Biocat Net

Amine biocat 3.0

PTPRK Rabbit Polyclonal Antibody

PTPRK Polyclonal Antibody

ABP60040-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human PTPRK protein at amino acid sequence of 180-260
  • Applications tips:
Description: A polyclonal antibody for detection of PTPRK from Human, Mouse. This PTPRK antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PTPRK protein at amino acid sequence of 180-260

PTPRK Polyclonal Antibody

ABP60040-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human PTPRK protein at amino acid sequence of 180-260
  • Applications tips:
Description: A polyclonal antibody for detection of PTPRK from Human, Mouse. This PTPRK antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PTPRK protein at amino acid sequence of 180-260

PTPRK Polyclonal Antibody

ABP60040-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human PTPRK protein at amino acid sequence of 180-260
  • Applications tips:
Description: A polyclonal antibody for detection of PTPRK from Human, Mouse. This PTPRK antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PTPRK protein at amino acid sequence of 180-260

PTPRK Rabbit pAb

A14773-100ul 100 ul
EUR 308

PTPRK Rabbit pAb

A14773-200ul 200 ul
EUR 459

PTPRK Rabbit pAb

A14773-20ul 20 ul
EUR 183

PTPRK Rabbit pAb

A14773-50ul 50 ul
EUR 223

PTPRK Antibody

ABD9842 100 ug
EUR 438

PTPRK Antibody

35901-100ul 100ul
EUR 252

PTPRK Antibody

DF9842 200ul
EUR 304
Description: PTPRK Antibody detects endogenous levels of total PTPRK.

PTPRK Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PTPRK. Recognizes PTPRK from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:200-1:500, IF:1:50-1:200


ERTP0176 96Tests
EUR 521

PTPRK Conjugated Antibody

C35901 100ul
EUR 397

Anti-PTPRK antibody

STJ116973 100 µl
EUR 277
Description: The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. This PTP possesses an extracellular region, a single transmembrane region, and two tandem catalytic domains, and thus represents a receptor-type PTP. The extracellular region contains a meprin-A5 antigen-PTP mu (MAM) domain, an Ig-like domain and four fibronectin type III-like repeats. This PTP was shown to mediate homophilic intercellular interaction, possibly through the interaction with beta- and gamma-catenin at adherens junctions. Expression of this gene was found to be stimulated by TGF-beta 1, which may be important for the inhibition of keratinocyte proliferation.

Anti-PTPRK antibody

STJ191300 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to PTPRK


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

PTPRK Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PTPRK. Recognizes PTPRK from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

PTPRK Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PTPRK. Recognizes PTPRK from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

PTPRK Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PTPRK. Recognizes PTPRK from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

PTPRK cloning plasmid

CSB-CL613588HU-10ug 10ug
EUR 185
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 234
  • Sequence: atggatacgactgcggcggcggcgctgcctgcttttgtggcgctcttgctcctctctccttggcctctcctgggatcggcccaaggccagttctccgcagtgtctgtgcttgtggtcggtaacttttgctgctgttgttctgctgctgtctgccattccattcgccatctatcacg
  • Show more
Description: A cloning plasmid for the PTPRK gene.

PTPRK Blocking Peptide

DF9842-BP 1mg
EUR 195

Protein tyrosine phosphatase receptor type K (PTPRK) polyclonal antibody

ABP-PAB-11046 100 ug Ask for price
    • Product line: Phosphatases
    • Brand:


EHP0176 96Tests
EUR 521


EGTP0176 96Tests
EUR 521


EBP0176 96Tests
EUR 521

Anserini PTPRK ELISA Kit

EAP0176 96Tests
EUR 521


ECP0176 96Tests
EUR 521


ELI-19769h 96 Tests
EUR 824

Mouse Ptprk ELISA KIT

ELI-22168m 96 Tests
EUR 865


EF005469 96 Tests
EUR 689


EPP0176 96Tests
EUR 521


ERP0176 96Tests
EUR 521


EMP0176 96Tests
EUR 521

Human PTPRK shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse PTPRK shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Protein Tyrosine Phosphatase Receptor Type K (PTPRK) Polyclonal Antibody (Human)

  • EUR 239.00
  • EUR 2391.00
  • EUR 598.00
  • EUR 299.00
  • EUR 211.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PTPRK (Thr1185~Ser1440)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Protein Tyrosine Phosphatase Receptor Type K (PTPRK)

Protein Tyrosine Phosphatase Receptor Type K (PTPRK) Polyclonal Antibody (Human), APC

  • EUR 333.00
  • EUR 3113.00
  • EUR 872.00
  • EUR 423.00
  • EUR 215.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PTPRK (Thr1185~Ser1440)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Protein Tyrosine Phosphatase Receptor Type K (PTPRK). This antibody is labeled with APC.

Protein Tyrosine Phosphatase Receptor Type K (PTPRK) Polyclonal Antibody (Human), Biotinylated

  • EUR 303.00
  • EUR 2341.00
  • EUR 697.00
  • EUR 369.00
  • EUR 216.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PTPRK (Thr1185~Ser1440)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Protein Tyrosine Phosphatase Receptor Type K (PTPRK). This antibody is labeled with Biotin.

Protein Tyrosine Phosphatase Receptor Type K (PTPRK) Polyclonal Antibody (Human), Cy3

  • EUR 403.00
  • EUR 4109.00
  • EUR 1121.00
  • EUR 523.00
  • EUR 245.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PTPRK (Thr1185~Ser1440)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Protein Tyrosine Phosphatase Receptor Type K (PTPRK). This antibody is labeled with Cy3.

Protein Tyrosine Phosphatase Receptor Type K (PTPRK) Polyclonal Antibody (Human), FITC

  • EUR 287.00
  • EUR 2510.00
  • EUR 717.00
  • EUR 359.00
  • EUR 192.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PTPRK (Thr1185~Ser1440)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Protein Tyrosine Phosphatase Receptor Type K (PTPRK). This antibody is labeled with FITC.

Protein Tyrosine Phosphatase Receptor Type K (PTPRK) Polyclonal Antibody (Human), HRP

  • EUR 305.00
  • EUR 2714.00
  • EUR 772.00
  • EUR 383.00
  • EUR 203.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PTPRK (Thr1185~Ser1440)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Protein Tyrosine Phosphatase Receptor Type K (PTPRK). This antibody is labeled with HRP.

Protein Tyrosine Phosphatase Receptor Type K (PTPRK) Polyclonal Antibody (Human), PE

  • EUR 287.00
  • EUR 2510.00
  • EUR 717.00
  • EUR 359.00
  • EUR 192.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PTPRK (Thr1185~Ser1440)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Protein Tyrosine Phosphatase Receptor Type K (PTPRK). This antibody is labeled with PE.

Guinea Pig PTPRK ELISA Kit

EGP0176 96Tests
EUR 521

PTPRK ORF Vector (Human) (pORF)

ORF008412 1.0 ug DNA
EUR 95

PTPRK Rabbit Polyclonal Antibody