RHPN2 Rabbit Polyclonal Antibody

RHPN2 Polyclonal Antibody

ABP60172-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human RHPN2 protein at amino acid sequence of 110-190
  • Applications tips:
Description: A polyclonal antibody for detection of RHPN2 from Human, Mouse. This RHPN2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human RHPN2 protein at amino acid sequence of 110-190

RHPN2 Polyclonal Antibody

ABP60172-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human RHPN2 protein at amino acid sequence of 110-190
  • Applications tips:
Description: A polyclonal antibody for detection of RHPN2 from Human, Mouse. This RHPN2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human RHPN2 protein at amino acid sequence of 110-190

anti- RHPN2 antibody

FNab07290 100µg
EUR 548.75
  • Immunogen: rhophilin, Rho GTPase binding protein 2
  • Uniprot ID: Q8IUC4
  • Gene ID: 85415
  • Research Area: Signal Transduction
Description: Antibody raised against RHPN2

Anti-RHPN2 antibody

PAab07290 100 ug
EUR 386

Anti-RHPN2 antibody

STJ191329 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to RHPN2


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


YF-PA27648 50 ug
EUR 363
Description: Mouse polyclonal to RHPN2

RHPN2 cloning plasmid

CSB-CL815544HU-10ug 10ug
EUR 686
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2061
  • Sequence: atgaccgacgcgctgttgcccgcggccccccagccgctggagaagaagaacgacggctactttcggaagggctgtaatccccttgcacaaaccggccggagtaaattgcagaatcaaagagctgctttgaatcagcagatcctgaaagccgtgcggatgaggaccggagcggaaa
  • Show more
Description: A cloning plasmid for the RHPN2 gene.

Mouse RHPN2 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human RHPN2 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.


EF002458 96 Tests
EUR 689


ELI-38888d 96 Tests
EUR 928

RHPN2 Recombinant Protein (Human)

RP026419 100 ug Ask for price

RHPN2 Recombinant Protein (Rat)

RP226100 100 ug Ask for price

RHPN2 Recombinant Protein (Mouse)

RP168161 100 ug Ask for price

RHPN2 ORF Vector (Human) (pORF)

ORF008807 1.0 ug DNA
EUR 95

Rhpn2 ORF Vector (Mouse) (pORF)

ORF056055 1.0 ug DNA
EUR 506

Rhpn2 ORF Vector (Rat) (pORF)

ORF075368 1.0 ug DNA
EUR 506

Rhophilin Rho GTPase Binding Protein 2 (RHPN2) Antibody

abx145071-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Rhophilin Rho GTPase Binding Protein 2 (RHPN2) Antibody

abx030913-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Rhophilin Rho GTPase Binding Protein 2 (RHPN2) Antibody

abx030913-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Rhophilin Rho GTPase Binding Protein 2 (RHPN2) Antibody

abx237290-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

Human Rhophilin- 2, RHPN2 ELISA KIT

ELI-18105h 96 Tests
EUR 824

Bovine Rhophilin- 2, RHPN2 ELISA KIT

ELI-19310b 96 Tests
EUR 928

Mouse Rhophilin- 2, Rhpn2 ELISA KIT

ELI-52668m 96 Tests
EUR 865

Human Rhophilin 2 (RHPN2)ELISA Kit

201-12-2513 96 tests
EUR 440
  • This Rhophilin 2 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

RHPN2 sgRNA CRISPR Lentivector set (Human)

K1822701 3 x 1.0 ug
EUR 339

Rhpn2 sgRNA CRISPR Lentivector set (Rat)

K6103001 3 x 1.0 ug
EUR 339

Rhpn2 sgRNA CRISPR Lentivector set (Mouse)

K4853001 3 x 1.0 ug
EUR 339

Human Rhophilin 2(RHPN2)ELISA Kit

QY-E04649 96T
EUR 394

RHPN2 sgRNA CRISPR Lentivector (Human) (Target 1)

K1822702 1.0 ug DNA
EUR 154

RHPN2 sgRNA CRISPR Lentivector (Human) (Target 2)

K1822703 1.0 ug DNA
EUR 154

RHPN2 sgRNA CRISPR Lentivector (Human) (Target 3)

K1822704 1.0 ug DNA
EUR 154

Rhpn2 sgRNA CRISPR Lentivector (Rat) (Target 1)

K6103002 1.0 ug DNA
EUR 154

Rhpn2 sgRNA CRISPR Lentivector (Rat) (Target 2)

K6103003 1.0 ug DNA
EUR 154

Rhpn2 sgRNA CRISPR Lentivector (Rat) (Target 3)

K6103004 1.0 ug DNA
EUR 154

Rhpn2 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4853002 1.0 ug DNA
EUR 154

Rhpn2 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4853003 1.0 ug DNA
EUR 154

Rhpn2 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4853004 1.0 ug DNA
EUR 154

RHPN2 Protein Vector (Human) (pPB-C-His)

PV035225 500 ng
EUR 329

RHPN2 Protein Vector (Human) (pPB-N-His)

PV035226 500 ng
EUR 329

RHPN2 Protein Vector (Human) (pPM-C-HA)

PV035227 500 ng
EUR 329

RHPN2 Protein Vector (Human) (pPM-C-His)

PV035228 500 ng
EUR 329

RHPN2 Protein Vector (Rat) (pPB-C-His)

PV301470 500 ng
EUR 1166

RHPN2 Protein Vector (Rat) (pPB-N-His)

PV301471 500 ng
EUR 1166

RHPN2 Protein Vector (Rat) (pPM-C-HA)

PV301472 500 ng
EUR 1166

RHPN2 Protein Vector (Rat) (pPM-C-His)

PV301473 500 ng
EUR 1166

RHPN2 Protein Vector (Mouse) (pPB-C-His)

PV224218 500 ng
EUR 1065

RHPN2 Protein Vector (Mouse) (pPB-N-His)

PV224219 500 ng
EUR 1065

RHPN2 Protein Vector (Mouse) (pPM-C-HA)

PV224220 500 ng
EUR 1065

RHPN2 Protein Vector (Mouse) (pPM-C-His)

PV224221 500 ng
EUR 1065

Rhpn2 3'UTR GFP Stable Cell Line

TU167875 1.0 ml Ask for price

RHPN2 3'UTR Luciferase Stable Cell Line

TU019903 1.0 ml
EUR 1394

Rhpn2 3'UTR Luciferase Stable Cell Line

TU117875 1.0 ml Ask for price

RHPN2 3'UTR GFP Stable Cell Line

TU069903 1.0 ml
EUR 1394

Rhpn2 3'UTR Luciferase Stable Cell Line

TU219428 1.0 ml Ask for price

Rhpn2 3'UTR GFP Stable Cell Line

TU269428 1.0 ml Ask for price

VEGF Rabbit Polyclonal Antibody

ES8453-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

VEGF Rabbit Polyclonal Antibody

ES8453-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody

ES8454-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody

ES8454-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody

ES8455-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody

ES8455-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8456-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8456-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8457-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8457-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSC70 Rabbit Polyclonal Antibody

ES8558-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSC70 Rabbit Polyclonal Antibody

ES8558-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody

ES8559-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody

ES8559-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP90? Rabbit Polyclonal Antibody

ES8560-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSP90? Rabbit Polyclonal Antibody

ES8560-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

RHPN2 Rabbit Polyclonal Antibody