RAB6B Polyclonal Antibody |
ES10132-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against RAB6B from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA |
RAB6B Polyclonal Antibody |
ES10132-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against RAB6B from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA |
RAB6B antibody |
70R-19722 |
Fitzgerald |
50 ul |
EUR 435 |
Description: Rabbit polyclonal RAB6B antibody |
Rab6B antibody |
10R-2996 |
Fitzgerald |
100 ug |
EUR 282 |
Description: Rat monoclonal Rab6B antibody |
RAB6B Antibody |
46192-100ul |
SAB |
100ul |
EUR 252 |
RAB6B Antibody |
46192-50ul |
SAB |
50ul |
EUR 187 |
RAB6B Antibody |
1-CSB-PA873642LA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against RAB6B. Recognizes RAB6B from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:500-1:2000, IHC:1:20-1:200 |
RAB6B Antibody |
DF9835 |
Affbiotech |
200ul |
EUR 304 |
Description: RAB6B Antibody detects endogenous levels of total RAB6B. |
RAB6B Antibody |
1-CSB-PA019217GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
|
Description: A polyclonal antibody against RAB6B. Recognizes RAB6B from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC |
RAB6B Polyclonal Antibody, Biotin Conjugated |
A60507 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: The best epigenetics products |
RAB6B Polyclonal Antibody, FITC Conjugated |
A60508 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: kits suitable for this type of research |
RAB6B Polyclonal Antibody, HRP Conjugated |
A60509 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: fast delivery possible |
RAB6B Conjugated Antibody |
C46192 |
SAB |
100ul |
EUR 397 |
RAB6B Antibody (HRP) |
20-abx311243 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
RAB6B Antibody (FITC) |
20-abx311244 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
RAB6B Antibody (Biotin) |
20-abx311245 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
anti- RAB6B antibody |
FNab07042 |
FN Test |
100µg |
EUR 505.25 |
- Immunogen: RAB6B, member RAS oncogene family
- Uniprot ID: Q9NRW1
- Gene ID: 51560
- Research Area: Signal Transduction
|
Description: Antibody raised against RAB6B |
Anti-RAB6B antibody |
STJ191290 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to RAB6B |
RAB6B siRNA |
20-abx930701 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
RAB6B siRNA |
20-abx930702 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
RAB6B Antibody, HRP conjugated |
1-CSB-PA873642LB01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against RAB6B. Recognizes RAB6B from Human. This antibody is HRP conjugated. Tested in the following application: ELISA |
RAB6B Antibody, FITC conjugated |
1-CSB-PA873642LC01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against RAB6B. Recognizes RAB6B from Human. This antibody is FITC conjugated. Tested in the following application: ELISA |
RAB6B Antibody, Biotin conjugated |
1-CSB-PA873642LD01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against RAB6B. Recognizes RAB6B from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA |
RAB6B Blocking Peptide |
DF9835-BP |
Affbiotech |
1mg |
EUR 195 |
RAB6B cloning plasmid |
CSB-CL873642HU-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 627
- Sequence: atgtccgcagggggagattttgggaatccactgagaaaattcaagttggtgttcttgggggagcagagcgtcgggaagacgtctctgattacgaggttcatgtacgacagcttcgacaacacataccaggcaaccattgggattgacttcttgtcaaaaaccatgtacttggagga
- Show more
|
Description: A cloning plasmid for the RAB6B gene. |
RAB6B protein (His tag) |
80R-1676 |
Fitzgerald |
100 ug |
EUR 305 |
Description: Purified recombinant Human RAB6B protein |
Human RAB6B shRNA Plasmid |
20-abx959832 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Mouse RAB6B shRNA Plasmid |
20-abx983106 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
RAB6B Recombinant Protein (Human) |
RP025540 |
ABM |
100 ug |
Ask for price |
RAB6B Recombinant Protein (Mouse) |
RP166367 |
ABM |
100 ug |
Ask for price |
RAB6B Recombinant Protein (Rat) |
RP223382 |
ABM |
100 ug |
Ask for price |
RAB6B Rabbit Polyclonal Antibody