RND2 Rabbit Polyclonal Antibody

RND2 Polyclonal Antibody

ES10176-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against RND2 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

RND2 antibody

70R-19916 50 ul
EUR 435
Description: Rabbit polyclonal RND2 antibody

RND2 Antibody

46211-100ul 100ul
EUR 252

RND2 Antibody

46211-50ul 50ul
EUR 187

RND2 Antibody

DF9867 200ul
EUR 304
Description: RND2 Antibody detects endogenous levels of total RND2.

RND2 Antibody

1-CSB-PA019812GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against RND2. Recognizes RND2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

RND2 Antibody

1-CSB-PA019812LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RND2. Recognizes RND2 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB; Recommended dilution: WB:1:500-1:5000

RND2 Antibody

ABD9867 100 ug
EUR 438

Polyclonal RND2 antibody - C-terminal region

APR13130G 0.05mg
EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human RND2 - C-terminal region. This antibody is tested and proven to work in the following applications:

RND2 Conjugated Antibody

C46211 100ul
EUR 397

anti- RND2 antibody

FNab07332 100µg
EUR 548.75
  • Immunogen: Rho family GTPase 2
  • Uniprot ID: P52198
  • Gene ID: 8153
  • Research Area: Signal Transduction
Description: Antibody raised against RND2

Anti-RND2 antibody

PAab07332 100 ug
EUR 386

Anti-RND2 antibody

STJ191334 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to RND2

RND2 siRNA

20-abx931649
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

RND2 siRNA

20-abx931650
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

pEGFP- Rnd2

PVT10199 2 ug
EUR 301

anti-RND2

YF-PA25050 50 ul
EUR 334
Description: Mouse polyclonal to RND2

RND2 Antibody, HRP conjugated

1-CSB-PA019812LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RND2. Recognizes RND2 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

RND2 Antibody, FITC conjugated

1-CSB-PA019812LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RND2. Recognizes RND2 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

RND2 Antibody, Biotin conjugated

1-CSB-PA019812LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RND2. Recognizes RND2 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

RND2 Blocking Peptide

DF9867-BP 1mg
EUR 195

RND2 Blocking Peptide

20-abx161211
  • EUR 272.00
  • EUR 411.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.

RND2 cloning plasmid

CSB-CL019812HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 510
  • Sequence: atgtgggacacttcaggttcctcttactatgataatgtccggcctctggcctatcctgattctgatgctgtgctcatctgcttcgacattagccgaccagaaacactggacagtgttctcaagaagtggcaaggagagactcaagagttctgccccaatgccaaggttgtgctggt
  • Show more
Description: A cloning plasmid for the RND2 gene.

pCDNA3.1- Flag- Rnd2

PVT10166 2 ug
EUR 301

pCDH- CMV- Rnd2

PVT10402 2 ug
EUR 301

Anti-RND2 (2D12)

YF-MA16299 100 ug
EUR 363
Description: Mouse monoclonal to RND2

RND2 ELISA KIT|Human

EF002500 96 Tests
EUR 689

Human RND2 shRNA Plasmid

20-abx955381
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse RND2 shRNA Plasmid

20-abx969231
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

RND2 Recombinant Protein (Human)

RP026545 100 ug Ask for price

RND2 Recombinant Protein (Mouse)

RP168407 100 ug Ask for price

RND2 Recombinant Protein (Rat)

RP226268 100 ug Ask for price

Rho Family GTPase 2 (RND2) Antibody

20-abx218322
  • EUR 425.00
  • EUR 342.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Rho Family Gtpase 2 (RND2) Antibody

20-abx115176
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Rho Family GTPase 2 (RND2) Antibody

20-abx121211
  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

Rho Family GTPase 2 (RND2) Antibody

abx237332-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

Rho Family GTPase 2 (RND2) Antibody

20-abx318052
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Monoclonal RND2 Antibody (monoclonal) (M01), Clone: 2D12

APR13129G 0.1mg
EUR 484
Description: A Monoclonal antibody against Human RND2 (monoclonal) (M01). The antibodies are raised in mouse and are from clone 2D12. This antibody is applicable in E

Rho Family GTPase 2 (RND2) Antibody (HRP)

20-abx315972
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Rho Family GTPase 2 (RND2) Antibody (FITC)

