PPME1 Polyclonal Antibody |
ABP59987-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from part region of human PPME1 protein at amino acid sequence of 220-300
- Applications tips:
|
Description: A polyclonal antibody for detection of PPME1 from Human, Mouse, Rat. This PPME1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PPME1 protein at amino acid sequence of 220-300 |
PPME1 Polyclonal Antibody |
ABP59987-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human PPME1 protein at amino acid sequence of 220-300
- Applications tips:
|
Description: A polyclonal antibody for detection of PPME1 from Human, Mouse, Rat. This PPME1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PPME1 protein at amino acid sequence of 220-300 |
PPME1 Polyclonal Antibody |
A50424 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: Ask the seller for details |
PPME1 Polyclonal Antibody |
27895-100ul |
SAB |
100ul |
EUR 252 |
PPME1 Polyclonal Antibody |
27895-50ul |
SAB |
50ul |
EUR 187 |
PPME1 Rabbit pAb |
A13094-100ul |
Abclonal |
100 ul |
EUR 308 |
PPME1 Rabbit pAb |
A13094-200ul |
Abclonal |
200 ul |
EUR 459 |
PPME1 Rabbit pAb |
A13094-20ul |
Abclonal |
20 ul |
EUR 183 |
PPME1 Rabbit pAb |
A13094-50ul |
Abclonal |
50 ul |
EUR 223 |
PPME1 Polyclonal Conjugated Antibody |
C27895 |
SAB |
100ul |
EUR 397 |
PPME1 antibody |
70R-3708 |
Fitzgerald |
50 ug |
EUR 467 |
Description: Rabbit polyclonal PPME1 antibody raised against the N terminal of PPME1 |
PPME1 antibody |
70R-3709 |
Fitzgerald |
50 ug |
EUR 467 |
Description: Rabbit polyclonal PPME1 antibody raised against the N terminal of PPME1 |
PPME1 antibody |
10R-5387 |
Fitzgerald |
100 ul |
EUR 691 |
Description: Mouse monoclonal PPME1 antibody |
PPME1 antibody |
10R-5388 |
Fitzgerald |
100 ul |
EUR 691 |
Description: Mouse monoclonal PPME1 antibody |
PPME1 antibody |
10R-5389 |
Fitzgerald |
100 ul |
EUR 691 |
Description: Mouse monoclonal PPME1 antibody |
PPME1 antibody |
70R-19465 |
Fitzgerald |
50 ul |
EUR 435 |
Description: Rabbit polyclonal PPME1 antibody |
PPME1 Antibody |
1-CSB-PA018501GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
|
Description: A polyclonal antibody against PPME1. Recognizes PPME1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB |
PPME1 Antibody |
1-CSB-PA018501LA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against PPME1. Recognizes PPME1 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:500-1:2000, IHC:1:20-1:200 |
Polyclonal PPME1 Antibody (C-term) |
AMM07292G |
Leading Biology |
0.1ml |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human PPME1 (C-term). This antibody is tested and proven to work in the following applications: |
PPME1 Polyclonal Antibody, HRP Conjugated |
A50425 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: The best epigenetics products |
PPME1 Polyclonal Antibody, FITC Conjugated |
A50426 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: kits suitable for this type of research |
PPME1 Polyclonal Antibody, Biotin Conjugated |
A50427 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: fast delivery possible |
anti- PPME1 antibody |
FNab06692 |
FN Test |
100µg |
EUR 548.75 |
- Immunogen: protein phosphatase methylesterase 1
- Uniprot ID: Q9Y570
- Gene ID: 51400
- Research Area: Metabolism
|
Description: Antibody raised against PPME1 |
Human PPME1 Antibody |
32213-05111 |
AssayPro |
150 ug |
EUR 261 |
Anti-PPME1 antibody |
STJ115061 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: This gene encodes a protein phosphatase methylesterase localized to the nucleus. The encoded protein acts on the protein phosphatase-2A catalytic subunit and supports the ERK pathway through dephosphorylation of regulatory proteins. It plays a role in malignant glioma progression. Alternative splicing results in multiple transcript variants. |
Anti-PPME1 antibody |
STJ191219 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to PPME1 |
PPME1 siRNA |
20-abx904170 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
PPME1 siRNA |
20-abx929449 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
PPME1 siRNA |
20-abx929450 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
anti-PPME1 |
YF-PA19030 |
Abfrontier |
50 ul |
EUR 363 |
Description: Mouse polyclonal to PPME1 |
anti-PPME1 |
YF-PA19031 |
Abfrontier |
50 ug |
EUR 363 |
Description: Mouse polyclonal to PPME1 |
PPME1 Antibody, HRP conjugated |
1-CSB-PA018501LB01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against PPME1. Recognizes PPME1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA |
PPME1 Antibody, FITC conjugated |
1-CSB-PA018501LC01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against PPME1. Recognizes PPME1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA |
PPME1 Antibody, Biotin conjugated |
1-CSB-PA018501LD01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against PPME1. Recognizes PPME1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA |
PPME1 cloning plasmid |
CSB-CL018501HU-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1161
- Sequence: atgtcggccctcgaaaagagcatgcacctcggccgccttccctctcgcccacctctacccggcagcgggggcagtcagagcggagccaagatgcgaatgggccctggaagaaagcgggacttttcccctgttccttggagtcagtattttgagtccatggaagatgtagaagtag
- Show more
|
Description: A cloning plasmid for the PPME1 gene. |
PPME1 Protein (Recombinant) |
20-abx073232 |
Abbexa |
-
EUR 3418.00
-
EUR 328.00
-
EUR 230.00
|
|
- Shipped within 5-10 working days.
