RND3 Rabbit pAb |
A11637-100ul |
Abclonal |
100 ul |
EUR 308 |
RND3 Rabbit pAb |
A11637-200ul |
Abclonal |
200 ul |
EUR 459 |
RND3 Rabbit pAb |
A11637-20ul |
Abclonal |
20 ul |
EUR 183 |
RND3 Rabbit pAb |
A11637-50ul |
Abclonal |
50 ul |
EUR 223 |
RND3 Rabbit pAb |
A17402-100ul |
Abclonal |
100 ul |
EUR 308 |
RND3 Rabbit pAb |
A17402-200ul |
Abclonal |
200 ul |
Ask for price |
RND3 Rabbit pAb |
A17402-20ul |
Abclonal |
20 ul |
Ask for price |
RND3 Rabbit pAb |
A17402-50ul |
Abclonal |
50 ul |
Ask for price |
RND3 antibody |
70R-19917 |
Fitzgerald |
50 ul |
EUR 435 |
Description: Rabbit polyclonal RND3 antibody |
RND3 Antibody |
48418-100ul |
SAB |
100ul |
EUR 333 |
RND3 Antibody |
48418-50ul |
SAB |
50ul |
EUR 239 |
RND3 Antibody |
DF12311 |
Affbiotech |
200ul |
EUR 304 |
Description: RND3 antibody detects endogenous levels of RND3. |
RND3 Antibody |
1-CSB-PA019813GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
|
Description: A polyclonal antibody against RND3. Recognizes RND3 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC |
RND3 Antibody |
1-CSB-PA019813LA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against RND3. Recognizes RND3 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200 |
Human RND3 Antibody |
33068-05111 |
AssayPro |
150 ug |
EUR 261 |
RND3 Conjugated Antibody |
C48418 |
SAB |
100ul |
EUR 397 |
anti- RND3 antibody |
FNab07333 |
FN Test |
100µg |
EUR 548.75 |
- Immunogen: Rho family GTPase 3
- Uniprot ID: P61587
- Gene ID: 390
- Research Area: Signal Transduction
|
Description: Antibody raised against RND3 |
anti- RND3 antibody |
FNab07334 |
FN Test |
100µg |
EUR 505.25 |
- Recommended dilution: WB: 1:500-1:2000
- Immunogen: Rho family GTPase 3
- Uniprot ID: P61587
- Gene ID: 390
- Research Area: Signal Transduction
|
Description: Antibody raised against RND3 |
Anti-RND3 antibody |
STJ113242 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: This gene encodes a protein which is a member of the small GTPase protein superfamily. The encoded protein binds only GTP but has no GTPase activity, and appears to act as a negative regulator of cytoskeletal organization leading to loss of adhesion. Multiple alternatively spliced variants, encoding the same protein, have been identified. |
Anti-RND3 antibody |
STJ119524 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: This gene encodes a protein which is a member of the small GTPase protein superfamily. The encoded protein binds only GTP but has no GTPase activity, and appears to act as a negative regulator of cytoskeletal organization leading to loss of adhesion. Multiple alternatively spliced variants, encoding the same protein, have been identified. |
Anti-RND3 antibody |
STJ191331 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to RND3 |
RND3 siRNA |
20-abx904598 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
RND3 siRNA |
20-abx931651 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
RND3 siRNA |
20-abx931652 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
anti-RND3 |
YF-PA10316 |
Abfrontier |
50 ul |
EUR 363 |
Description: Mouse polyclonal to RND3 |
anti-RND3 |
YF-PA10317 |
Abfrontier |
50 ug |
EUR 363 |
Description: Mouse polyclonal to RND3 |
RND3 Antibody, HRP conjugated |
1-CSB-PA019813LB01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against RND3. Recognizes RND3 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA |
RND3 Antibody, FITC conjugated |
1-CSB-PA019813LC01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against RND3. Recognizes RND3 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA |
RND3 Antibody, Biotin conjugated |
1-CSB-PA019813LD01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against RND3. Recognizes RND3 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA |
RND3 Blocking Peptide |
DF12311-BP |
Affbiotech |
1mg |
EUR 195 |
RND3 cloning plasmid |
CSB-CL019813HU-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 735
- Sequence: atgaaggagagaagagccagccagaaattatccagcaaatctatcatggatcctaatcagaacgtgaaatgcaagatagttgtggtgggagacagtcagtgtggaaaaactgcgctgctccatgtcttcgccaaggactgcttccccgagaattacgttcctacagtgtttgagaa
- Show more
|
Description: A cloning plasmid for the RND3 gene. |
Anti-RND3 (1D2) |
YF-MA10058 |
Abfrontier |
100 ug |
EUR 363 |
Description: Mouse monoclonal to RND3 |
Human RND3 Antibody (Biotin Conjugate) |
33068-05121 |
