kit| Mouse Probable hydrolase PNKD ELISA Kit |
EF015799 |
Lifescience Market |
96 Tests |
EUR 689 |
PNKD ELISA Kit| Bovine Probable hydrolase PNKD ELISA Kit |
EF011715 |
Lifescience Market |
96 Tests |
EUR 689 |
Mouse PNKD shRNA Plasmid |
20-abx974862 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Human PNKD shRNA Plasmid |
20-abx958613 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
PNKD Recombinant Protein (Human) |
RP023923 |
ABM |
100 ug |
Ask for price |
PNKD Recombinant Protein (Human) |
RP023926 |
ABM |
100 ug |
Ask for price |
PNKD Recombinant Protein (Human) |
RP023929 |
ABM |
100 ug |
Ask for price |
PNKD Recombinant Protein (Rat) |
RP221156 |
ABM |
100 ug |
Ask for price |
PNKD Recombinant Protein (Rat) |
RP221159 |
ABM |
100 ug |
Ask for price |
PNKD Recombinant Protein (Rat) |
RP221162 |
ABM |
100 ug |
Ask for price |
PNKD Recombinant Protein (Mouse) |
RP163112 |
ABM |
100 ug |
Ask for price |
PNKD Recombinant Protein (Mouse) |
RP163115 |
ABM |
100 ug |
Ask for price |
PNKD Recombinant Protein (Mouse) |
RP163118 |
ABM |
100 ug |
Ask for price |
PNKD ORF Vector (Human) (pORF) |
ORF007975 |
ABM |
1.0 ug DNA |
EUR 95 |
PNKD ORF Vector (Human) (pORF) |
ORF007976 |
ABM |
1.0 ug DNA |
EUR 95 |
PNKD ORF Vector (Human) (pORF) |
ORF007977 |
ABM |
1.0 ug DNA |
EUR 95 |
Pnkd ORF Vector (Rat) (pORF) |
ORF073720 |
ABM |
1.0 ug DNA |
EUR 506 |
Pnkd ORF Vector (Rat) (pORF) |
ORF073721 |
ABM |
1.0 ug DNA |
EUR 506 |
Pnkd ORF Vector (Rat) (pORF) |
ORF073722 |
ABM |
1.0 ug DNA |
EUR 506 |
Pnkd ORF Vector (Mouse) (pORF) |
ORF054372 |
ABM |
1.0 ug DNA |
EUR 506 |
Pnkd ORF Vector (Mouse) (pORF) |
ORF054373 |
ABM |
1.0 ug DNA |
EUR 506 |
Pnkd ORF Vector (Mouse) (pORF) |
ORF054374 |
ABM |
1.0 ug DNA |
EUR 506 |
PNKD sgRNA CRISPR Lentivector set (Human) |
K1675901 |
ABM |
3 x 1.0 ug |
EUR 339 |
Pnkd sgRNA CRISPR Lentivector set (Mouse) |
K4860101 |
ABM |
3 x 1.0 ug |
EUR 339 |
Pnkd sgRNA CRISPR Lentivector set (Rat) |
K7520901 |
ABM |
3 x 1.0 ug |
EUR 339 |
PNKD sgRNA CRISPR Lentivector (Human) (Target 1) |
K1675902 |
ABM |
1.0 ug DNA |
EUR 154 |
PNKD sgRNA CRISPR Lentivector (Human) (Target 2) |
K1675903 |
ABM |
1.0 ug DNA |
EUR 154 |
PNKD sgRNA CRISPR Lentivector (Human) (Target 3) |
K1675904 |
ABM |
1.0 ug DNA |
EUR 154 |
Pnkd sgRNA CRISPR Lentivector (Mouse) (Target 1) |
K4860102 |
ABM |
1.0 ug DNA |
EUR 154 |
Pnkd sgRNA CRISPR Lentivector (Mouse) (Target 2) |
K4860103 |
ABM |
1.0 ug DNA |
EUR 154 |
Pnkd sgRNA CRISPR Lentivector (Mouse) (Target 3) |
K4860104 |
ABM |
1.0 ug DNA |
EUR 154 |
Pnkd sgRNA CRISPR Lentivector (Rat) (Target 1) |
K7520902 |
ABM |
1.0 ug DNA |
EUR 154 |
Pnkd sgRNA CRISPR Lentivector (Rat) (Target 2) |
K7520903 |
ABM |
1.0 ug DNA |
EUR 154 |
Pnkd sgRNA CRISPR Lentivector (Rat) (Target 3) |
K7520904 |
ABM |
1.0 ug DNA |
EUR 154 |
PNKD Protein Vector (Human) (pPB-C-His) |
PV031897 |
ABM |
500 ng |
EUR 329 |
PNKD Protein Vector (Human) (pPB-N-His) |
PV031898 |
ABM |
500 ng |
EUR 329 |
PNKD Protein Vector (Human) (pPM-C-HA) |
PV031899 |
ABM |
500 ng |
EUR 329 |
PNKD Protein Vector (Human) (pPM-C-His) |
PV031900 |
ABM |
500 ng |
EUR 329 |
PNKD Protein Vector (Human) (pPB-C-His) |
PV031901 |
ABM |
500 ng |
EUR 329 |
PNKD Protein Vector (Human) (pPB-N-His) |
PV031902 |
ABM |
500 ng |
EUR 329 |
PNKD Protein Vector (Human) (pPM-C-HA) |
PV031903 |
ABM |
500 ng |
EUR 329 |
PNKD Protein Vector (Human) (pPM-C-His) |
PV031904 |
ABM |
500 ng |
EUR 329 |
PNKD Protein Vector (Human) (pPB-C-His) |
PV031905 |
ABM |
500 ng |
EUR 329 |
PNKD Protein Vector (Human) (pPB-N-His) |
PV031906 |
ABM |
500 ng |
EUR 329 |
PNKD Protein Vector (Human) (pPM-C-HA) |
PV031907 |
ABM |
500 ng |
EUR 329 |
PNKD Protein Vector (Human) (pPM-C-His) |
PV031908 |
ABM |
500 ng |
EUR 329 |
PNKD Protein Vector (Mouse) (pPB-C-His) |
PV217486 |
ABM |
500 ng |
EUR 1065 |
PNKD Protein Vector (Mouse) (pPB-N-His) |
PV217487 |
ABM |
500 ng |
EUR 1065 |
PNKD Protein Vector (Mouse) (pPM-C-HA) |
PV217488 |
ABM |
500 ng |
EUR 1065 |
PNKD Protein Vector (Mouse) (pPM-C-His) |
PV217489 |
ABM |
500 ng |
EUR 1065 |