|
PPME1 Blocking Peptide |
33R-6394 |
Fitzgerald |
100 ug |
EUR 180 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of PPME1 antibody, catalog no. 70R-3708 |
PPME1 Blocking Peptide |
33R-7126 |
Fitzgerald |
100 ug |
EUR 180 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of PPME1 antibody, catalog no. 70R-3709 |
Human PPME1 Antibody (Biotin Conjugate) |
32213-05121 |
AssayPro |
150 ug |
EUR 369 |
Protein Phosphatase Methylesterase 1 (PPME1) Antibody |
20-abx114859 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Protein Phosphatase Methylesterase 1 (PPME1) Antibody |
abx048500-100ug |
Abbexa |
100 ug |
EUR 481 |
- Shipped within 5-10 working days.
|
Protein Phosphatase Methylesterase 1 (PPME1) Antibody |
20-abx029420 |
Abbexa |
-
EUR 98.00
-
EUR 133.00
-
EUR 523.00
|
|
- Shipped within 5-10 working days.
|
Protein Phosphatase Methylesterase 1 (PPME1) Antibody |
abx029420-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
Protein Phosphatase Methylesterase 1 (PPME1) Antibody |
20-abx318360 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Protein Phosphatase Methylesterase 1 (PPME1) Antibody |
abx236692-100ug |
Abbexa |
100 ug |
EUR 509 |
- Shipped within 5-12 working days.
|
Human PPME1 AssayLite Antibody (FITC Conjugate) |
32213-05141 |
AssayPro |
150 ug |
EUR 428 |
Human PPME1 AssayLite Antibody (RPE Conjugate) |
32213-05151 |
AssayPro |
150 ug |
EUR 428 |
Human PPME1 AssayLite Antibody (APC Conjugate) |
32213-05161 |
AssayPro |
150 ug |
EUR 428 |
Human PPME1 AssayLite Antibody (PerCP Conjugate) |
32213-05171 |
AssayPro |
150 ug |
EUR 471 |
Mouse PPME1 shRNA Plasmid |
20-abx977811 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Rat PPME1 shRNA Plasmid |
20-abx990227 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Human PPME1 shRNA Plasmid |
20-abx959748 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
PPME1 protein (His tag) |
80R-1904 |
Fitzgerald |
100 ug |
EUR 305 |
Description: Purified recombinant PPME1 protein |
PPME1 Recombinant Protein (Human) |
RP024325 |
ABM |
100 ug |
Ask for price |
PPME1 Recombinant Protein (Rat) |
RP221675 |
ABM |
100 ug |
Ask for price |
PPME1 Recombinant Protein (Mouse) |
RP163835 |
ABM |
100 ug |
Ask for price |
Protein Phosphatase Methylesterase 1 (PPME1) Antibody (HRP) |
20-abx304927 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Protein Phosphatase Methylesterase 1 (PPME1) Antibody (FITC) |
20-abx304928 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Protein Phosphatase Methylesterase 1 (PPME1) Antibody (Biotin) |
20-abx304929 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
PPME1 ORF Vector (Human) (pORF) |
ORF008109 |
ABM |
1.0 ug DNA |
EUR 95 |
Ppme1 ORF Vector (Rat) (pORF) |
ORF073893 |
ABM |
1.0 ug DNA |
EUR 506 |
Ppme1 ORF Vector (Mouse) (pORF) |
ORF054613 |
ABM |
1.0 ug DNA |
EUR 506 |
PPME1 ELISA Kit (Rat) (OKEH03629) |
OKEH03629 |
Aviva Systems Biology |
96 Wells |
EUR 779 |
Description: Description of target: Demethylates proteins that have been reversibly carboxymethylated. Demethylates PPP2CB (in vitro) and PPP2CA. Binding to PPP2CA displaces the manganese ion and inactivates the enzyme.;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Competitive ELISA;Sensitivity: 0.325 ng/mL |
