 RGS17 Polyclonal Antibody |
|
ABP60153-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from part region of human RGS17 protein at amino acid sequence of 70-150
- Applications tips:
|
|
Description: A polyclonal antibody for detection of RGS17 from Human, Mouse. This RGS17 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human RGS17 protein at amino acid sequence of 70-150 |
RGS17 Polyclonal Antibody |
|
ABP60153-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human RGS17 protein at amino acid sequence of 70-150
- Applications tips:
|
|
Description: A polyclonal antibody for detection of RGS17 from Human, Mouse. This RGS17 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human RGS17 protein at amino acid sequence of 70-150 |
RGS17 Polyclonal Antibody |
|
29434-100ul |
SAB |
100ul |
EUR 252 |
RGS17 Polyclonal Antibody |
|
29434-50ul |
SAB |
50ul |
EUR 187 |
 RGS17 Rabbit pAb |
|
A15815-100ul |
Abclonal |
100 ul |
EUR 308 |
RGS17 Rabbit pAb |
|
A15815-200ul |
Abclonal |
200 ul |
EUR 459 |
RGS17 Rabbit pAb |
|
A15815-20ul |
Abclonal |
20 ul |
EUR 183 |
RGS17 Rabbit pAb |
|
A15815-50ul |
Abclonal |
50 ul |
EUR 223 |
 RGS17 Polyclonal Conjugated Antibody |
|
C29434 |
SAB |
100ul |
EUR 397 |
 RGS17 antibody |
|
70R-51373 |
Fitzgerald |
100 ul |
EUR 244 |
|
Description: Purified Polyclonal RGS17 antibody |
RGS17 antibody |
|
22501-100ul |
SAB |
100ul |
EUR 390 |
RGS17 antibody |
|
70R-13010 |
Fitzgerald |
100 ul |
EUR 457 |
|
Description: Affinity purified Rabbit polyclonal RGS17 antibody |
 RGS17 Antibody |
|
DF9844 |
Affbiotech |
200ul |
EUR 304 |
|
Description: RGS17 Antibody detects endogenous levels of total RGS17. |
) Polyclonal RGS17 / RGSZ2 Antibody (C-Term) |
|
AMM07585G |
Leading Biology |
0.1 mg |
EUR 484 |
|
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human RGS17 / RGSZ2 (C-Term). This antibody is tested and proven to work in the following applications: |
 Polyclonal RGS17 Antibody - C-terminal region |
|
AMM07586G |
Leading Biology |
0.05mg |
EUR 528 |
|
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human RGS17 - C-terminal region. This antibody is tested and proven to work in the following applications: |
 anti- RGS17 antibody |
|
FNab07268 |
FN Test |
100µg |
EUR 548.75 |
- Immunogen: regulator of G-protein signaling 17
- Uniprot ID: Q9UGC6
- Gene ID: 26575
- Research Area: Signal Transduction
|
|
Description: Antibody raised against RGS17 |
 Anti-RGS17 antibody |
|
STJ191305 |
St John's Laboratory |
200 µl |
EUR 197 |
|
Description: Unconjugated Rabbit polyclonal to RGS17 |
 RGS17 siRNA |
|
20-abx931398 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
RGS17 siRNA |
|
20-abx931399 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
 anti-RGS17 |
|
YF-PA26007 |
Abfrontier |
50 ul |
EUR 334 |
|
Description: Mouse polyclonal to RGS17 |
 Human RGS17/RGSZ2 Antibody |
|
32841-05111 |
AssayPro |
150 ug |
EUR 261 |
 RGS17 cloning plasmid |
|
CSB-CL019648HU-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 633
- Sequence: atgcgaaaaaggcagcagtcccaaaatgaaggaacacctgccgtgtctcaagctcctggaaaccagaggcccaacaacacctgttgcttttgttggtgctgttgttgcagctgctcctgcctcactgtgaggaatgaagaaagaggggaaaatgcgggaagacccacacacactac
- Show more
|
|
Description: A cloning plasmid for the RGS17 gene. |
 RGS17 Blocking Peptide |
|
20-abx064248 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
RGS17 Blocking Peptide |
|
DF9844-BP |
Affbiotech |
1mg |
EUR 195 |
) Anti-RGS17 (2H4) |
|
YF-MA18126 |
Abfrontier |
200 ul |
EUR 363 |
|
Description: Mouse monoclonal to RGS17 |
) Human RGS17/RGSZ2 Antibody (Biotin Conjugate) |
|
32841-05121 |
AssayPro |
150 ug |
EUR 369 |
 Mouse RGS17 shRNA Plasmid |
|
20-abx974830 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
 Human RGS17 shRNA Plasmid |
|
20-abx958861 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
) RGS17 protein (His tag) |
|
80R-1956 |
Fitzgerald |
100 ug |
EUR 322 |
|
Description: Recombinant human RGS17 protein |
) RGS17 Recombinant Protein (Human) |
|
RP026308 |
ABM |
100 ug |
Ask for price |
) RGS17 Recombinant Protein (Rat) |
|
RP225941 |
ABM |
100 ug |
Ask for price |
) RGS17 Recombinant Protein (Mouse) |
|
RP167882 |
ABM |
100 ug |
Ask for price |
RGS17 Recombinant Protein (Mouse) |
|
RP167885 |
ABM |
100 ug |
Ask for price |
) Human RGS17/RGSZ2 AssayLite Antibody (FITC Conjugate) |
|
32841-05141 |
AssayPro |
150 ug |
EUR 428 |
) Human RGS17/RGSZ2 AssayLite Antibody (RPE Conjugate) |
|
32841-05151 |
AssayPro |
150 ug |
EUR 428 |
) Human RGS17/RGSZ2 AssayLite Antibody (APC Conjugate) |
|
32841-05161 |
AssayPro |
150 ug |
EUR 428 |
) Human RGS17/RGSZ2 AssayLite Antibody (PerCP Conjugate) |
|
32841-05171 |
AssayPro |
150 ug |
EUR 471 |
 (pORF)) RGS17 ORF Vector (Human) (pORF) |
|
ORF008770 |
ABM |
1.0 ug DNA |
EUR 95 |
 (pORF)) Rgs17 ORF Vector (Mouse) (pORF) |
|
ORF055962 |
ABM |
1.0 ug DNA |
EUR 506 |
Rgs17 ORF Vector (Mouse) (pORF) |
|
ORF055963 |
ABM |
1.0 ug DNA |
EUR 506 |
 (pORF)) Rgs17 ORF Vector (Rat) (pORF) |
|
ORF075315 |
ABM |
1.0 ug DNA |
EUR 506 |
 ELISA kit) Rabbit Regulator of G protein signaling 17(RGS17) ELISA kit |
|
E04R0408-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A competitive ELISA for quantitative measurement of Rabbit Regulator of G protein signaling 17(RGS17) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit Regulator of G protein signaling 17(RGS17) ELISA kit |
|
E04R0408-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A competitive ELISA for quantitative measurement of Rabbit Regulator of G protein signaling 17(RGS17) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit Regulator of G protein signaling 17(RGS17) ELISA kit |
|
E04R0408-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A competitive ELISA for quantitative measurement of Rabbit Regulator of G protein signaling 17(RGS17) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
RGS17 Rabbit Polyclonal Antibody