PNKD Protein Vector (Mouse) (pPB-C-His) |
PV217490 |
ABM |
500 ng |
EUR 603 |
PNKD Protein Vector (Mouse) (pPB-N-His) |
PV217491 |
ABM |
500 ng |
EUR 603 |
PNKD Protein Vector (Mouse) (pPM-C-HA) |
PV217492 |
ABM |
500 ng |
EUR 603 |
PNKD Protein Vector (Mouse) (pPM-C-His) |
PV217493 |
ABM |
500 ng |
EUR 603 |
PNKD Protein Vector (Mouse) (pPB-C-His) |
PV217494 |
ABM |
500 ng |
EUR 1065 |
PNKD Protein Vector (Mouse) (pPB-N-His) |
PV217495 |
ABM |
500 ng |
EUR 1065 |
PNKD Protein Vector (Mouse) (pPM-C-HA) |
PV217496 |
ABM |
500 ng |
EUR 1065 |
PNKD Protein Vector (Mouse) (pPM-C-His) |
PV217497 |
ABM |
500 ng |
EUR 1065 |
PNKD Protein Vector (Rat) (pPB-C-His) |
PV294878 |
ABM |
500 ng |
EUR 603 |
PNKD Protein Vector (Rat) (pPB-N-His) |
PV294879 |
ABM |
500 ng |
EUR 603 |
PNKD Protein Vector (Rat) (pPM-C-HA) |
PV294880 |
ABM |
500 ng |
EUR 603 |
PNKD Protein Vector (Rat) (pPM-C-His) |
PV294881 |
ABM |
500 ng |
EUR 603 |
PNKD Protein Vector (Rat) (pPB-C-His) |
PV294882 |
ABM |
500 ng |
EUR 603 |
PNKD Protein Vector (Rat) (pPB-N-His) |
PV294883 |
ABM |
500 ng |
EUR 603 |
PNKD Protein Vector (Rat) (pPM-C-HA) |
PV294884 |
ABM |
500 ng |
EUR 603 |
PNKD Protein Vector (Rat) (pPM-C-His) |
PV294885 |
ABM |
500 ng |
EUR 603 |
PNKD Protein Vector (Rat) (pPB-C-His) |
PV294886 |
ABM |
500 ng |
EUR 603 |
PNKD Protein Vector (Rat) (pPB-N-His) |
PV294887 |
ABM |
500 ng |
EUR 603 |
PNKD Protein Vector (Rat) (pPM-C-HA) |
PV294888 |
ABM |
500 ng |
EUR 603 |
PNKD Protein Vector (Rat) (pPM-C-His) |
PV294889 |
ABM |
500 ng |
EUR 603 |
Pnkd 3'UTR GFP Stable Cell Line |
TU166611 |
ABM |
1.0 ml |
Ask for price |
PNKD 3'UTR Luciferase Stable Cell Line |
TU018346 |
ABM |
1.0 ml |
EUR 1521 |
Pnkd 3'UTR Luciferase Stable Cell Line |
TU116611 |
ABM |
1.0 ml |
Ask for price |
PNKD 3'UTR GFP Stable Cell Line |
TU068346 |
ABM |
1.0 ml |
EUR 1521 |
Pnkd 3'UTR GFP Stable Cell Line |
TU266465 |
ABM |
1.0 ml |
Ask for price |
Pnkd 3'UTR Luciferase Stable Cell Line |
TU216465 |
ABM |
1.0 ml |
Ask for price |
VEGF Rabbit Polyclonal Antibody |
ES8453-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
VEGF Rabbit Polyclonal Antibody |
ES8453-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
CD10 Rabbit Polyclonal Antibody |
ES8454-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
CD10 Rabbit Polyclonal Antibody |
ES8454-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NM23A Rabbit Polyclonal Antibody |
ES8455-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NM23A Rabbit Polyclonal Antibody |
ES8455-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8456-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8456-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8457-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8457-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
HSC70 Rabbit Polyclonal Antibody |
ES8558-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSC70 Rabbit Polyclonal Antibody |
ES8558-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSP40 Rabbit Polyclonal Antibody |
ES8559-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSP40 Rabbit Polyclonal Antibody |
ES8559-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSP90? Rabbit Polyclonal Antibody |
ES8560-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
HSP90? Rabbit Polyclonal Antibody |
ES8560-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
IkB ? Rabbit Polyclonal Antibody |
ES8561-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
IkB ? Rabbit Polyclonal Antibody |
ES8561-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
JAK1 Rabbit Polyclonal Antibody |
ES8562-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JAK1 Rabbit Polyclonal Antibody |
ES8562-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JAK2 Rabbit Polyclonal Antibody |
ES8563-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JAK2 Rabbit Polyclonal Antibody |
ES8563-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JNK2 Rabbit Polyclonal Antibody |
ES8564-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
JNK2 Rabbit Polyclonal Antibody |
