 PTPRK Polyclonal Antibody |
|
ABP60040-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human PTPRK protein at amino acid sequence of 180-260
- Applications tips:
|
|
Description: A polyclonal antibody for detection of PTPRK from Human, Mouse. This PTPRK antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PTPRK protein at amino acid sequence of 180-260 |
PTPRK Polyclonal Antibody |
|
ES10142-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against PTPRK from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA |
PTPRK Polyclonal Antibody |
|
ES10142-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against PTPRK from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA |
 PTPRK Rabbit pAb |
|
A14773-100ul |
Abclonal |
100 ul |
EUR 308 |
PTPRK Rabbit pAb |
|
A14773-200ul |
Abclonal |
200 ul |
EUR 459 |
PTPRK Rabbit pAb |
|
A14773-20ul |
Abclonal |
20 ul |
EUR 183 |
PTPRK Rabbit pAb |
|
A14773-50ul |
Abclonal |
50 ul |
EUR 223 |
 PTPRK Antibody |
|
35901-100ul |
SAB |
100ul |
EUR 252 |
PTPRK Antibody |
|
1-CSB-PA613588LA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
|
|
Description: A polyclonal antibody against PTPRK. Recognizes PTPRK from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:200-1:500, IF:1:50-1:200 |
PTPRK Antibody |
|
DF9842 |
Affbiotech |
200ul |
EUR 304 |
|
Description: PTPRK Antibody detects endogenous levels of total PTPRK. |
 Rabbit PTPRK ELISA Kit |
|
ERTP0176 |
Abclonal |
96Tests |
EUR 521 |
 PTPRK Conjugated Antibody |
|
C35901 |
SAB |
100ul |
EUR 397 |
 Anti-PTPRK antibody |
|
STJ116973 |
St John's Laboratory |
100 µl |
EUR 277 |
|
Description: The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. This PTP possesses an extracellular region, a single transmembrane region, and two tandem catalytic domains, and thus represents a receptor-type PTP. The extracellular region contains a meprin-A5 antigen-PTP mu (MAM) domain, an Ig-like domain and four fibronectin type III-like repeats. This PTP was shown to mediate homophilic intercellular interaction, possibly through the interaction with beta- and gamma-catenin at adherens junctions. Expression of this gene was found to be stimulated by TGF-beta 1, which may be important for the inhibition of keratinocyte proliferation. |
Anti-PTPRK antibody |
|
STJ191300 |
St John's Laboratory |
200 µl |
EUR 197 |
|
Description: Unconjugated Rabbit polyclonal to PTPRK |
 PTPRK siRNA |
|
20-abx930410 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
PTPRK siRNA |
|
20-abx930411 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
 PTPRK Antibody, HRP conjugated |
|
1-CSB-PA613588LB01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
|
|
Description: A polyclonal antibody against PTPRK. Recognizes PTPRK from Human. This antibody is HRP conjugated. Tested in the following application: ELISA |
 PTPRK Antibody, FITC conjugated |
|
1-CSB-PA613588LC01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
|
|
Description: A polyclonal antibody against PTPRK. Recognizes PTPRK from Human. This antibody is FITC conjugated. Tested in the following application: ELISA |
 PTPRK Antibody, Biotin conjugated |
|
1-CSB-PA613588LD01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
|
|
Description: A polyclonal antibody against PTPRK. Recognizes PTPRK from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA |
 PTPRK Blocking Peptide |
|
DF9842-BP |
Affbiotech |
1mg |
EUR 195 |
 PTPRK cloning plasmid |
|
CSB-CL613588HU-10ug |
Cusabio |
10ug |
EUR 185 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 234
- Sequence: atggatacgactgcggcggcggcgctgcctgcttttgtggcgctcttgctcctctctccttggcctctcctgggatcggcccaaggccagttctccgcagtgtctgtgcttgtggtcggtaacttttgctgctgttgttctgctgctgtctgccattccattcgccatctatcacg
- Show more
|
|
Description: A cloning plasmid for the PTPRK gene. |
 polyclonal antibody) Protein tyrosine phosphatase receptor type K (PTPRK) polyclonal antibody |
|
ABP-PAB-11046 |
Allele Biotech |
100 ug |
Ask for price |
- Product line: Phosphatases
- Brand:
|
 Human PTPRK ELISA Kit |
|
EHP0176 |
Abclonal |
96Tests |
EUR 521 |
 Bovine PTPRK ELISA Kit |
|
EBP0176 |
Abclonal |
96Tests |
EUR 521 |
 Anserini PTPRK ELISA Kit |
|
EAP0176 |
Abclonal |
96Tests |
EUR 521 |
