Biocat Net

Amine biocat 3.0

RAB6B Rabbit Polyclonal Antibody

RAB6B Polyclonal Antibody

ES10132-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against RAB6B from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

RAB6B Polyclonal Antibody

ES10132-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against RAB6B from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

RAB6B antibody

70R-19722 50 ul
EUR 435
Description: Rabbit polyclonal RAB6B antibody

Rab6B antibody

10R-2996 100 ug
EUR 282
Description: Rat monoclonal Rab6B antibody

RAB6B Antibody

46192-100ul 100ul
EUR 252

RAB6B Antibody

46192-50ul 50ul
EUR 187

RAB6B Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RAB6B. Recognizes RAB6B from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:500-1:2000, IHC:1:20-1:200

RAB6B Antibody

DF9835 200ul
EUR 304
Description: RAB6B Antibody detects endogenous levels of total RAB6B.

RAB6B Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against RAB6B. Recognizes RAB6B from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

RAB6B Antibody

ABD9835 100 ug
EUR 438

RAB6B Polyclonal Antibody, Biotin Conjugated

A60507 100 µg
EUR 570.55
Description: The best epigenetics products

RAB6B Polyclonal Antibody, FITC Conjugated

A60508 100 µg
EUR 570.55
Description: kits suitable for this type of research

RAB6B Polyclonal Antibody, HRP Conjugated

A60509 100 µg
EUR 570.55
Description: fast delivery possible

RAB6B Conjugated Antibody

C46192 100ul
EUR 397

RAB6B Antibody (HRP)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

RAB6B Antibody (FITC)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

RAB6B Antibody (Biotin)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

anti- RAB6B antibody

FNab07042 100µg
EUR 505.25
  • Immunogen: RAB6B, member RAS oncogene family
  • Uniprot ID: Q9NRW1
  • Gene ID: 51560
  • Research Area: Signal Transduction
Description: Antibody raised against RAB6B

Anti-RAB6B antibody

PAab07042 100 ug
EUR 355

Anti-RAB6B antibody

STJ13100309 100 µl
EUR 427

Anti-RAB6B antibody

STJ191290 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to RAB6B


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

RAB6B Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RAB6B. Recognizes RAB6B from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

RAB6B Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RAB6B. Recognizes RAB6B from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

RAB6B Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RAB6B. Recognizes RAB6B from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

RAB6B Blocking Peptide

DF9835-BP 1mg
EUR 195

RAB6B cloning plasmid

CSB-CL873642HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 627
  • Sequence: atgtccgcagggggagattttgggaatccactgagaaaattcaagttggtgttcttgggggagcagagcgtcgggaagacgtctctgattacgaggttcatgtacgacagcttcgacaacacataccaggcaaccattgggattgacttcttgtcaaaaaccatgtacttggagga
  • Show more
Description: A cloning plasmid for the RAB6B gene.

RAB6B protein (His tag)

80R-1676 100 ug
EUR 305
Description: Purified recombinant Human RAB6B protein


EF002257 96 Tests
EUR 689

Human RAB6B shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse RAB6B shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

RAB6B Recombinant Protein (Human)

RP025540 100 ug Ask for price

RAB6B Recombinant Protein (Mouse)

RP166367 100 ug Ask for price

RAB6B Recombinant Protein (Rat)

RP223382 100 ug Ask for price

RAB6B Rabbit Polyclonal Antibody