ES8564-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
JNK3 Rabbit Polyclonal Antibody |
ES8565-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JNK3 Rabbit Polyclonal Antibody |
ES8565-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
MEK2 Rabbit Polyclonal Antibody |
ES8566-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC |
MEK2 Rabbit Polyclonal Antibody |
ES8566-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC |
MEK3 Rabbit Polyclonal Antibody |
ES8567-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
MEK3 Rabbit Polyclonal Antibody |
ES8567-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
Nrf2 Rabbit Polyclonal Antibody |
ES8568-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
Nrf2 Rabbit Polyclonal Antibody |
ES8568-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4a Rabbit Polyclonal Antibody |
ES8569-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4a Rabbit Polyclonal Antibody |
ES8569-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4b Rabbit Polyclonal Antibody |
ES8570-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4b Rabbit Polyclonal Antibody |
ES8570-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4c Rabbit Polyclonal Antibody |
ES8571-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4c Rabbit Polyclonal Antibody |
ES8571-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG5 Rabbit Polyclonal Antibody |
ES8572-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG5 Rabbit Polyclonal Antibody |
ES8572-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG7 Rabbit Polyclonal Antibody |
ES8573-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG7 Rabbit Polyclonal Antibody |
ES8573-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG13 Rabbit Polyclonal Antibody |
ES8574-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG13 Rabbit Polyclonal Antibody |
ES8574-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG13 Rabbit Polyclonal Antibody |
ES8575-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG13 Rabbit Polyclonal Antibody |
ES8575-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG14L Rabbit Polyclonal Antibody |
ES8576-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG14L Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG14L Rabbit Polyclonal Antibody |
ES8576-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG14L Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NBR1 Rabbit Polyclonal Antibody |
ES8578-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NBR1 Rabbit Polyclonal Antibody |
ES8578-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NBR1 Rabbit Polyclonal Antibody |
ES8579-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NBR1 Rabbit Polyclonal Antibody |
ES8579-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
WIPI2 Rabbit Polyclonal Antibody |
ES8580-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against WIPI2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
WIPI2 Rabbit Polyclonal Antibody |
ES8580-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against WIPI2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
Gab1 Rabbit Polyclonal Antibody |
ES8582-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against Gab1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
Gab1 Rabbit Polyclonal Antibody |
ES8582-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against Gab1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ERK1 Rabbit Polyclonal Antibody |
ES8583-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ERK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ERK1 Rabbit Polyclonal Antibody |
ES8583-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ERK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
Met Rabbit Polyclonal Antibody |
ABP57458-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
Met Rabbit Polyclonal Antibody |
ABP57458-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
Met Rabbit Polyclonal Antibody |
ABP57458-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
PNKD Rabbit Polyclonal Antibody