Biocat Net

RHPN2 Polyclonal Antibody
ES10171-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against RHPN2 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

RHPN2 Polyclonal Antibody
ES10171-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against RHPN2 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

anti- RHPN2 antibody
FNab07290	FN Test	100µg	EUR 548.75
Immunogen: rhophilin, Rho GTPase binding protein 2 Uniprot ID: Q8IUC4 Gene ID: 85415 Research Area: Signal Transduction
Description: Antibody raised against RHPN2

Anti-RHPN2 antibody
PAab07290	Lifescience Market	100 ug	EUR 386

Anti-RHPN2 antibody
STJ191329	St John's Laboratory	200 µl	EUR 197
Description: Unconjugated Rabbit polyclonal to RHPN2

RHPN2 siRNA
20-abx931502	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

RHPN2 siRNA
20-abx931503	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

anti-RHPN2
YF-PA27648	Abfrontier	50 ug	EUR 363
Description: Mouse polyclonal to RHPN2

RHPN2 cloning plasmid
CSB-CL815544HU-10ug	Cusabio	10ug	EUR 686
Formulation: 10 μg plasmid + 200μl Glycerol Length: 2061 Sequence: atgaccgacgcgctgttgcccgcggccccccagccgctggagaagaagaacgacggctactttcggaagggctgtaatccccttgcacaaaccggccggagtaaattgcagaatcaaagagctgctttgaatcagcagatcctgaaagccgtgcggatgaggaccggagcggaaa Show more
Description: A cloning plasmid for the RHPN2 gene.

RHPN2 ELISA KIT|Human
EF002458	Lifescience Market	96 Tests	EUR 689

Mouse RHPN2 shRNA Plasmid
20-abx974234	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Human RHPN2 shRNA Plasmid
20-abx963802	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Canine RHPN2 ELISA KIT
ELI-38888d	Lifescience Market	96 Tests	EUR 928

RHPN2 Recombinant Protein (Human)
RP026419	ABM	100 ug	Ask for price

RHPN2 Recombinant Protein (Mouse)
RP168161	ABM	100 ug	Ask for price

RHPN2 Recombinant Protein (Rat)
RP226100	ABM	100 ug	Ask for price

Rhpn2 ORF Vector (Rat) (pORF)
ORF075368	ABM	1.0 ug DNA	EUR 506

RHPN2 ORF Vector (Human) (pORF)
ORF008807	ABM	1.0 ug DNA	EUR 95

Rhpn2 ORF Vector (Mouse) (pORF)
ORF056055	ABM	1.0 ug DNA	EUR 506

Rhophilin Rho GTPase Binding Protein 2 (RHPN2) Antibody
abx145071-100ug	Abbexa	100 ug	EUR 391
Shipped within 5-10 working days.

Rhophilin Rho GTPase Binding Protein 2 (RHPN2) Antibody
abx030913-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

Rhophilin Rho GTPase Binding Protein 2 (RHPN2) Antibody
abx030913-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

Rhophilin Rho GTPase Binding Protein 2 (RHPN2) Antibody
abx237290-100ug	Abbexa	100 ug	EUR 509
Shipped within 5-12 working days.

Human Rhophilin 2 (RHPN2)ELISA Kit
201-12-2513	SunredBio	96 tests	EUR 440
This Rhophilin 2 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Rhophilin- 2, RHPN2 ELISA KIT
ELI-18105h	Lifescience Market	96 Tests	EUR 824

Bovine Rhophilin- 2, RHPN2 ELISA KIT
ELI-19310b	Lifescience Market	96 Tests	EUR 928

Mouse Rhophilin- 2, Rhpn2 ELISA KIT
ELI-52668m	Lifescience Market	96 Tests	EUR 865

Rhpn2 sgRNA CRISPR Lentivector set (Mouse)
K4853001	ABM	3 x 1.0 ug	EUR 339

Rhpn2 sgRNA CRISPR Lentivector set (Rat)
K6103001	ABM	3 x 1.0 ug	EUR 339

RHPN2 sgRNA CRISPR Lentivector set (Human)
K1822701	ABM	3 x 1.0 ug	EUR 339

Human Rhophilin 2(RHPN2)ELISA Kit
QY-E04649	Qayee Biotechnology	96T	EUR 394

Rhpn2 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4853002	ABM	1.0 ug DNA	EUR 154

Rhpn2 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4853003	ABM	1.0 ug DNA	EUR 154

Rhpn2 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4853004	ABM	1.0 ug DNA	EUR 154

