RAB5B Rabbit Polyclonal Antibody

RAB5B Polyclonal Antibody
ABP60069-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human RAB5B protein at amino acid sequence of 90-170
  • Applications tips:
Description: A polyclonal antibody for detection of RAB5B from Human, Mouse. This RAB5B antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human RAB5B protein at amino acid sequence of 90-170

RAB5B Polyclonal Antibody
ABP60069-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human RAB5B protein at amino acid sequence of 90-170
  • Applications tips:
Description: A polyclonal antibody for detection of RAB5B from Human, Mouse. This RAB5B antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human RAB5B protein at amino acid sequence of 90-170

RAB5B Rabbit pAb
A7447-100ul 100 ul
EUR 308

RAB5B Rabbit pAb
A7447-200ul 200 ul
EUR 459

RAB5B Rabbit pAb
A7447-20ul 20 ul
EUR 183

RAB5B Rabbit pAb
A7447-50ul 50 ul
EUR 223

Polyclonal RAB5B Antibody (Center)
APR13055G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human RAB5B (Center). This antibody is tested and proven to work in the following applications:

RAB5B Antibody
ABD9834 100 ug
EUR 438

RAB5B antibody
70R-5873 50 ug
EUR 467
Description: Rabbit polyclonal RAB5B antibody raised against the N terminal of RAB5B

RAB5B Antibody
ABD13226 100 ug
EUR 438

RAB5B Antibody
46191-100ul 100ul
EUR 252

RAB5B Antibody
46191-50ul 50ul
EUR 187

RAB5B antibody
70R-19720 50 ul
EUR 435
Description: Rabbit polyclonal RAB5B antibody

RAB5B Antibody
DF9834 200ul
EUR 304
Description: RAB5B Antibody detects endogenous levels of total RAB5B.

RAB5B Antibody
1-CSB-PA019214ESR1HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against RAB5B. Recognizes RAB5B from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200

RAB5B Antibody
1-CSB-PA019214ESR2HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against RAB5B. Recognizes RAB5B from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200

RAB5B Antibody
1-CSB-PA019214GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against RAB5B. Recognizes RAB5B from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

RAB5B, Member RAS Oncogene Family (RAB5B) Antibody
abx145141-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

RAB5B, Member RAS Oncogene Family (RAB5B) Antibody
20-abx006959
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

RAB5B, Member RAS Oncogene Family (RAB5B) Antibody
abx030408-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

RAB5B, Member RAS Oncogene Family (RAB5B) Antibody
abx030408-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

RAB5B, Member RAS Oncogene Family (RAB5B) Antibody
20-abx321877
  • EUR 439.00
  • EUR 328.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

RAB5B, Member RAS Oncogene Family (RAB5B) Antibody
20-abx321878
  • EUR 439.00
  • EUR 328.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

RAB5B, Member RAS Oncogene Family (RAB5B) Antibody
20-abx218131
  • EUR 425.00
  • EUR 342.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

RAB5B, Member RAS Oncogene Family (RAB5B) Antibody
abx237040-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

RAB5B Conjugated Antibody
C46191 100ul
EUR 397

anti- RAB5B antibody
FNab07040 100µg
EUR 505.25
  • Immunogen: RAB5B, member RAS oncogene family
  • Uniprot ID: P61020
  • Gene ID: 5869
  • Research Area: Cardiovascular, Signal Transduction
Description: Antibody raised against RAB5B

Anti-RAB5B antibody
PAab07040 100 ug
EUR 355

Anti-RAB5B antibody
STJ29583 100 µl
EUR 277

Anti-Rab5b antibody
STJ140061 200 µg
EUR 231
Description: Goat polyclonal antibody to mouse Rab5b. Rab5b belongs to the small GTPase superfamily, Rab family. Rab5b is an Early Endosome Marker and functions as a key regulator of vesicular trafficking during early endocytosis.

Anti-RAB5B antibody
STJ191289 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to RAB5B

RAB5B siRNA
20-abx930695
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

RAB5B siRNA
20-abx930696
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

RAB5B cloning plasmid
CSB-CL019214HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 648
  • Sequence: ATGACTAGCAGAAGCACAGCTAGGCCCAATGGGCAACCCCAGGCCAGCAAAATTTGCCAGTTCAAATTGGTCCTGCTGGGAGAATCTGCAGTGGGAAAGTCAAGCCTGGTATTACGTTTTGTCAAAGGGCAGTTCCATGAGTACCAGGAGAGCACCATTGGAGCGGCCTTCCTCAC
  • Show more
Description: A cloning plasmid for the RAB5B gene.

RAB5B Rabbit Polyclonal Antibody