RBBP6 Rabbit Polyclonal Antibody

RBBP6 Polyclonal Antibody

ABP60112-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human RBBP6 protein at amino acid sequence of 270-350
  • Applications tips:
Description: A polyclonal antibody for detection of RBBP6 from Human, Mouse. This RBBP6 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human RBBP6 protein at amino acid sequence of 270-350

RBBP6 Polyclonal Antibody

30775-100ul 100ul
EUR 252

RBBP6 Polyclonal Antibody

30775-50ul 50ul
EUR 187

RBBP6 Polyclonal Antibody

28700-100ul 100ul
EUR 252

RBBP6 Polyclonal Antibody

28700-50ul 50ul
EUR 187

RBBP6 Rabbit pAb

A14776-100ul 100 ul
EUR 308

RBBP6 Rabbit pAb

A14776-200ul 200 ul
EUR 459

RBBP6 Rabbit pAb

A14776-20ul 20 ul
EUR 183

RBBP6 Rabbit pAb

A14776-50ul 50 ul
EUR 223

RBBP6 Rabbit pAb

A6966-100ul 100 ul
EUR 308

RBBP6 Rabbit pAb

A6966-200ul 200 ul
EUR 459

RBBP6 Rabbit pAb

A6966-20ul 20 ul
EUR 183

RBBP6 Rabbit pAb

A6966-50ul 50 ul
EUR 223

RBBP6 Polyclonal Conjugated Antibody

C30775 100ul
EUR 397

RBBP6 Polyclonal Conjugated Antibody

C28700 100ul
EUR 397

RBBP6 Antibody

ABD9853 100 ug
EUR 438

RBBP6 antibody

70R-51322 100 ul
EUR 244
Description: Purified Polyclonal RBBP6 antibody

RBBP6 antibody

70R-5583 50 ug
EUR 467
Description: Rabbit polyclonal RBBP6 antibody raised against the N terminal of RBBP6

RBBP6 Antibody

39226-100ul 100ul
EUR 390

RBBP6 Antibody

39408-100ul 100ul
EUR 390

RBBP6 antibody

70R-19797 50 ul
EUR 435
Description: Rabbit polyclonal RBBP6 antibody

RBBP6 Antibody

DF9853 200ul
EUR 304
Description: RBBP6 Antibody detects endogenous levels of total RBBP6.

RBBP6 Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RBBP6. Recognizes RBBP6 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:500-1:5000, IHC:1:20-1:200, IF:1:50-1:200

RBBP6 Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against RBBP6. Recognizes RBBP6 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB

Histone-Binding Protein RBBP6 (RBBP6) Antibody

abx038306-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Histone-Binding Protein RBBP6 (RBBP6) Antibody

abx038417-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Histone-Binding Protein RBBP6 (RBBP6) Antibody

abx038470-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Histone-Binding Protein RBBP6 (RBBP6) Antibody

  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

Histone-Binding Protein RBBP6 (RBBP6) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Histone-Binding Protein RBBP6 (RBBP6) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Histone-Binding Protein RBBP6 (RBBP6) Antibody

abx237152-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

Histone-Binding Protein RBBP6 (RBBP6) Antibody (HRP)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Histone-Binding Protein RBBP6 (RBBP6) Antibody (FITC)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Histone-Binding Protein RBBP6 (RBBP6) Antibody (Biotin)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Polyclonal RBBP6 antibody - N-terminal region

APR00874G 0.05mg
EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human RBBP6 - N-terminal region. This antibody is tested and proven to work in the following applications:

anti- RBBP6 antibody

FNab07152 100µg
EUR 548.75
  • Immunogen: retinoblastoma binding protein 6
  • Uniprot ID: Q7Z6E9
  • Gene ID: 5930
  • Research Area: Epigenetics, Immunology, Metabolism
Description: Antibody raised against RBBP6

Anti-RBBP6 antibody

PAab07152 100 ug
EUR 386

Anti-RBBP6 antibody

STJ29046 100 µl
EUR 277
Description: The retinoblastoma tumor suppressor (pRB) protein binds with many other proteins. In various human cancers, pRB suppresses cellular proliferation and is inactivated. Cell cycle-dependent phosphorylation regulates the activity of pRB. This gene encodes a protein which binds to underphosphorylated but not phosphorylated pRB. Multiple alternatively spliced transcript variants that encode different isoforms have been found for this gene.

Anti-RBBP6 antibody

STJ116976 100 µl
EUR 277
Description: The retinoblastoma tumor suppressor (pRB) protein binds with many other proteins. In various human cancers, pRB suppresses cellular proliferation and is inactivated. Cell cycle-dependent phosphorylation regulates the activity of pRB. This gene encodes a protein which binds to underphosphorylated but not phosphorylated pRB. Multiple alternatively spliced transcript variants that encode different isoforms have been found for this gene.

Anti-RBBP6 antibody

STJ191314 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to RBBP6


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

RBBP6 Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RBBP6. Recognizes RBBP6 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

RBBP6 Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RBBP6. Recognizes RBBP6 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

RBBP6 Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RBBP6. Recognizes RBBP6 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Human Histone-binding protein RBBP6 (RBBP6) ELISA Kit

abx382708-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

RBBP6 Blocking Peptide

  • EUR 272.00
  • EUR 411.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.

RBBP6 Blocking Peptide

33R-1433 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of RBBP6 antibody, catalog no. 70R-5583

RBBP6 Blocking Peptide

DF9853-BP 1mg
EUR 195

RBBP6 cloning plasmid

CSB-CL768776HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 357
  • Sequence: atgtcctgtgtgcattataaattttcctctaaactcaactatgataccgtcacctttgatgggctccacatctccctctgcgacttaaagaagcagattatggggagagagaagctgaaagctgccgactgcgacctgcagatcaccaatgcgcagacgaaagaagaatatactga
  • Show more
Description: A cloning plasmid for the RBBP6 gene.

Mouse E3 ubiquitin- protein ligase RBBP6, Rbbp6 ELISA KIT

ELI-36000m 96 Tests
EUR 865

Human E3 ubiquitin- protein ligase RBBP6, RBBP6 ELISA KIT

ELI-36042h 96 Tests
EUR 824


EF002342 96 Tests
EUR 689

Human RBBP6 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse RBBP6 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Retinoblastoma Binding Protein 6 (RBBP6) Antibody

  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Monoclonal RBBP6 Antibody (monoclonal) (M01), Clone: 5A11

AMM03998G 0.1mg
EUR 484
Description: A Monoclonal antibody against Human RBBP6 (monoclonal) (M01). The antibodies are raised in Mouse and are from clone 5A11. This antibody is applicable in WB, IHC and IF, E

RBBP6 ORF Vector (Human) (pORF)

ORF008623 1.0 ug DNA
EUR 95

Rbbp6 ORF Vector (Mouse) (pORF)

ORF055675 1.0 ug DNA
EUR 506

RBBP6 Rabbit Polyclonal Antibody