RND2 Polyclonal Antibody |
ES10176-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against RND2 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA |
RND2 antibody |
70R-19916 |
Fitzgerald |
50 ul |
EUR 435 |
Description: Rabbit polyclonal RND2 antibody |
RND2 Antibody |
46211-100ul |
SAB |
100ul |
EUR 252 |
RND2 Antibody |
46211-50ul |
SAB |
50ul |
EUR 187 |
RND2 Antibody |
DF9867 |
Affbiotech |
200ul |
EUR 304 |
Description: RND2 Antibody detects endogenous levels of total RND2. |
RND2 Antibody |
1-CSB-PA019812GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
|
Description: A polyclonal antibody against RND2. Recognizes RND2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC |
RND2 Antibody |
1-CSB-PA019812LA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against RND2. Recognizes RND2 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB; Recommended dilution: WB:1:500-1:5000 |
Polyclonal RND2 antibody - C-terminal region |
APR13130G |
Leading Biology |
0.05mg |
EUR 528 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human RND2 - C-terminal region. This antibody is tested and proven to work in the following applications: |
RND2 Conjugated Antibody |
C46211 |
SAB |
100ul |
EUR 397 |
anti- RND2 antibody |
FNab07332 |
FN Test |
100µg |
EUR 548.75 |
- Immunogen: Rho family GTPase 2
- Uniprot ID: P52198
- Gene ID: 8153
- Research Area: Signal Transduction
|
Description: Antibody raised against RND2 |
Anti-RND2 antibody |
STJ191334 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to RND2 |
RND2 siRNA |
20-abx931649 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
RND2 siRNA |
20-abx931650 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
anti-RND2 |
YF-PA25050 |
Abfrontier |
50 ul |
EUR 334 |
Description: Mouse polyclonal to RND2 |
RND2 Antibody, HRP conjugated |
1-CSB-PA019812LB01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against RND2. Recognizes RND2 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA |
RND2 Antibody, FITC conjugated |
1-CSB-PA019812LC01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against RND2. Recognizes RND2 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA |
RND2 Antibody, Biotin conjugated |
1-CSB-PA019812LD01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against RND2. Recognizes RND2 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA |
RND2 Blocking Peptide |
DF9867-BP |
Affbiotech |
1mg |
EUR 195 |
RND2 Blocking Peptide |
20-abx161211 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
RND2 cloning plasmid |
CSB-CL019812HU-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 510
- Sequence: atgtgggacacttcaggttcctcttactatgataatgtccggcctctggcctatcctgattctgatgctgtgctcatctgcttcgacattagccgaccagaaacactggacagtgttctcaagaagtggcaaggagagactcaagagttctgccccaatgccaaggttgtgctggt
- Show more
|
Description: A cloning plasmid for the RND2 gene. |
Anti-RND2 (2D12) |
YF-MA16299 |
Abfrontier |
100 ug |
EUR 363 |
Description: Mouse monoclonal to RND2 |
Human RND2 shRNA Plasmid |
20-abx955381 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Mouse RND2 shRNA Plasmid |
20-abx969231 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
RND2 Recombinant Protein (Human) |
RP026545 |
ABM |
100 ug |
Ask for price |
RND2 Recombinant Protein (Mouse) |
RP168407 |
ABM |
100 ug |
Ask for price |
RND2 Recombinant Protein (Rat) |
RP226268 |
ABM |
100 ug |
Ask for price |
Rho Family GTPase 2 (RND2) Antibody |
20-abx218322 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Rho Family Gtpase 2 (RND2) Antibody |
20-abx115176 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Rho Family GTPase 2 (RND2) Antibody |
20-abx121211 |
Abbexa |
-
EUR 300.00
-
EUR 439.00
-
EUR 189.00
|
|
- Shipped within 5-10 working days.
|
Rho Family GTPase 2 (RND2) Antibody |
abx237332-100ug |
Abbexa |
100 ug |
EUR 509 |
- Shipped within 5-12 working days.