Rhpn2 sgRNA CRISPR Lentivector (Rat) (Target 1)
K6103002	ABM	1.0 ug DNA	EUR 154

Rhpn2 sgRNA CRISPR Lentivector (Rat) (Target 2)
K6103003	ABM	1.0 ug DNA	EUR 154

Rhpn2 sgRNA CRISPR Lentivector (Rat) (Target 3)
K6103004	ABM	1.0 ug DNA	EUR 154

RHPN2 sgRNA CRISPR Lentivector (Human) (Target 1)
K1822702	ABM	1.0 ug DNA	EUR 154

RHPN2 sgRNA CRISPR Lentivector (Human) (Target 2)
K1822703	ABM	1.0 ug DNA	EUR 154

RHPN2 sgRNA CRISPR Lentivector (Human) (Target 3)
K1822704	ABM	1.0 ug DNA	EUR 154

RHPN2 Protein Vector (Rat) (pPB-C-His)
PV301470	ABM	500 ng	EUR 1166

RHPN2 Protein Vector (Rat) (pPB-N-His)
PV301471	ABM	500 ng	EUR 1166

RHPN2 Protein Vector (Rat) (pPM-C-HA)
PV301472	ABM	500 ng	EUR 1166

RHPN2 Protein Vector (Rat) (pPM-C-His)
PV301473	ABM	500 ng	EUR 1166

RHPN2 Protein Vector (Human) (pPB-C-His)
PV035225	ABM	500 ng	EUR 329

RHPN2 Protein Vector (Human) (pPB-N-His)
PV035226	ABM	500 ng	EUR 329

RHPN2 Protein Vector (Human) (pPM-C-HA)
PV035227	ABM	500 ng	EUR 329

RHPN2 Protein Vector (Human) (pPM-C-His)
PV035228	ABM	500 ng	EUR 329

RHPN2 Protein Vector (Mouse) (pPB-C-His)
PV224218	ABM	500 ng	EUR 1065

RHPN2 Protein Vector (Mouse) (pPB-N-His)
PV224219	ABM	500 ng	EUR 1065

RHPN2 Protein Vector (Mouse) (pPM-C-HA)
PV224220	ABM	500 ng	EUR 1065

RHPN2 Protein Vector (Mouse) (pPM-C-His)
PV224221	ABM	500 ng	EUR 1065

Rhpn2 3'UTR Luciferase Stable Cell Line
TU117875	ABM	1.0 ml	Ask for price

Rhpn2 3'UTR GFP Stable Cell Line
TU167875	ABM	1.0 ml	Ask for price

Rhpn2 3'UTR Luciferase Stable Cell Line
TU219428	ABM	1.0 ml	Ask for price

Rhpn2 3'UTR GFP Stable Cell Line
TU269428	ABM	1.0 ml	Ask for price

RHPN2 3'UTR GFP Stable Cell Line
TU069903	ABM	1.0 ml	EUR 1394

RHPN2 3'UTR Luciferase Stable Cell Line
TU019903	ABM	1.0 ml	EUR 1394

GAPDH Rabbit Polyclonal Antibody
37985-100ul	SAB	100ul	EUR 252

GAPDH Rabbit Polyclonal Antibody
37985-50ul	SAB	50ul	EUR 187

EFHD1 Rabbit Polyclonal Antibody
38001-100ul	SAB	100ul	EUR 252

EFHD1 Rabbit Polyclonal Antibody
38001-50ul	SAB	50ul	EUR 187

Alliinase Rabbit Polyclonal Antibody
38042-100ul	SAB	100ul	EUR 252

Alliinase Rabbit Polyclonal Antibody
38042-50ul	SAB	50ul	EUR 187

ECFP Rabbit Polyclonal Antibody
38077-100ul	SAB	100ul	EUR 252

ECFP Rabbit Polyclonal Antibody
38077-50ul	SAB	50ul	EUR 187

EYFP Rabbit Polyclonal Antibody
38078-100ul	SAB	100ul	EUR 252

EYFP Rabbit Polyclonal Antibody
38078-50ul	SAB	50ul	EUR 187

mOrange Rabbit Polyclonal Antibody
38079-100ul	SAB	100ul	EUR 252

mOrange Rabbit Polyclonal Antibody
38079-50ul	SAB	50ul	EUR 187

mStrawberry Rabbit Polyclonal Antibody
38083-100ul	SAB	100ul	EUR 252

mStrawberry Rabbit Polyclonal Antibody
38083-50ul	SAB	50ul	EUR 187

AmCyan Rabbit Polyclonal Antibody
38086-100ul	SAB	100ul	EUR 252

AmCyan Rabbit Polyclonal Antibody
38086-50ul	SAB	50ul	EUR 187

RHPN2 Rabbit Polyclonal Antibody