PPME1 sgRNA CRISPR Lentivector set (Human) |
K1701501 |
ABM |
3 x 1.0 ug |
EUR 339 |
Ppme1 sgRNA CRISPR Lentivector set (Mouse) |
K3733801 |
ABM |
3 x 1.0 ug |
EUR 339 |
Ppme1 sgRNA CRISPR Lentivector set (Rat) |
K6404301 |
ABM |
3 x 1.0 ug |
EUR 339 |
PPME1 sgRNA CRISPR Lentivector (Human) (Target 1) |
K1701502 |
ABM |
1.0 ug DNA |
EUR 154 |
PPME1 sgRNA CRISPR Lentivector (Human) (Target 2) |
K1701503 |
ABM |
1.0 ug DNA |
EUR 154 |
PPME1 sgRNA CRISPR Lentivector (Human) (Target 3) |
K1701504 |
ABM |
1.0 ug DNA |
EUR 154 |
Ppme1 sgRNA CRISPR Lentivector (Mouse) (Target 1) |
K3733802 |
ABM |
1.0 ug DNA |
EUR 154 |
Ppme1 sgRNA CRISPR Lentivector (Mouse) (Target 2) |
K3733803 |
ABM |
1.0 ug DNA |
EUR 154 |
Ppme1 sgRNA CRISPR Lentivector (Mouse) (Target 3) |
K3733804 |
ABM |
1.0 ug DNA |
EUR 154 |
Ppme1 sgRNA CRISPR Lentivector (Rat) (Target 1) |
K6404302 |
ABM |
1.0 ug DNA |
EUR 154 |
Ppme1 sgRNA CRISPR Lentivector (Rat) (Target 2) |
K6404303 |
ABM |
1.0 ug DNA |
EUR 154 |
Ppme1 sgRNA CRISPR Lentivector (Rat) (Target 3) |
K6404304 |
ABM |
1.0 ug DNA |
EUR 154 |
Recombinant Human PPME1 Protein, His, E.coli-1mg |
QP13121-1mg |
EnQuireBio |
1mg |
EUR 2757 |
Recombinant Human PPME1 Protein, His, E.coli-20ug |
QP13121-20ug |
EnQuireBio |
20ug |
EUR 201 |
Recombinant Human PPME1 Protein, His, E.coli-5ug |
QP13121-5ug |
EnQuireBio |
5ug |
EUR 155 |
PPME1 Protein Vector (Human) (pPB-C-His) |
PV032433 |
ABM |
500 ng |
EUR 329 |
PPME1 Protein Vector (Human) (pPB-N-His) |
PV032434 |
ABM |
500 ng |
EUR 329 |
PPME1 Protein Vector (Human) (pPM-C-HA) |
PV032435 |
ABM |
500 ng |
EUR 329 |
PPME1 Protein Vector (Human) (pPM-C-His) |
PV032436 |
ABM |
500 ng |
EUR 329 |
PPME1 Protein Vector (Mouse) (pPB-C-His) |
PV218450 |
ABM |
500 ng |
EUR 603 |
PPME1 Protein Vector (Mouse) (pPB-N-His) |
PV218451 |
ABM |
500 ng |
EUR 603 |
PPME1 Protein Vector (Mouse) (pPM-C-HA) |
PV218452 |
ABM |
500 ng |
EUR 603 |
PPME1 Protein Vector (Mouse) (pPM-C-His) |
PV218453 |
ABM |
500 ng |
EUR 603 |
PPME1 Protein Vector (Rat) (pPB-C-His) |
PV295570 |
ABM |
500 ng |
EUR 603 |
PPME1 Protein Vector (Rat) (pPB-N-His) |
PV295571 |
ABM |
500 ng |
EUR 603 |
PPME1 Protein Vector (Rat) (pPM-C-HA) |
PV295572 |
ABM |
500 ng |
EUR 603 |
PPME1 Protein Vector (Rat) (pPM-C-His) |
PV295573 |
ABM |
500 ng |
EUR 603 |
Ppme1 3'UTR GFP Stable Cell Line |
TU166797 |
ABM |
1.0 ml |
Ask for price |
PPME1 3'UTR Luciferase Stable Cell Line |
TU018616 |
ABM |
1.0 ml |
EUR 1394 |
Ppme1 3'UTR Luciferase Stable Cell Line |
TU116797 |
ABM |
1.0 ml |
Ask for price |
PPME1 3'UTR GFP Stable Cell Line |
TU068616 |
ABM |
1.0 ml |
EUR 1394 |
Ppme1 3'UTR GFP Stable Cell Line |
TU266642 |
ABM |
1.0 ml |
Ask for price |
Ppme1 3'UTR Luciferase Stable Cell Line |
TU216642 |
ABM |
1.0 ml |
Ask for price |
Cow Protein phosphatase methylesterase 1 (PPME1) ELISA Kit |
abx516396-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
Human Protein phosphatase methylesterase 1 (PPME1) ELISA Kit |
abx516397-96tests |
Abbexa |
96 tests |
EUR 739 |
- Shipped within 5-12 working days.
