RAB5B Polyclonal Antibody |
ABP60069-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from part region of human RAB5B protein at amino acid sequence of 90-170
- Applications tips:
|
Description: A polyclonal antibody for detection of RAB5B from Human, Mouse. This RAB5B antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human RAB5B protein at amino acid sequence of 90-170 |
RAB5B Polyclonal Antibody |
ABP60069-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human RAB5B protein at amino acid sequence of 90-170
- Applications tips:
|
Description: A polyclonal antibody for detection of RAB5B from Human, Mouse. This RAB5B antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human RAB5B protein at amino acid sequence of 90-170 |
RAB5B Rabbit pAb |
A7447-100ul |
Abclonal |
100 ul |
EUR 308 |
RAB5B Rabbit pAb |
A7447-200ul |
Abclonal |
200 ul |
EUR 459 |
RAB5B Rabbit pAb |
A7447-20ul |
Abclonal |
20 ul |
EUR 183 |
RAB5B Rabbit pAb |
A7447-50ul |
Abclonal |
50 ul |
EUR 223 |
Polyclonal RAB5B Antibody (Center) |
APR13055G |
Leading Biology |
0.1ml |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human RAB5B (Center). This antibody is tested and proven to work in the following applications: |
RAB5B antibody |
70R-5873 |
Fitzgerald |
50 ug |
EUR 467 |
Description: Rabbit polyclonal RAB5B antibody raised against the N terminal of RAB5B |
RAB5B Antibody |
46191-100ul |
SAB |
100ul |
EUR 252 |
RAB5B Antibody |
46191-50ul |
SAB |
50ul |
EUR 187 |
RAB5B antibody |
70R-19720 |
Fitzgerald |
50 ul |
EUR 435 |
Description: Rabbit polyclonal RAB5B antibody |
RAB5B Antibody |
DF9834 |
Affbiotech |
200ul |
EUR 304 |
Description: RAB5B Antibody detects endogenous levels of total RAB5B. |
RAB5B Antibody |
1-CSB-PA019214ESR1HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
|
Description: A polyclonal antibody against RAB5B. Recognizes RAB5B from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200 |
RAB5B Antibody |
1-CSB-PA019214ESR2HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
|
Description: A polyclonal antibody against RAB5B. Recognizes RAB5B from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200 |
RAB5B Antibody |
1-CSB-PA019214GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
|
Description: A polyclonal antibody against RAB5B. Recognizes RAB5B from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB |
RAB5B, Member RAS Oncogene Family (RAB5B) Antibody |
abx145141-100ug |
Abbexa |
100 ug |
EUR 391 |
- Shipped within 5-10 working days.
|
RAB5B, Member RAS Oncogene Family (RAB5B) Antibody |
20-abx006959 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
RAB5B, Member RAS Oncogene Family (RAB5B) Antibody |
abx030408-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
RAB5B, Member RAS Oncogene Family (RAB5B) Antibody |
abx030408-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
RAB5B, Member RAS Oncogene Family (RAB5B) Antibody |
20-abx321877 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
RAB5B, Member RAS Oncogene Family (RAB5B) Antibody |
20-abx321878 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
RAB5B, Member RAS Oncogene Family (RAB5B) Antibody |
20-abx218131 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
RAB5B, Member RAS Oncogene Family (RAB5B) Antibody |
abx237040-100ug |
Abbexa |
100 ug |
EUR 481 |
- Shipped within 5-12 working days.
|
RAB5B Conjugated Antibody |
C46191 |
SAB |
100ul |
EUR 397 |
anti- RAB5B antibody |
FNab07040 |
FN Test |
100µg |
EUR 505.25 |
- Immunogen: RAB5B, member RAS oncogene family
- Uniprot ID: P61020
- Gene ID: 5869
- Research Area: Cardiovascular, Signal Transduction
|
Description: Antibody raised against RAB5B |
Anti-Rab5b antibody |
STJ140061 |
St John's Laboratory |
200 µg |
EUR 231 |
Description: Goat polyclonal antibody to mouse Rab5b. Rab5b belongs to the small GTPase superfamily, Rab family. Rab5b is an Early Endosome Marker and functions as a key regulator of vesicular trafficking during early endocytosis. |
Anti-RAB5B antibody |
STJ191289 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to RAB5B |
RAB5B siRNA |
20-abx930695 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
RAB5B siRNA |
20-abx930696 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
RAB5B cloning plasmid |
CSB-CL019214HU-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 648
- Sequence: ATGACTAGCAGAAGCACAGCTAGGCCCAATGGGCAACCCCAGGCCAGCAAAATTTGCCAGTTCAAATTGGTCCTGCTGGGAGAATCTGCAGTGGGAAAGTCAAGCCTGGTATTACGTTTTGTCAAAGGGCAGTTCCATGAGTACCAGGAGAGCACCATTGGAGCGGCCTTCCTCAC
- Show more
|
Description: A cloning plasmid for the RAB5B gene. |
RAB5B Rabbit Polyclonal Antibody