20-abx315973
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Rho Family GTPase 2 (RND2) Antibody (Biotin)

20-abx315974
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Rnd2 ORF Vector (Rat) (pORF)

ORF075424 1.0 ug DNA
EUR 506

RND2 ORF Vector (Human) (pORF)

ORF008849 1.0 ug DNA
EUR 95

Rnd2 ORF Vector (Mouse) (pORF)

ORF056137 1.0 ug DNA
EUR 506

Rnd2 sgRNA CRISPR Lentivector set (Rat)

K6116001 3 x 1.0 ug
EUR 339

RND2 sgRNA CRISPR Lentivector set (Human)

K1833601 3 x 1.0 ug
EUR 339

Rnd2 sgRNA CRISPR Lentivector set (Mouse)

K4479501 3 x 1.0 ug
EUR 339

Rnd2 sgRNA CRISPR Lentivector (Rat) (Target 1)

K6116002 1.0 ug DNA
EUR 154

Rnd2 sgRNA CRISPR Lentivector (Rat) (Target 2)

K6116003 1.0 ug DNA
EUR 154

Rnd2 sgRNA CRISPR Lentivector (Rat) (Target 3)

K6116004 1.0 ug DNA
EUR 154

RND2 sgRNA CRISPR Lentivector (Human) (Target 1)

K1833602 1.0 ug DNA
EUR 154

RND2 sgRNA CRISPR Lentivector (Human) (Target 2)

K1833603 1.0 ug DNA
EUR 154

RND2 sgRNA CRISPR Lentivector (Human) (Target 3)

K1833604 1.0 ug DNA
EUR 154

Rnd2 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4479502 1.0 ug DNA
EUR 154

Rnd2 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4479503 1.0 ug DNA
EUR 154

Rnd2 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4479504 1.0 ug DNA
EUR 154

RND2 Protein Vector (Rat) (pPB-C-His)

PV301694 500 ng
EUR 603

RND2 Protein Vector (Rat) (pPB-N-His)

PV301695 500 ng
EUR 603

RND2 Protein Vector (Rat) (pPM-C-HA)

PV301696 500 ng
EUR 603

RND2 Protein Vector (Rat) (pPM-C-His)

PV301697 500 ng
EUR 603

RND2 Protein Vector (Human) (pPB-C-His)

PV035393 500 ng
EUR 329

RND2 Protein Vector (Human) (pPB-N-His)

PV035394 500 ng
EUR 329

RND2 Protein Vector (Human) (pPM-C-HA)

PV035395 500 ng
EUR 329

RND2 Protein Vector (Human) (pPM-C-His)

PV035396 500 ng
EUR 329

RND2 Protein Vector (Mouse) (pPB-C-His)

PV224546 500 ng
EUR 603

RND2 Protein Vector (Mouse) (pPB-N-His)

PV224547 500 ng
EUR 603

RND2 Protein Vector (Mouse) (pPM-C-HA)

PV224548 500 ng
EUR 603

RND2 Protein Vector (Mouse) (pPM-C-His)

PV224549 500 ng
EUR 603

Rnd2 3'UTR Luciferase Stable Cell Line

TU117939 1.0 ml Ask for price

Rnd2 3'UTR GFP Stable Cell Line

TU167939 1.0 ml Ask for price

Rnd2 3'UTR Luciferase Stable Cell Line

TU219494 1.0 ml Ask for price

Rnd2 3'UTR GFP Stable Cell Line

TU269494 1.0 ml Ask for price

RND2 3'UTR GFP Stable Cell Line

TU070017 1.0 ml
EUR 2333

RND2 3'UTR Luciferase Stable Cell Line

TU020017 1.0 ml
EUR 2333

Human Rho Family GTPase 2 (RND2) ELISA Kit

abx382837-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

GAPDH Rabbit Polyclonal Antibody

37985-100ul 100ul
EUR 252

GAPDH Rabbit Polyclonal Antibody

37985-50ul 50ul
EUR 187

EFHD1 Rabbit Polyclonal Antibody

38001-100ul 100ul
EUR 252

EFHD1 Rabbit Polyclonal Antibody

38001-50ul 50ul
EUR 187

RND2 Rabbit Polyclonal Antibody