|
Mouse Protein phosphatase methylesterase 1 (PPME1) ELISA Kit |
abx516398-96tests |
Abbexa |
96 tests |
EUR 739 |
- Shipped within 5-12 working days.
|
Rat Ppme1/ Protein phosphatase methylesterase 1 ELISA Kit |
E0785Ra |
Sunlong |
1 Kit |
EUR 646 |
Mouse Ppme1/ Protein phosphatase methylesterase 1 ELISA Kit |
E1180Mo |
Sunlong |
1 Kit |
EUR 632 |
Human PPME1/ Protein phosphatase methylesterase 1 ELISA Kit |
E2010Hu |
Sunlong |
1 Kit |
EUR 605 |
Rat Ppme1(Protein phosphatase methylesterase 1) ELISA Kit |
ER0505 |
FN Test |
96T |
EUR 567.6 |
- Detection range: 0.625-40 ng/ml
- Uniprot ID: Q4FZT2
- Alias: Ppme1
|
Description: Method of detection: Coated with Antigen, Competitive ELISA;Reacts with: Rattus;Sensitivity: 0.375 ng/ml |
Human Protein phosphatase methylesterase 1, PPME1 ELISA KIT |
ELI-36196h |
Lifescience Market |
96 Tests |
EUR 824 |
Mouse Protein phosphatase methylesterase 1, Ppme1 ELISA KIT |
ELI-36547m |
Lifescience Market |
96 Tests |
EUR 865 |
Bovine Protein phosphatase methylesterase 1, PPME1 ELISA KIT |
ELI-45446b |
Lifescience Market |
96 Tests |
EUR 928 |
Rat Protein phosphatase methylesterase 1 (PPME1) ELISA Kit |
abx256482-96tests |
Abbexa |
96 tests |
EUR 739 |
- Shipped within 5-12 working days.
|
PPME1 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV) |
LV700207 |
ABM |
1.0 ug DNA |
EUR 682 |
PPME1 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC) |
LV700211 |
ABM |
1.0 ug DNA |
EUR 682 |
PPME1 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a) |
LV700212 |
ABM |
1.0 ug DNA |
EUR 682 |
PPME1 Protein Phosphatase Methylesterase 1 Human Recombinant Protein |
PROTQ9Y570 |
BosterBio |
Regular: 20ug |
EUR 317 |
Description: PPME1 Human Recombinant produced in E.coli is a single, non-glycosylated polypeptide chain containing 406 amino acids (1-386) and having a molecular mass of 44.4 kDa.;The PPME1 is fused to a 20 amino acid His-Tag at N-terminus and purified by proprietary chromatographic techniques. |
VEGF Rabbit Polyclonal Antibody |
ES8453-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
VEGF Rabbit Polyclonal Antibody |
ES8453-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
CD10 Rabbit Polyclonal Antibody |
ES8454-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
CD10 Rabbit Polyclonal Antibody |
ES8454-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NM23A Rabbit Polyclonal Antibody |
ES8455-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NM23A Rabbit Polyclonal Antibody |
ES8455-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8456-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8456-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8457-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8457-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
HSC70 Rabbit Polyclonal Antibody |
ES8558-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSC70 Rabbit Polyclonal Antibody |
ES8558-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSP40 Rabbit Polyclonal Antibody |
ES8559-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSP40 Rabbit Polyclonal Antibody |
ES8559-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSP90? Rabbit Polyclonal Antibody |
ES8560-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
HSP90? Rabbit Polyclonal Antibody |
ES8560-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
IkB ? Rabbit Polyclonal Antibody |
ES8561-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
IkB ? Rabbit Polyclonal Antibody |
ES8561-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
JAK1 Rabbit Polyclonal Antibody |
ES8562-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JAK1 Rabbit Polyclonal Antibody |
ES8562-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JAK2 Rabbit Polyclonal Antibody |
ES8563-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JAK2 Rabbit Polyclonal Antibody |
ES8563-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JNK2 Rabbit Polyclonal Antibody |
ES8564-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
JNK2 Rabbit Polyclonal Antibody |
ES8564-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
JNK3 Rabbit Polyclonal Antibody |
ES8565-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JNK3 Rabbit Polyclonal Antibody |
ES8565-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
MEK2 Rabbit Polyclonal Antibody |
ES8566-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC |
MEK2 Rabbit Polyclonal Antibody |
ES8566-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC |
MEK3 Rabbit Polyclonal Antibody |
ES8567-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
MEK3 Rabbit Polyclonal Antibody |
ES8567-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
Nrf2 Rabbit Polyclonal Antibody |
ES8568-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
Nrf2 Rabbit Polyclonal Antibody |
ES8568-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4a Rabbit Polyclonal Antibody |
ES8569-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4a Rabbit Polyclonal Antibody |