AssayPro |
150 ug |
EUR 369 |
Monoclonal RND3 Antibody, Clone: 5C7E8 |
AMM03058G |
Leading Biology |
0.1ml |
EUR 528 |
Description: A Monoclonal antibody against Human RND3. The antibodies are raised in Mouse and are from clone 5C7E8. This antibody is applicable in WB and IHC, FC, ICC, E |
Monoclonal RND3 Antibody, Clone: 5C7B6 |
AMM03059G |
Leading Biology |
0.1ml |
EUR 528 |
Description: A Monoclonal antibody against Human RND3. The antibodies are raised in Mouse and are from clone 5C7B6. This antibody is applicable in WB and IHC, FC, ICC, E |
RND3 protein (His tag) |
80R-1413 |
Fitzgerald |
100 ug |
EUR 305 |
Description: Purified recombinant Human RND3 protein |
Rat RND3 shRNA Plasmid |
20-abx988763 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Mouse RND3 shRNA Plasmid |
20-abx978141 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Human RND3 shRNA Plasmid |
20-abx950279 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
RND3 Recombinant Protein (Human) |
RP026548 |
ABM |
100 ug |
Ask for price |
RND3 Recombinant Protein (Mouse) |
RP168410 |
ABM |
100 ug |
Ask for price |
RND3 Recombinant Protein (Rat) |
RP226271 |
ABM |
100 ug |
Ask for price |
Human RND3 AssayLite Antibody (FITC Conjugate) |
33068-05141 |
AssayPro |
150 ug |
EUR 428 |
Human RND3 AssayLite Antibody (RPE Conjugate) |
33068-05151 |
AssayPro |
150 ug |
EUR 428 |
Human RND3 AssayLite Antibody (APC Conjugate) |
33068-05161 |
AssayPro |
150 ug |
EUR 428 |
Human RND3 AssayLite Antibody (PerCP Conjugate) |
33068-05171 |
AssayPro |
150 ug |
EUR 471 |
Rho Family Gtpase 3 (RND3) Antibody |
20-abx115177 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Rnd3 ORF Vector (Rat) (pORF) |
ORF075425 |
ABM |
1.0 ug DNA |
EUR 506 |
RND3 ORF Vector (Human) (pORF) |
ORF008850 |
ABM |
1.0 ug DNA |
EUR 95 |
Rnd3 ORF Vector (Mouse) (pORF) |
ORF056138 |
ABM |
1.0 ug DNA |
EUR 506 |
Rho-Related GTP-Binding Protein RhoE (RND3) Antibody |
abx016165-100ug |
Abbexa |
100 ug |
EUR 411 |
- Shipped within 5-10 working days.
|
Rho-Related GTP-Binding Protein RhoE (RND3) Antibody |
abx224184-100ug |
Abbexa |
100 ug |
EUR 411 |
- Shipped within 5-10 working days.
|
Rho-Related GTP-Binding Protein RhoE (RND3) Antibody |
20-abx126483 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
Rho-Related GTP-Binding Protein RhoE (RND3) Antibody |
abx145568-100ug |
Abbexa |
100 ug |
EUR 391 |
- Shipped within 5-10 working days.
|
Rho-Related GTP-Binding Protein RhoE (RND3) Antibody |
abx237333-100ug |
Abbexa |
100 ug |
EUR 509 |
- Shipped within 5-12 working days.
|
Rho-Related GTP-Binding Protein RhoE (RND3) Antibody |
abx237334-100ug |
Abbexa |
100 ug |
EUR 481 |
- Shipped within 5-12 working days.
|
Rho-Related GTP-Binding Protein RhoE (RND3) Antibody |
20-abx301776 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Rnd3 sgRNA CRISPR Lentivector set (Rat) |
K6291101 |
ABM |
3 x 1.0 ug |
EUR 339 |
RND3 sgRNA CRISPR Lentivector set (Human) |
K1833701 |
ABM |
3 x 1.0 ug |
EUR 339 |
Rnd3 sgRNA CRISPR Lentivector set (Mouse) |
K4391301 |
ABM |
3 x 1.0 ug |
EUR 339 |
Rho-Related GTP-Binding Protein RhoE (RND3) Antibody (HRP) |
20-abx314290 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Rho-Related GTP-Binding Protein RhoE (RND3) Antibody (FITC) |
20-abx314291 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Rho-Related GTP-Binding Protein RhoE (RND3) Antibody (Biotin) |
20-abx314292 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Rnd3 sgRNA CRISPR Lentivector (Rat) (Target 1) |
K6291102 |
ABM |
1.0 ug DNA |
EUR 154 |
Rnd3 sgRNA CRISPR Lentivector (Rat) (Target 2) |
K6291103 |
ABM |
1.0 ug DNA |
EUR 154 |
Rnd3 sgRNA CRISPR Lentivector (Rat) (Target 3) |
K6291104 |
ABM |
1.0 ug DNA |
EUR 154 |
RND3 sgRNA CRISPR Lentivector (Human) (Target 1) |
K1833702 |
ABM |
1.0 ug DNA |
EUR 154 |
RND3 sgRNA CRISPR Lentivector (Human) (Target 2) |
K1833703 |
ABM |
1.0 ug DNA |
EUR 154 |
RND3 sgRNA CRISPR Lentivector (Human) (Target 3) |
K1833704 |
ABM |
1.0 ug DNA |
EUR 154 |
Rnd3 sgRNA CRISPR Lentivector (Mouse) (Target 1) |
K4391302 |
ABM |
1.0 ug DNA |
EUR 154 |
Rnd3 sgRNA CRISPR Lentivector (Mouse) (Target 2) |
K4391303 |
ABM |
1.0 ug DNA |
EUR 154 |
Rnd3 sgRNA CRISPR Lentivector (Mouse) (Target 3) |
K4391304 |
ABM |
1.0 ug DNA |
EUR 154 |
RND3 Protein Vector (Rat) (pPB-C-His) |
PV301698 |
ABM |
500 ng |
EUR 603 |
RND3 Rabbit Polyclonal Antibody