Biocat Net

Amine biocat 3.0

RND3 Rabbit Polyclonal Antibody

RND3 Rabbit pAb

A11637-100ul 100 ul
EUR 308

RND3 Rabbit pAb

A11637-200ul 200 ul
EUR 459

RND3 Rabbit pAb

A11637-20ul 20 ul
EUR 183

RND3 Rabbit pAb

A11637-50ul 50 ul
EUR 223

RND3 Rabbit pAb

A17402-100ul 100 ul
EUR 308

RND3 Rabbit pAb

A17402-200ul 200 ul Ask for price

RND3 Rabbit pAb

A17402-20ul 20 ul Ask for price

RND3 Rabbit pAb

A17402-50ul 50 ul Ask for price

RND3 Antibody

48418-100ul 100ul
EUR 333

RND3 Antibody

48418-50ul 50ul
EUR 239

RND3 antibody

70R-19917 50 ul
EUR 435
Description: Rabbit polyclonal RND3 antibody

RND3 Antibody

DF12311 200ul
EUR 304
Description: RND3 antibody detects endogenous levels of RND3.

RND3 Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against RND3. Recognizes RND3 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

RND3 Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RND3. Recognizes RND3 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

Rnd3/ Rat Rnd3 ELISA Kit

ELI-14681r 96 Tests
EUR 886

RND3 Conjugated Antibody

C48418 100ul
EUR 397

anti- RND3 antibody

FNab07333 100µg
EUR 548.75
  • Immunogen: Rho family GTPase 3
  • Uniprot ID: P61587
  • Gene ID: 390
  • Research Area: Signal Transduction
Description: Antibody raised against RND3

anti- RND3 antibody

FNab07334 100µg
EUR 505.25
  • Recommended dilution: WB: 1:500-1:2000
  • Immunogen: Rho family GTPase 3
  • Uniprot ID: P61587
  • Gene ID: 390
  • Research Area: Signal Transduction
Description: Antibody raised against RND3

Human RND3 Antibody

33068-05111 150 ug
EUR 261

Anti-RND3 antibody

PAab07333 100 ug
EUR 386

Anti-RND3 antibody

STJ113242 100 µl
EUR 277
Description: This gene encodes a protein which is a member of the small GTPase protein superfamily. The encoded protein binds only GTP but has no GTPase activity, and appears to act as a negative regulator of cytoskeletal organization leading to loss of adhesion. Multiple alternatively spliced variants, encoding the same protein, have been identified.

Anti-RND3 antibody

STJ119524 100 µl
EUR 277
Description: This gene encodes a protein which is a member of the small GTPase protein superfamily. The encoded protein binds only GTP but has no GTPase activity, and appears to act as a negative regulator of cytoskeletal organization leading to loss of adhesion. Multiple alternatively spliced variants, encoding the same protein, have been identified.

Anti-RND3 antibody

STJ191331 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to RND3


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


YF-PA10316 50 ul
EUR 363
Description: Mouse polyclonal to RND3


YF-PA10317 50 ug
EUR 363
Description: Mouse polyclonal to RND3

RND3 Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RND3. Recognizes RND3 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

RND3 Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RND3. Recognizes RND3 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

RND3 Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RND3. Recognizes RND3 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

RND3 cloning plasmid

CSB-CL019813HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 735
  • Sequence: atgaaggagagaagagccagccagaaattatccagcaaatctatcatggatcctaatcagaacgtgaaatgcaagatagttgtggtgggagacagtcagtgtggaaaaactgcgctgctccatgtcttcgccaaggactgcttccccgagaattacgttcctacagtgtttgagaa
  • Show more
Description: A cloning plasmid for the RND3 gene.

RND3 Blocking Peptide

DF12311-BP 1mg
EUR 195

Anti-RND3 (1D2)

YF-MA10058 100 ug
EUR 363
Description: Mouse monoclonal to RND3

Monoclonal RND3 Antibody, Clone: 5C7E8

AMM03058G 0.1ml
EUR 528
Description: A Monoclonal antibody against Human RND3. The antibodies are raised in Mouse and are from clone 5C7E8. This antibody is applicable in WB and IHC, FC, ICC, E

Monoclonal RND3 Antibody, Clone: 5C7B6

AMM03059G 0.1ml
EUR 528
Description: A Monoclonal antibody against Human RND3. The antibodies are raised in Mouse and are from clone 5C7B6. This antibody is applicable in WB and IHC, FC, ICC, E

Human RND3 Antibody (Biotin Conjugate)

33068-05121 150 ug
EUR 369

Mouse RND3 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Rat RND3 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.