|
Rho Family GTPase 2 (RND2) Antibody |
20-abx318052 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Monoclonal RND2 Antibody (monoclonal) (M01), Clone: 2D12 |
APR13129G |
Leading Biology |
0.1mg |
EUR 484 |
Description: A Monoclonal antibody against Human RND2 (monoclonal) (M01). The antibodies are raised in mouse and are from clone 2D12. This antibody is applicable in E |
Rho Family GTPase 2 (RND2) Antibody (HRP) |
20-abx315972 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Rho Family GTPase 2 (RND2) Antibody (FITC) |
20-abx315973 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Rho Family GTPase 2 (RND2) Antibody (Biotin) |
20-abx315974 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Rnd2 ORF Vector (Rat) (pORF) |
ORF075424 |
ABM |
1.0 ug DNA |
EUR 506 |
RND2 ORF Vector (Human) (pORF) |
ORF008849 |
ABM |
1.0 ug DNA |
EUR 95 |
Rnd2 ORF Vector (Mouse) (pORF) |
ORF056137 |
ABM |
1.0 ug DNA |
EUR 506 |
Rnd2 sgRNA CRISPR Lentivector set (Rat) |
K6116001 |
ABM |
3 x 1.0 ug |
EUR 339 |
RND2 sgRNA CRISPR Lentivector set (Human) |
K1833601 |
ABM |
3 x 1.0 ug |
EUR 339 |
Rnd2 sgRNA CRISPR Lentivector set (Mouse) |
K4479501 |
ABM |
3 x 1.0 ug |
EUR 339 |
Rnd2 sgRNA CRISPR Lentivector (Rat) (Target 1) |
K6116002 |
ABM |
1.0 ug DNA |
EUR 154 |
Rnd2 sgRNA CRISPR Lentivector (Rat) (Target 2) |
K6116003 |
ABM |
1.0 ug DNA |
EUR 154 |
Rnd2 sgRNA CRISPR Lentivector (Rat) (Target 3) |
K6116004 |
ABM |
1.0 ug DNA |
EUR 154 |
RND2 sgRNA CRISPR Lentivector (Human) (Target 1) |
K1833602 |
ABM |
1.0 ug DNA |
EUR 154 |
RND2 sgRNA CRISPR Lentivector (Human) (Target 2) |
K1833603 |
ABM |
1.0 ug DNA |
EUR 154 |
RND2 sgRNA CRISPR Lentivector (Human) (Target 3) |
K1833604 |
ABM |
1.0 ug DNA |
EUR 154 |
Rnd2 sgRNA CRISPR Lentivector (Mouse) (Target 1) |
K4479502 |
ABM |
1.0 ug DNA |
EUR 154 |
Rnd2 sgRNA CRISPR Lentivector (Mouse) (Target 2) |
K4479503 |
ABM |
1.0 ug DNA |
EUR 154 |
Rnd2 sgRNA CRISPR Lentivector (Mouse) (Target 3) |
K4479504 |
ABM |
1.0 ug DNA |
EUR 154 |
RND2 Protein Vector (Rat) (pPB-C-His) |
PV301694 |
ABM |
500 ng |
EUR 603 |
RND2 Protein Vector (Rat) (pPB-N-His) |
PV301695 |
ABM |
500 ng |
EUR 603 |
RND2 Protein Vector (Rat) (pPM-C-HA) |
PV301696 |
ABM |
500 ng |
EUR 603 |
RND2 Protein Vector (Rat) (pPM-C-His) |
PV301697 |
ABM |
500 ng |
EUR 603 |
RND2 Protein Vector (Human) (pPB-C-His) |
PV035393 |
ABM |
500 ng |
EUR 329 |
RND2 Protein Vector (Human) (pPB-N-His) |
PV035394 |
ABM |
500 ng |
EUR 329 |
RND2 Protein Vector (Human) (pPM-C-HA) |
PV035395 |
ABM |
500 ng |
EUR 329 |
RND2 Protein Vector (Human) (pPM-C-His) |
PV035396 |
ABM |
500 ng |
EUR 329 |
RND2 Protein Vector (Mouse) (pPB-C-His) |
PV224546 |
ABM |
500 ng |
EUR 603 |
RND2 Protein Vector (Mouse) (pPB-N-His) |
PV224547 |
ABM |
500 ng |
EUR 603 |
RND2 Protein Vector (Mouse) (pPM-C-HA) |
PV224548 |
ABM |
500 ng |
EUR 603 |
RND2 Protein Vector (Mouse) (pPM-C-His) |
PV224549 |
ABM |
500 ng |
EUR 603 |
Rnd2 3'UTR Luciferase Stable Cell Line |
TU117939 |
ABM |
1.0 ml |
Ask for price |
Rnd2 3'UTR GFP Stable Cell Line |
TU167939 |
ABM |
1.0 ml |
Ask for price |
Rnd2 3'UTR Luciferase Stable Cell Line |
TU219494 |
ABM |
1.0 ml |
Ask for price |
Rnd2 3'UTR GFP Stable Cell Line |
TU269494 |
ABM |
1.0 ml |
Ask for price |
RND2 3'UTR GFP Stable Cell Line |
TU070017 |
ABM |
1.0 ml |
EUR 2333 |
RND2 3'UTR Luciferase Stable Cell Line |
TU020017 |
ABM |
1.0 ml |
EUR 2333 |
Human Rho Family GTPase 2 (RND2) ELISA Kit |
abx382837-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
GAPDH Rabbit Polyclonal Antibody |
37985-100ul |
SAB |
100ul |
EUR 252 |
GAPDH Rabbit Polyclonal Antibody |
37985-50ul |
SAB |
50ul |
EUR 187 |
EFHD1 Rabbit Polyclonal Antibody |
38001-100ul |
SAB |
100ul |
EUR 252 |
EFHD1 Rabbit Polyclonal Antibody |
38001-50ul |
SAB |
50ul |
EUR 187 |
RND2 Rabbit Polyclonal Antibody