 Canine PTPRK ELISA Kit |
|
ECP0176 |
Abclonal |
96Tests |
EUR 521 |
 Goat PTPRK ELISA Kit |
|
EGTP0176 |
Abclonal |
96Tests |
EUR 521 |
 Mouse PTPRK shRNA Plasmid |
|
20-abx972307 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
 Human PTPRK shRNA Plasmid |
|
20-abx953918 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
 Porcine PTPRK ELISA Kit |
|
EPP0176 |
Abclonal |
96Tests |
EUR 521 |
 Rat PTPRK ELISA Kit |
|
ERP0176 |
Abclonal |
96Tests |
EUR 521 |
 Mouse PTPRK ELISA Kit |
|
EMP0176 |
Abclonal |
96Tests |
EUR 521 |
 Polyclonal Antibody (Human)) Protein Tyrosine Phosphatase Receptor Type K (PTPRK) Polyclonal Antibody (Human) |
|
4-PAB047Hu01 |
Cloud-Clone |
-
EUR 239.00
-
EUR 2391.00
-
EUR 598.00
-
EUR 299.00
-
EUR 211.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: PTPRK (Thr1185~Ser1440)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
|
Description: A Rabbit polyclonal antibody against Human Protein Tyrosine Phosphatase Receptor Type K (PTPRK) |
 Polyclonal Antibody (Human), APC) Protein Tyrosine Phosphatase Receptor Type K (PTPRK) Polyclonal Antibody (Human), APC |
|
4-PAB047Hu01-APC |
Cloud-Clone |
-
EUR 333.00
-
EUR 3113.00
-
EUR 872.00
-
EUR 423.00
-
EUR 215.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: PTPRK (Thr1185~Ser1440)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
|
Description: A Rabbit polyclonal antibody against Human Protein Tyrosine Phosphatase Receptor Type K (PTPRK). This antibody is labeled with APC. |
 Polyclonal Antibody (Human), Biotinylated) Protein Tyrosine Phosphatase Receptor Type K (PTPRK) Polyclonal Antibody (Human), Biotinylated |
|
4-PAB047Hu01-Biotin |
Cloud-Clone |
-
EUR 303.00
-
EUR 2341.00
-
EUR 697.00
-
EUR 369.00
-
EUR 216.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: PTPRK (Thr1185~Ser1440)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
|
Description: A Rabbit polyclonal antibody against Human Protein Tyrosine Phosphatase Receptor Type K (PTPRK). This antibody is labeled with Biotin. |
 Polyclonal Antibody (Human), Cy3) Protein Tyrosine Phosphatase Receptor Type K (PTPRK) Polyclonal Antibody (Human), Cy3 |
|
4-PAB047Hu01-Cy3 |
Cloud-Clone |
-
EUR 403.00
-
EUR 4109.00
-
EUR 1121.00
-
EUR 523.00
-
EUR 245.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: PTPRK (Thr1185~Ser1440)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
|
Description: A Rabbit polyclonal antibody against Human Protein Tyrosine Phosphatase Receptor Type K (PTPRK). This antibody is labeled with Cy3. |
 Polyclonal Antibody (Human), FITC) Protein Tyrosine Phosphatase Receptor Type K (PTPRK) Polyclonal Antibody (Human), FITC |
|
4-PAB047Hu01-FITC |
Cloud-Clone |
-
EUR 287.00
-
EUR 2510.00
-
EUR 717.00
-
EUR 359.00
-
EUR 192.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: PTPRK (Thr1185~Ser1440)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
|
Description: A Rabbit polyclonal antibody against Human Protein Tyrosine Phosphatase Receptor Type K (PTPRK). This antibody is labeled with FITC. |
 Polyclonal Antibody (Human), HRP) Protein Tyrosine Phosphatase Receptor Type K (PTPRK) Polyclonal Antibody (Human), HRP |
|
4-PAB047Hu01-HRP |
Cloud-Clone |
-
EUR 305.00
-
EUR 2714.00
-
EUR 772.00
-
EUR 383.00
-
EUR 203.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: PTPRK (Thr1185~Ser1440)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
|
Description: A Rabbit polyclonal antibody against Human Protein Tyrosine Phosphatase Receptor Type K (PTPRK). This antibody is labeled with HRP. |
 Polyclonal Antibody (Human), PE) Protein Tyrosine Phosphatase Receptor Type K (PTPRK) Polyclonal Antibody (Human), PE |
|
4-PAB047Hu01-PE |
Cloud-Clone |
-
EUR 287.00
-
EUR 2510.00
-
EUR 717.00
-
EUR 359.00
-
EUR 192.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: PTPRK (Thr1185~Ser1440)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
|
Description: A Rabbit polyclonal antibody against Human Protein Tyrosine Phosphatase Receptor Type K (PTPRK). This antibody is labeled with PE. |
 Guinea Pig PTPRK ELISA Kit |
|
EGP0176 |
Abclonal |
96Tests |
EUR 521 |
 (pORF)) Ptprk ORF Vector (Rat) (pORF) |
|
ORF074333 |
ABM |
1.0 ug DNA |
EUR 2080 |
PTPRK Rabbit Polyclonal Antibody