EF002501 96 Tests
EUR 689

Human RND3 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

RND3 protein (His tag)

80R-1413 100 ug
EUR 305
Description: Purified recombinant Human RND3 protein

RND3 Recombinant Protein (Human)

RP026548 100 ug Ask for price

RND3 Recombinant Protein (Rat)

RP226271 100 ug Ask for price

RND3 Recombinant Protein (Mouse)

RP168410 100 ug Ask for price

Rho Family Gtpase 3 (RND3) Antibody

  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Human RND3 AssayLite Antibody (FITC Conjugate)

33068-05141 150 ug
EUR 428

Human RND3 AssayLite Antibody (RPE Conjugate)

33068-05151 150 ug
EUR 428

Human RND3 AssayLite Antibody (APC Conjugate)

33068-05161 150 ug
EUR 428

Human RND3 AssayLite Antibody (PerCP Conjugate)

33068-05171 150 ug
EUR 471

RND3 ORF Vector (Human) (pORF)

ORF008850 1.0 ug DNA
EUR 95

Rnd3 ORF Vector (Mouse) (pORF)

ORF056138 1.0 ug DNA
EUR 506

Rnd3 ORF Vector (Rat) (pORF)

ORF075425 1.0 ug DNA
EUR 506

Rho-Related GTP-Binding Protein RhoE (RND3) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Rho-Related GTP-Binding Protein RhoE (RND3) Antibody

abx145568-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Rho-Related GTP-Binding Protein RhoE (RND3) Antibody

abx016165-100ug 100 ug
EUR 411
  • Shipped within 5-10 working days.

Rho-Related GTP-Binding Protein RhoE (RND3) Antibody

abx224184-100ug 100 ug
EUR 411
  • Shipped within 5-10 working days.

Rho-Related GTP-Binding Protein RhoE (RND3) Antibody

abx237333-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

Rho-Related GTP-Binding Protein RhoE (RND3) Antibody

abx237334-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

Rho-Related GTP-Binding Protein RhoE (RND3) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

RND3 sgRNA CRISPR Lentivector set (Human)

K1833701 3 x 1.0 ug
EUR 339

Rnd3 sgRNA CRISPR Lentivector set (Mouse)

K4391301 3 x 1.0 ug
EUR 339

Rnd3 sgRNA CRISPR Lentivector set (Rat)

K6291101 3 x 1.0 ug
EUR 339

Rho-Related GTP-Binding Protein RhoE (RND3) Antibody (HRP)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Rho-Related GTP-Binding Protein RhoE (RND3) Antibody (FITC)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Rho-Related GTP-Binding Protein RhoE (RND3) Antibody (Biotin)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

RND3 sgRNA CRISPR Lentivector (Human) (Target 1)

K1833702 1.0 ug DNA
EUR 154

RND3 sgRNA CRISPR Lentivector (Human) (Target 2)

K1833703 1.0 ug DNA
EUR 154

RND3 sgRNA CRISPR Lentivector (Human) (Target 3)

K1833704 1.0 ug DNA
EUR 154

Rnd3 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4391302 1.0 ug DNA
EUR 154

Rnd3 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4391303 1.0 ug DNA
EUR 154

Rnd3 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4391304 1.0 ug DNA
EUR 154

Rnd3 sgRNA CRISPR Lentivector (Rat) (Target 1)

K6291102 1.0 ug DNA
EUR 154

Rnd3 sgRNA CRISPR Lentivector (Rat) (Target 2)

K6291103 1.0 ug DNA
EUR 154

Rnd3 sgRNA CRISPR Lentivector (Rat) (Target 3)

K6291104 1.0 ug DNA
EUR 154

RND3 Protein Vector (Human) (pPB-C-His)

PV035397 500 ng
EUR 329

RND3 Rabbit Polyclonal Antibody