ES8569-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4b Rabbit Polyclonal Antibody |
ES8570-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4b Rabbit Polyclonal Antibody |
ES8570-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4c Rabbit Polyclonal Antibody |
ES8571-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4c Rabbit Polyclonal Antibody |
ES8571-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG5 Rabbit Polyclonal Antibody |
ES8572-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG5 Rabbit Polyclonal Antibody |
ES8572-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG7 Rabbit Polyclonal Antibody |
ES8573-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG7 Rabbit Polyclonal Antibody |
ES8573-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG13 Rabbit Polyclonal Antibody |
ES8574-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG13 Rabbit Polyclonal Antibody |
ES8574-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG13 Rabbit Polyclonal Antibody |
ES8575-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG13 Rabbit Polyclonal Antibody |
ES8575-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG14L Rabbit Polyclonal Antibody |
ES8576-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG14L Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG14L Rabbit Polyclonal Antibody |
ES8576-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG14L Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NBR1 Rabbit Polyclonal Antibody |
ES8578-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NBR1 Rabbit Polyclonal Antibody |
ES8578-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NBR1 Rabbit Polyclonal Antibody |
ES8579-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NBR1 Rabbit Polyclonal Antibody |
ES8579-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
WIPI2 Rabbit Polyclonal Antibody |
ES8580-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against WIPI2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
WIPI2 Rabbit Polyclonal Antibody |
ES8580-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against WIPI2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
Gab1 Rabbit Polyclonal Antibody |
ES8582-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against Gab1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
Gab1 Rabbit Polyclonal Antibody |
ES8582-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against Gab1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ERK1 Rabbit Polyclonal Antibody |
ES8583-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ERK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ERK1 Rabbit Polyclonal Antibody |
ES8583-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ERK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
Met Rabbit Polyclonal Antibody |
ABP57458-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
Met Rabbit Polyclonal Antibody |
ABP57458-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
Met Rabbit Polyclonal Antibody |
ABP57458-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
VEGF Rabbit Polyclonal Antibody |
ABP57460-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
VEGF Rabbit Polyclonal Antibody |
ABP57460-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
VEGF Rabbit Polyclonal Antibody |
ABP57460-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
CD10 Rabbit Polyclonal Antibody |
ABP57461-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of CD10 of MME
- Applications tips:
|
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME |
CD10 Rabbit Polyclonal Antibody |
ABP57461-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of CD10 of MME
- Applications tips:
|
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME |
CD10 Rabbit Polyclonal Antibody |
ABP57461-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of CD10 of MME
- Applications tips:
|
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME |
NM23A Rabbit Polyclonal Antibody |
ABP57462-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of NM23A of NME1
- Applications tips:
|
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1 |
NM23A Rabbit Polyclonal Antibody |
ABP57462-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of NM23A of NME1
- Applications tips:
|
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1 |
NM23A Rabbit Polyclonal Antibody |
ABP57462-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of NM23A of NME1
- Applications tips:
|
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1 |
ATM Rabbit Polyclonal Antibody |
ABP57463-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
ATM Rabbit Polyclonal Antibody |
ABP57463-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
ATM Rabbit Polyclonal Antibody |
ABP57463-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
ATM Rabbit Polyclonal Antibody |
ABP57464-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
PPME1 Rabbit Polyclonal Antibody